ID: 1182219814

View in Genome Browser
Species Human (GRCh38)
Location 22:28749245-28749267
Sequence CATTGTGGCTGGAGTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 1, 2: 11, 3: 87, 4: 510}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182219814_1182219820 6 Left 1182219814 22:28749245-28749267 CCTTCTCCACTCCAGCCACAATG 0: 1
1: 1
2: 11
3: 87
4: 510
Right 1182219820 22:28749274-28749296 TCCAGTTCCTCATCTATACTGGG No data
1182219814_1182219824 24 Left 1182219814 22:28749245-28749267 CCTTCTCCACTCCAGCCACAATG 0: 1
1: 1
2: 11
3: 87
4: 510
Right 1182219824 22:28749292-28749314 CTGGGCACCCTCCTACCCTAGGG No data
1182219814_1182219823 23 Left 1182219814 22:28749245-28749267 CCTTCTCCACTCCAGCCACAATG 0: 1
1: 1
2: 11
3: 87
4: 510
Right 1182219823 22:28749291-28749313 ACTGGGCACCCTCCTACCCTAGG 0: 1
1: 0
2: 1
3: 15
4: 187
1182219814_1182219819 5 Left 1182219814 22:28749245-28749267 CCTTCTCCACTCCAGCCACAATG 0: 1
1: 1
2: 11
3: 87
4: 510
Right 1182219819 22:28749273-28749295 TTCCAGTTCCTCATCTATACTGG 0: 1
1: 0
2: 2
3: 18
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182219814 Original CRISPR CATTGTGGCTGGAGTGGAGA AGG (reversed) Intronic
900724796 1:4208883-4208905 CATGGTGGATGAAGTGGCGAAGG - Intergenic
901533939 1:9870734-9870756 CATTGTGGCTGGTGTGGTCCTGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902073234 1:13760475-13760497 TATGTTGGCTGGAGGGGAGAGGG + Intronic
902432353 1:16373085-16373107 CCTTCTGGCTGAAGGGGAGAGGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
902985709 1:20152889-20152911 CATAGGGCCTGGCGTGGAGAAGG + Intergenic
903331330 1:22598494-22598516 CATGCTGGCTGTGGTGGAGACGG + Intronic
903910851 1:26723788-26723810 CATTGGAGGTGGAATGGAGAGGG - Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904423617 1:30409669-30409691 GGTTGAGGATGGAGTGGAGAGGG + Intergenic
905030746 1:34882861-34882883 CCATGTGGCTGGTGTGGAGTGGG - Intronic
906245248 1:44268831-44268853 CTTTGTGGGTGGAAAGGAGAGGG - Intronic
906747544 1:48232254-48232276 GATTGTGACTGGACTGGAGTAGG + Intronic
906796228 1:48698270-48698292 CAAAGAGGCTGGAGTGGACAGGG + Intronic
906894926 1:49760473-49760495 CATTATGACTGGTGTTGAGATGG - Intronic
907333468 1:53686051-53686073 CATGGCTGCGGGAGTGGAGAGGG - Intronic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907701009 1:56788395-56788417 GATTGTGGTGGGAGTGGTGAGGG + Intronic
908789795 1:67770272-67770294 CAAGGTGGGTGGAATGGAGAGGG + Intronic
909164953 1:72209552-72209574 CATTATGGCTGAAGTGGTCAAGG - Intronic
909182539 1:72442460-72442482 CATTGTGGGTGGAGTTGTGGAGG + Intergenic
909203673 1:72725712-72725734 CAATGTGGCTTTAGGGGAGATGG - Intergenic
909463690 1:75948332-75948354 ATGTGTGGGTGGAGTGGAGAGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910680463 1:89858297-89858319 CCTTTTGGGTGGGGTGGAGAGGG + Intronic
910835538 1:91505248-91505270 CATTGTGGCTAGAATGGGGAAGG + Intronic
911663354 1:100527826-100527848 AATTGTGGCTGGGGTGGGGTGGG + Intergenic
912209006 1:107538171-107538193 CATTGTGGCAGGTGTTGTGATGG - Intergenic
912413920 1:109495412-109495434 CATTGGGGCCGGAAAGGAGAAGG + Intronic
913184818 1:116360763-116360785 TATGGTGGCTGGAGTTGTGAGGG + Intergenic
913489729 1:119367742-119367764 CAATGAGCCTTGAGTGGAGATGG + Intergenic
914697772 1:150101406-150101428 CATTCTGACTGGTGTTGAGATGG - Intronic
914972182 1:152317238-152317260 GATTGAGGGTGGGGTGGAGATGG - Intronic
915010846 1:152685070-152685092 TATTGTGGCTTCTGTGGAGAGGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
916833342 1:168515273-168515295 TGGTGTGGCTGGAGTTGAGAAGG - Intergenic
917021402 1:170592298-170592320 CATTGTGACTGAACTAGAGAGGG + Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
918124769 1:181573589-181573611 CATTCTGACTGGTGTTGAGATGG - Intronic
918877702 1:190070872-190070894 CATTCTGACTGGCGTTGAGATGG + Intergenic
919195927 1:194286316-194286338 CAATGTGGATGGAGTGGATGAGG - Intergenic
919618337 1:199835239-199835261 CATTGGTGGTGAAGTGGAGAGGG - Intergenic
920311275 1:205049867-205049889 TGCTCTGGCTGGAGTGGAGAAGG + Intronic
920450797 1:206059761-206059783 GAATGTGGCTGGAGAGGGGATGG + Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
921780121 1:219153091-219153113 AATTGTGACTGGAGTGTAGAGGG - Intergenic
922350304 1:224729758-224729780 CTGTGTGGCTGGATTGGAGGTGG + Intronic
922558808 1:226552174-226552196 CACTGTTGCTTGGGTGGAGAAGG - Intronic
922876256 1:228942100-228942122 CCCTGTGGCTGTAGTTGAGAAGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923472740 1:234306763-234306785 CATTGTAGATGGGATGGAGAAGG - Intronic
924832608 1:247614153-247614175 GTGTTTGGCTGGAGTGGAGAAGG - Intergenic
1064347885 10:14549040-14549062 CATTGAGGCTGGAGAGTACAGGG - Intronic
1064682860 10:17828867-17828889 CATTTTAGGTGGAGTGGAGGAGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065028064 10:21557755-21557777 CTCTGTGGCTGGAGTGGGGAGGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065969138 10:30792089-30792111 GTTAGTGGCTGGAGTGGAGCAGG - Intergenic
1066651924 10:37664511-37664533 CGATGTGGCTGGCTTGGAGATGG - Intergenic
1067154631 10:43767584-43767606 CATTCTGGCTGGGGTGAAGTGGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067775968 10:49165174-49165196 AATGGTGGCTGGAGTCGAGAGGG + Intronic
1068068905 10:52170552-52170574 GAGTGTCGATGGAGTGGAGAGGG - Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069606634 10:69743049-69743071 CATGGTGGCAGGAGTGGGGAGGG - Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070280631 10:75045660-75045682 CAGTGTGGCTGAAGTGGCAAGGG + Intronic
1070284352 10:75072472-75072494 CATGGAGGCTGGGGTGGACATGG - Intergenic
1070457499 10:76631871-76631893 AATTGTGGTTGCAGTGTAGAGGG - Intergenic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1070868841 10:79729968-79729990 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1070941415 10:80351488-80351510 CAGTGTGGATGGAGTGGTGGGGG - Intronic
1071635756 10:87252187-87252209 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071659487 10:87485789-87485811 CTCTGTGGCTGGAATGGAAATGG - Intergenic
1071896296 10:90071079-90071101 CATTCAGGCTGGAGTGCAGCTGG + Intergenic
1072244701 10:93532815-93532837 CATTGTGGCTGTCGTGGCTAAGG + Intergenic
1072374871 10:94804126-94804148 CTTTGAGGATGGAATGGAGAGGG + Intronic
1072983617 10:100120637-100120659 CATTGTGGCTAAAGTGGCTATGG + Intergenic
1073617968 10:105017211-105017233 GTTTGTAGCTGGGGTGGAGATGG + Intronic
1073803187 10:107066166-107066188 CATTTGGTCTGGAATGGAGAGGG + Intronic
1074842530 10:117369542-117369564 CTTAATAGCTGGAGTGGAGAGGG - Intronic
1075429185 10:122366152-122366174 GGTTGTGGTTGGGGTGGAGAAGG + Intergenic
1075445199 10:122508191-122508213 ACTTGGGGATGGAGTGGAGATGG + Intronic
1075463339 10:122632962-122632984 CAATGGGGCTGGGGAGGAGATGG + Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077613279 11:3658377-3658399 CATTGGGTCTGGATTGGAGCAGG - Intronic
1077865517 11:6218329-6218351 CATTGTGTCTTCAGTGGTGATGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078317413 11:10304917-10304939 CTTTGGGGCTGGAGTTGGGATGG - Intronic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1078860117 11:15239091-15239113 GGCTGTGGCTGGAGTGGAGTGGG + Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1081850627 11:46272861-46272883 GATTCAGGCTGGAGGGGAGAAGG + Intergenic
1083043734 11:59713329-59713351 CATTGTGGCAGAATGGGAGATGG + Exonic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1083597059 11:63922990-63923012 TATGGTGGCTGGAGTGGTGGAGG - Intergenic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1084172791 11:67408710-67408732 CATTTTGGCGGGGGTGGGGATGG + Intronic
1084190334 11:67495758-67495780 CATTCTGGCAGGAGTGCAGCTGG - Intronic
1085638653 11:78177436-78177458 CATGGCTGCTGGTGTGGAGATGG + Intronic
1085790303 11:79492007-79492029 CCATGTGGCAGGCGTGGAGAGGG - Intergenic
1086028363 11:82322726-82322748 CTTTGTGACTGAAGTGGGGAGGG + Intergenic
1086308480 11:85508338-85508360 CCTTGTGGCAGGAGTGTACATGG - Intronic
1087026899 11:93659055-93659077 TATTGTGGCTAGTTTGGAGAGGG - Intergenic
1087585468 11:100114937-100114959 AATGGTGGGTGGAGTGGAGTGGG - Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1087870101 11:103283315-103283337 CATGGTGGCTGGGGTGGGAAGGG - Intronic
1088485741 11:110338766-110338788 AATTGTGGGTGGAGAAGAGATGG - Intergenic
1088849922 11:113696137-113696159 GAATGTGGCTGGAGTTGGGAAGG - Intronic
1089662685 11:119995914-119995936 CATGGGGGATGGAGTGGAGGGGG - Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089677265 11:120098368-120098390 GACAATGGCTGGAGTGGAGAGGG + Intergenic
1089950136 11:122518111-122518133 CATAGTGACTGGTTTGGAGATGG - Intergenic
1090363774 11:126190151-126190173 AATGGGGGCTGGAGTGGGGAAGG - Intergenic
1091548140 12:1518311-1518333 CATGGTGGCTGTGGTGGAGGTGG - Intergenic
1091752805 12:3033166-3033188 CAGGGAGGCTGGACTGGAGACGG - Intronic
1092912762 12:13162555-13162577 CAATGAGGCTGGAGCTGAGAGGG - Intergenic
1094047108 12:26179263-26179285 TAGTGTGGCTGGACAGGAGAAGG + Intronic
1094160855 12:27388602-27388624 CAATTTGGCTGGAGTGGCCAAGG + Intronic
1094254615 12:28408478-28408500 CATTCTGACTGGCGTTGAGATGG + Intronic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1096069229 12:48765684-48765706 AATTGTGGCAAGAGTGCAGAGGG + Intergenic
1096474793 12:51901750-51901772 CATTCTGGCAGGGGAGGAGAGGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1098239585 12:68453228-68453250 CCATGTGCCAGGAGTGGAGAGGG + Intergenic
1098872867 12:75836234-75836256 CACTGTGCCTGGTGTGGAGAGGG - Intergenic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1099560345 12:84165234-84165256 CATTATGGCTAGAGTGAAGGAGG + Intergenic
1101132871 12:101707284-101707306 CTTTGTGGGTGGAATGGAGCTGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101630974 12:106494443-106494465 AATTTTGGCTGGTGAGGAGATGG - Intronic
1101804496 12:108051611-108051633 CATTGCAGCTGGAGTGAAGCGGG - Intergenic
1102108002 12:110342353-110342375 CATTGTGGCTGCCGTTGAGGAGG + Exonic
1102233730 12:111281223-111281245 CCCAGTGGCTGGAGTGGAGTTGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1103551768 12:121743133-121743155 GACTGTGTCTGGAGTGGGGAGGG + Intronic
1104310322 12:127648997-127649019 CCTGGTGCCTGGAGGGGAGAGGG - Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1105865931 13:24459923-24459945 CATTTTGGCAGCAGTGGAGGGGG - Intronic
1106230133 13:27815234-27815256 CTCTATGGCTAGAGTGGAGAGGG + Intergenic
1107257392 13:38444981-38445003 AATGGTTGCTGGAGTGGACAGGG + Intergenic
1108443639 13:50483446-50483468 CATTGTCACTGGACTGGTGATGG - Intronic
1109597912 13:64580508-64580530 CATTCAGGCTGGAGTGCAGTGGG - Intergenic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111503220 13:89152744-89152766 AATTGTGGCTGAAGTAGAAAGGG - Intergenic
1111983593 13:95042374-95042396 CATTGTGCATGGTGTAGAGAGGG + Intronic
1112681477 13:101771111-101771133 CATGGGGGCTGTAGTGCAGAAGG + Intronic
1112998598 13:105604539-105604561 CTTGGTGTCTGGAGAGGAGAGGG + Intergenic
1114247756 14:20930501-20930523 CCAGGTGGCTGGACTGGAGAAGG - Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114626401 14:24132793-24132815 GCTTGCGGCTGGAGTGGGGACGG - Exonic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1115809010 14:37085076-37085098 AATTGTGTCTGAAGTGGAGAGGG + Intronic
1116276535 14:42840586-42840608 AATTGGGGCAGAAGTGGAGATGG - Intergenic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1117490918 14:56246940-56246962 CATGGTTACTGGGGTGGAGAAGG - Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119197676 14:72729400-72729422 TCTTGTGCCTGGAGTGGAGTGGG + Intronic
1119942479 14:78656278-78656300 CAATGTGGCTGCTGAGGAGAAGG + Intronic
1119962259 14:78872979-78873001 GATTTTTGCTGCAGTGGAGAGGG + Intronic
1120673112 14:87387262-87387284 CAAGGAGGCTGGAGTGGCGACGG + Intergenic
1120702151 14:87709990-87710012 TATTGTGGCTGAAGTAGAAAAGG - Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121007351 14:90498927-90498949 GAATGTGGCTGGTGTGGAGGAGG + Intergenic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122969652 14:105147404-105147426 CATTGTAGCTGCAGAGCAGAGGG + Exonic
1123716660 15:23038882-23038904 CATTCTAGCTGGAGTGGAAGTGG + Intronic
1123903232 15:24897110-24897132 CACTCAGGCTGGAGTGCAGAGGG - Intronic
1126636486 15:50785155-50785177 CATCGAGGCTGGAGTGCAGTGGG - Intergenic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1126864362 15:52921227-52921249 CATGGTGGCTGGTGTGGCTAGGG + Intergenic
1127530224 15:59836570-59836592 GATTCTGGCTGAAGTGGAGTTGG - Intergenic
1128393981 15:67204793-67204815 TAGTGGGCCTGGAGTGGAGAAGG - Intronic
1128988352 15:72237574-72237596 CATTCTGGCTGGTGGGGAGAGGG - Intergenic
1128998743 15:72316205-72316227 ACTTGTGACTGGAGTGGGGAGGG - Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131308693 15:91268426-91268448 CATAGTAACTGGAGTGGAGAAGG - Exonic
1131961118 15:97791439-97791461 CATTGTGGTGGTAGTGGAGATGG - Intergenic
1132358198 15:101189285-101189307 CGTGTTGACTGGAGTGGAGAGGG - Intronic
1132997535 16:2830941-2830963 CTTCCTGGCTGGAGCGGAGACGG + Intronic
1133235939 16:4387466-4387488 CCATGTGGCTGGTGTGGAGTAGG + Intronic
1133294353 16:4743652-4743674 CTTTGTGGCCCGAGTGGATAGGG - Intronic
1133461674 16:5991530-5991552 CATCGTGGCTGGATAGGAGCTGG + Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134798658 16:17064855-17064877 CTTGGGGGCTGGAGTGGTGAGGG - Intergenic
1135158534 16:20073908-20073930 CTTTGAGGCGGGAGTGGAGCGGG - Exonic
1135181809 16:20281400-20281422 CATTTGGGATGGAGTGGGGAGGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136186370 16:28591074-28591096 CTTTGGGGCTGGAGTGGAAGAGG - Intronic
1136188858 16:28603790-28603812 CTTTGGGGCTGGAGTGGAAGAGG - Intergenic
1137400326 16:48147950-48147972 TATTGTGGTTGTTGTGGAGACGG + Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139599782 16:67979758-67979780 CATTGTGGCTGGGGGTGTGAAGG + Exonic
1141733911 16:85839879-85839901 CCTTGTGGCTGGGGTGGTGTGGG + Intergenic
1141917144 16:87106841-87106863 TATGGTGGCTGGAGAGTAGAGGG + Intronic
1143025199 17:3937489-3937511 CATCGTGGCTGCGGTGGAGGAGG - Exonic
1143462069 17:7110194-7110216 GAGTGTGGCTGCAGTGGGGAAGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1144201247 17:12944279-12944301 CGTGGGGGCCGGAGTGGAGATGG - Intronic
1144328302 17:14202838-14202860 CATGGAGGCTGGAGTGAGGAAGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144805919 17:17967645-17967667 CATTCAGGCTGGAGTGCAAATGG + Intronic
1145271756 17:21408711-21408733 CATGGTGGGTGGAGGGGTGAAGG - Intronic
1145309970 17:21696175-21696197 CATGGTGGGTGGAGGGGTGAAGG - Intronic
1145739143 17:27257678-27257700 GCCTGTGGCTGGAGTGGAGATGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147461965 17:40578443-40578465 CATTGTTGCTGGAGAGGATGTGG + Intergenic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147589058 17:41669545-41669567 TGGTGTGGCTGGAGTGGGGACGG + Intergenic
1148019899 17:44546847-44546869 CATTATGGCAGGAGGGGAAATGG - Intergenic
1148835298 17:50462778-50462800 CAAGAGGGCTGGAGTGGAGAGGG - Intronic
1149050709 17:52301168-52301190 TATTTTGGGTGGAGGGGAGAGGG - Intergenic
1149640994 17:58202534-58202556 GATTGGGGCTGGGGTGGGGATGG - Intronic
1149772799 17:59334087-59334109 CAAACAGGCTGGAGTGGAGAGGG - Intronic
1149891848 17:60396868-60396890 CATTGCAGTTGGAGTAGAGAAGG - Intronic
1150602526 17:66663181-66663203 CTTTGAGGCTGGAGAGGAGCAGG - Intronic
1151227871 17:72660098-72660120 CATTGAGGTTTGAGTGGAGATGG - Intronic
1151724979 17:75878412-75878434 CATCGTGGCGCGAGTGGAGCCGG - Exonic
1151874161 17:76857067-76857089 CATGGAGGCTGGAGCAGAGATGG + Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152912357 17:83012656-83012678 CATGGAGGCTGGAGAGGAAAGGG - Intronic
1153006891 18:504983-505005 CATGGGGGATGCAGTGGAGATGG - Intergenic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1154057994 18:11030122-11030144 CTTTGTGGCTGGAATGAGGATGG - Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1154976183 18:21459958-21459980 CATTGTGGCTGTGGTGAAGCGGG - Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155775993 18:29762356-29762378 CAATGTGGCTGGAGTGAACTGGG - Intergenic
1157125146 18:44949856-44949878 AAGGGTGGGTGGAGTGGAGAGGG - Intronic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158685454 18:59610173-59610195 AAATCTGGCTGGAGTGGAGAGGG + Intronic
1158997178 18:62934029-62934051 CATTCTGACTGGTGTTGAGATGG - Intronic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160296860 18:77646521-77646543 TGTTGTGGCTGGAGTCGAGTGGG + Intergenic
1160579472 18:79875400-79875422 CAGTGAAGCTGGAGTGGAAATGG - Intronic
1161207846 19:3051144-3051166 CACTTTGGCTGCAGTGGAGATGG + Intergenic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162672422 19:12268187-12268209 CTTTGTGACTGGGGTGGGGAAGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165683409 19:37796954-37796976 CATTGTATTTGTAGTGGAGACGG + Intronic
1165963781 19:39557232-39557254 CATTGTTGTTGGATTGTAGAAGG - Intergenic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166280359 19:41788480-41788502 CAAAGTGGCAGGAGTGGAGGGGG - Intergenic
1166924824 19:46260387-46260409 CATTGTGGGTGCAGGGGAGCGGG - Intergenic
1167512531 19:49903349-49903371 GATGGTGTCTGGAGGGGAGACGG + Intronic
1167617799 19:50545538-50545560 CATTCAGGCTGGAGTGCAGTGGG - Intronic
1168018827 19:53594464-53594486 CATTGGGACTGGAATGGAGGTGG + Intergenic
1168522266 19:57061743-57061765 CATCCTGGCTGGAGTGCAGTGGG - Intergenic
927455627 2:23246885-23246907 CATTGGGGCTGGAGTAGGGGTGG - Intergenic
927813524 2:26194170-26194192 CATTCTGGCAGGAAAGGAGAGGG - Intronic
927967893 2:27283020-27283042 TGTTGTGGCTGGAGAGCAGAAGG + Intronic
929053453 2:37856818-37856840 CTTGGTGGCTGGGGTGGAGGAGG - Intergenic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929573573 2:43038784-43038806 GATTGGAGCTGGAGTGGAGTGGG - Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
930889386 2:56365328-56365350 TTATGTGCCTGGAGTGGAGAAGG + Intronic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
932292554 2:70594777-70594799 CAATGTGGCTGGGGTAGGGATGG - Intergenic
932302001 2:70674071-70674093 CAATTTGGGTGGAGTAGAGAGGG + Intronic
932447701 2:71790908-71790930 CATGGTGGCTGGAGAGGGCAAGG + Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933301393 2:80545114-80545136 CACAAGGGCTGGAGTGGAGAAGG - Intronic
933358445 2:81245299-81245321 CACAGTGGCTGCATTGGAGATGG + Intergenic
934196491 2:89841264-89841286 CATATTTGCTGGAGGGGAGATGG - Intergenic
934582853 2:95459717-95459739 CATTGTGCCTGGAGCGGGTAGGG - Intergenic
934596597 2:95616997-95617019 CATTGTGCCTGGAGCGGGTAGGG + Intergenic
935186633 2:100740134-100740156 ATCTGAGGCTGGAGTGGAGAAGG - Intergenic
935328350 2:101958624-101958646 CATTGTGGCTTGGGTTGGGATGG + Intergenic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
936932134 2:117801049-117801071 CATTGAGGGTGGAGTGGAAGTGG - Intergenic
937064669 2:119008952-119008974 GATTGAATCTGGAGTGGAGACGG - Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937355480 2:121195669-121195691 CAGTGTAGCTGCTGTGGAGAGGG + Intergenic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
938262804 2:129907313-129907335 CACAGTGGCTGGAGATGAGAGGG + Intergenic
938337696 2:130513773-130513795 CATTCTGGCTGGAAAGAAGAAGG - Intergenic
938352143 2:130606962-130606984 CATTCTGGCTGGAAAGAAGAAGG + Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
939070557 2:137535929-137535951 TGGTGTGGCTGGAGTGGATAAGG + Intronic
939072787 2:137563539-137563561 GATTGTGGCTGCACTGCAGAGGG - Intronic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
939956586 2:148532516-148532538 CATGGTGCCTGGACTGGAGTAGG - Intergenic
940061631 2:149577381-149577403 TGTTGTGGCTGGAGTGCAGAGGG + Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
942799253 2:179857913-179857935 CTTTGAGGCTGGACTGCAGAGGG + Intronic
944162048 2:196673169-196673191 AATTGTGCCTGGAATGTAGAAGG - Intronic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
946179835 2:217942653-217942675 CAATGTGGCAGCAGTGGGGAAGG - Intronic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948207901 2:236172673-236172695 CCTCGTCGCTGGAGTGGAGAGGG - Intergenic
948218357 2:236249264-236249286 CATTGTGGGAGGAGAGCAGAAGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948313417 2:237007789-237007811 GTGTGTGGCTGGGGTGGAGAGGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169079390 20:2786713-2786735 CATGGTGGCTGGGGTGGTGGAGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1170055910 20:12202119-12202141 CATTCTGGATGGAGTGGGGAAGG - Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170630243 20:18058811-18058833 CTTTATGCCTGGAGGGGAGAGGG + Intronic
1172037680 20:32021229-32021251 CATGGTGGCTGGAGTACAAATGG - Intronic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1172165437 20:32896111-32896133 CATCTTTGCTGGAGTGGAGAAGG - Intronic
1172619433 20:36309288-36309310 GGGTGTGGCTGGTGTGGAGAAGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1173272626 20:41551960-41551982 CATTATGGTTGCAGTGGGGATGG - Intronic
1173395804 20:42678339-42678361 CATTCAGGCTGGAGTGCAGTGGG + Intronic
1174118176 20:48242286-48242308 CATTGTCACTGGAAGGGAGATGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174463667 20:50700697-50700719 CCTTGTGCCTAGAGTGGAGGGGG + Intergenic
1174568789 20:51486304-51486326 CCCTGTGGCTGGACTGGAGTTGG - Intronic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1175110846 20:56646834-56646856 CCCTGTGGCTGGAGTGGGGAGGG + Intergenic
1175328014 20:58142986-58143008 CCATGTGGCTGGAGTGGCCATGG + Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176267078 20:64215386-64215408 GATTGTGGCTAGGGTGGAGGAGG + Intronic
1177087049 21:16718832-16718854 TATTGTAGCAGGAGTGGAGTGGG - Intergenic
1178855221 21:36245178-36245200 CATTTGGGCCGAAGTGGAGAAGG + Exonic
1179238336 21:39566709-39566731 AATTAAGGCTGGAGTGGTGATGG - Intronic
1179828416 21:43981412-43981434 CAGTGGGGCTGCAGTGGGGATGG - Intronic
1180003728 21:45008882-45008904 CAGTGGGGCTGTATTGGAGATGG - Intergenic
1180015513 21:45080220-45080242 GATGGTGGCTGGAGGGGACATGG + Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181433176 22:22895120-22895142 AATTGAGGCTGTAGAGGAGAGGG + Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183203095 22:36399593-36399615 CTTTGTGGTTGGAGAGGAAAGGG - Intergenic
1183309063 22:37099457-37099479 TATTTTGGCTGAAGTGAAGAGGG + Intronic
1183699794 22:39444795-39444817 AATGGTGGCTGGGGTGGAGATGG - Intergenic
1183813583 22:40279175-40279197 CATTGCAACTGGAGTGGAAACGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185316344 22:50180848-50180870 CATGGGGGCTGGAGTGGGGTTGG + Intergenic
949374243 3:3369211-3369233 CATTGAAGGTGGAGTAGAGAAGG - Intergenic
950076474 3:10190912-10190934 CACTGTGGCTGGGGAAGAGAGGG + Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
951606271 3:24438590-24438612 CATTGATGTTGGAGTGGGGAGGG + Intronic
951690113 3:25386291-25386313 CATAGAGGCTGGGGTGGAGAGGG + Intronic
952281120 3:31924273-31924295 CATTGACTCTGGAGTGGAAAAGG + Intronic
953006765 3:38986217-38986239 CAGTGTGGATGGTGTGGTGACGG - Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
954419553 3:50411453-50411475 CACTGTGTCTGGAATGGAGCTGG - Intronic
954663226 3:52237207-52237229 CATTGGGGCTGGGGTGGGCAGGG - Intronic
955364106 3:58297247-58297269 TAAAGAGGCTGGAGTGGAGAGGG - Intergenic
955408675 3:58642111-58642133 CATTGAGGCTGGAGTGGAACAGG + Intronic
955628841 3:60950519-60950541 CACCCAGGCTGGAGTGGAGATGG + Intronic
955647781 3:61158908-61158930 CTTTGTTGCAGCAGTGGAGAAGG - Intronic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958673978 3:97242283-97242305 CACTGTGGCTAGACTGCAGAGGG - Intronic
958896846 3:99838973-99838995 CAATGTGGATGAAGTTGAGATGG - Intronic
959836642 3:110925578-110925600 CATTGGGTCTTGAATGGAGAAGG - Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
961008766 3:123422662-123422684 CATTCTGGCTGGGGTTGAGGAGG - Intronic
962989775 3:140567194-140567216 CATGGTGGGTGGAGTGGGGGTGG + Exonic
963452898 3:145507286-145507308 CAGTGTGGCTGTTTTGGAGATGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
964556544 3:157945787-157945809 CATTGTGGCTTCAGAGGAGCAGG + Intergenic
965367045 3:167813883-167813905 CTGTGTGGCTGCAGTGGGGAGGG - Intronic
965379921 3:167975439-167975461 CATTGTTGTAGGAGTGGACAAGG + Intergenic
965449978 3:168825754-168825776 CATTGTCAATGGAGTAGAGAAGG - Intergenic
966047634 3:175572023-175572045 GATTGTGTGTGGAGTGGGGATGG + Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
967756772 3:193178892-193178914 CATTATGGCTAAAGTAGAGAAGG - Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969282108 4:6177743-6177765 CATTGGGGGTGGAGTGGAGGAGG - Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969340357 4:6536629-6536651 CAGGGTGGGTGCAGTGGAGAAGG + Intronic
969423706 4:7111726-7111748 CAGTGTGGCAGCAGTGGTGAAGG + Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
971251596 4:24977126-24977148 CATGGTTGCTGGGGTGGACATGG + Intronic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
971515071 4:27475365-27475387 CATGGTGGGTGGAGAGGGGAGGG - Intergenic
972150012 4:36077677-36077699 CATTGAGTCTGCAGTGTAGAGGG - Intronic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
972450812 4:39196557-39196579 CATGGTGGCAGCAGTAGAGATGG - Intronic
973147669 4:46847880-46847902 CCTTGAGGCTGGAGTGGAAGTGG - Intronic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
975768546 4:77695951-77695973 CATTCTGTCTGGAGTAGGGAAGG - Intergenic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977744864 4:100534892-100534914 CTTTGTGGCAGGAGACGAGAGGG - Intronic
977891073 4:102312280-102312302 AAATGAGGCTGGAGTGGAGTGGG - Intronic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
978833010 4:113112391-113112413 GATTGAGGCTGGAGTGGGGTTGG + Intronic
980032495 4:127846328-127846350 CTGTGTGGCTGGGGTGGAGGAGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
983344309 4:166507057-166507079 CACTGTGGCTTGAGTGGGCAAGG + Intergenic
983695014 4:170517713-170517735 CATTGTGCCAGGAGGGGAAAAGG + Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984713294 4:182903732-182903754 CATTGTTGCAGGAGCGGAGACGG - Intronic
984747639 4:183238550-183238572 CACTGTGGCTGGATTACAGAGGG - Intronic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
984878470 4:184390164-184390186 GAAAGTGGCTGGAATGGAGATGG - Intronic
984931198 4:184848421-184848443 CATTTTGGCGTGAGTGGAGAGGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
986341327 5:6791610-6791632 GATGGTTGCTGGAGGGGAGAAGG + Intergenic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG + Intergenic
987534944 5:19173100-19173122 CATAGTGGCTACAGTGGACAAGG - Intergenic
987986713 5:25156519-25156541 CATTGTGGCTGAAATTGAAAAGG - Intergenic
988621658 5:32829635-32829657 CATTTAGACTGGAGAGGAGAAGG + Intergenic
989630472 5:43477149-43477171 CATTTAGGCTGGAGTGCAGTAGG - Intronic
990976300 5:61564668-61564690 CATGGGGGCTGCAGTGGAAATGG - Intergenic
990999845 5:61771770-61771792 CATTGTGGCTAAACTGGAGAAGG - Intergenic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992681088 5:79153812-79153834 CAACATGGCTGGAGTAGAGAGGG + Intronic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
994116158 5:96063192-96063214 CATAGTGGCTGGACTGCTGATGG + Intergenic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995198288 5:109398105-109398127 CATTCTGACTGGTGTGGAGATGG - Intronic
996354090 5:122577610-122577632 GATTGAGCTTGGAGTGGAGAGGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998665652 5:144294116-144294138 CATTCAGGCTGGAGTGTAGTGGG - Intronic
998904335 5:146888417-146888439 CATGGTAGCAGCAGTGGAGATGG - Intronic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
1000037001 5:157456504-157456526 CATTGTGGCTAGAGGAGAAAAGG + Intronic
1000634345 5:163626982-163627004 GACAGTGGTTGGAGTGGAGATGG - Intergenic
1001024569 5:168213316-168213338 CAATCTGGGTGGAGTTGAGATGG - Intronic
1001523565 5:172413072-172413094 CATTGAGGCTGGACTTGGGAGGG + Intronic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1003078790 6:3004443-3004465 CATTGTGGCTGAAGCTGAGTTGG - Intronic
1003208322 6:4035590-4035612 CATTTTGGCTGGATCAGAGAAGG + Intronic
1003221414 6:4164218-4164240 TATTGAGACTGGAGTGTAGAGGG + Intergenic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1003989975 6:11476597-11476619 CAGTGTGACAGCAGTGGAGATGG + Intergenic
1004146933 6:13076647-13076669 AGTTGGAGCTGGAGTGGAGATGG + Intronic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005210528 6:23455257-23455279 CATTTAGGCTGGAGTGCAGTGGG + Intergenic
1005473273 6:26182881-26182903 AATGGTGGCAGGAGAGGAGAAGG + Intergenic
1005548241 6:26890703-26890725 CATTCTGACTGGTGTTGAGATGG - Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007452885 6:41953599-41953621 CAGAGAGGCTGGAGTGGTGAAGG - Intronic
1009680788 6:66889658-66889680 CATTTTGGGGGGAGGGGAGAGGG + Intergenic
1009787582 6:68358877-68358899 GCCTGTGGATGGAGTGGAGAGGG + Intergenic
1009814246 6:68710578-68710600 CATTGTGTCAGGAGGAGAGAAGG - Intronic
1010832420 6:80547140-80547162 CATTGTCACTGGAATGGAGGAGG - Intergenic
1011311199 6:85981492-85981514 GAATGTGCATGGAGTGGAGAAGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011810056 6:91121040-91121062 CATTTTGGCTGGAGTTCAGGAGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1012566541 6:100662950-100662972 CATTGTGGCTAGTGTGGATGAGG - Intronic
1012840450 6:104323013-104323035 CATTGGAGCTGCAGTGGTGAGGG - Intergenic
1013306458 6:108851228-108851250 CACTGGAGCTGGAGTAGAGAAGG - Intronic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014024883 6:116634138-116634160 CATTTTGGCTACAGTGTAGATGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015572490 6:134636053-134636075 CACAGGGGCTGGAGTGGGGAAGG - Intergenic
1015816898 6:137220005-137220027 CAATGTGGCTGCAGTGGAATAGG - Intergenic
1016259342 6:142148898-142148920 TATTGTGACTGGAGTGGATGGGG + Intronic
1017467471 6:154707787-154707809 CAGTCTGGCTGAAGTGGAGGAGG + Intergenic
1018254908 6:161908367-161908389 CAATCTGGCAGGAGAGGAGAAGG - Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018934640 6:168265683-168265705 CTCTGTGGCTTGAGAGGAGACGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019422800 7:958847-958869 GATGGGGTCTGGAGTGGAGAAGG + Intronic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1020417263 7:7960452-7960474 CATTGTGGCTGGAACTGAAAAGG + Intronic
1020606467 7:10344235-10344257 TATTGTGGGTAGGGTGGAGAAGG - Intergenic
1021236163 7:18144748-18144770 GATGATGGCTGGAGAGGAGATGG - Intronic
1021262401 7:18474400-18474422 TATTGTGGCTAGAGTCGAGCAGG - Intronic
1021769239 7:23982338-23982360 GATTGTGGTTGAAGTGCAGATGG + Intergenic
1022088905 7:27095348-27095370 CTTGGTGGCTGGCGTGGAGAGGG + Exonic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023268028 7:38429211-38429233 CATTGCTGCTTGTGTGGAGATGG - Intronic
1023311628 7:38893198-38893220 CAATGTGGCTGTAGTGTAGAAGG - Intronic
1023764018 7:43494110-43494132 CATTCTGGCGGGAGTGGCAAGGG - Intronic
1024058521 7:45681809-45681831 CATTGTGGCCTGAGTGGACGCGG + Intronic
1024753521 7:52500021-52500043 CATGGTGGCTGCAGTGTGGAGGG - Intergenic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1025851574 7:65248947-65248969 CATTCAGGCTGGAGTGCAGTAGG + Intergenic
1026877987 7:73890633-73890655 CTTTGTCGGTGGAGAGGAGACGG - Intergenic
1028202394 7:87976802-87976824 CATTATGCCTGGGGTGGGGAAGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1031350798 7:120728459-120728481 CATTGTATCTGTAGTAGAGATGG + Intronic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032269372 7:130389538-130389560 GATTGGGGCTGGAGTGAGGATGG + Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1033540339 7:142350169-142350191 CAACATGGCTGGAGTAGAGAAGG - Intergenic
1034931269 7:155165826-155165848 CACAGTGGCTGGAGTCGAGGGGG + Intergenic
1037529044 8:19756740-19756762 TATTGTGGCTGGGATGGAGAGGG - Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037835841 8:22214293-22214315 GATGGTGGCTGGAGAGGAGGAGG + Intergenic
1037987063 8:23296635-23296657 AATTGTGGTTTGAGTGGAGTTGG + Intergenic
1038814647 8:30888887-30888909 CATTGTGGCTGAATGGAAGAAGG - Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1041214119 8:55583007-55583029 TGAGGTGGCTGGAGTGGAGAAGG - Intergenic
1042130775 8:65585120-65585142 CAATGTGGCTGGGATGCAGAGGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1045008020 8:97932780-97932802 CATGGTAGCTGGAGGGGACAGGG - Intronic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045494132 8:102693975-102693997 CATTGTGGCTGGACCTGTGAGGG + Intergenic
1046872016 8:119214243-119214265 GACATTGGCTGGAGTGGAGAAGG + Intronic
1046887837 8:119387611-119387633 CATGGTGGCAGGAGTGGGGCAGG - Intergenic
1046905376 8:119566671-119566693 CCCTGAGGCTGGTGTGGAGAAGG - Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1048192339 8:132301335-132301357 CATGGTGGCTGGAGTGGACAGGG - Intronic
1048334186 8:133490816-133490838 CATCGTGGCTGGACTGGAGAGGG + Intronic
1048527641 8:135217827-135217849 CATTGTGGCTGGCTTGGTGGGGG + Intergenic
1049268215 8:141680862-141680884 CACAGTGCCTGGAGTGGGGAGGG - Intergenic
1049320681 8:141994643-141994665 GATAGTGGGTGGACTGGAGATGG - Intergenic
1049673454 8:143879591-143879613 CAGTGTGGCAGGTGTGGACAGGG - Intergenic
1049763034 8:144339353-144339375 CTTTGTTGCAGGAGAGGAGATGG + Intergenic
1050297263 9:4218240-4218262 CATGGTGGTTGCAGTGGAGATGG - Intronic
1050340810 9:4636841-4636863 CATTGTGGCTGGAGCGTGGCTGG - Intronic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1055453993 9:76456318-76456340 TATTGAGGCTGGATGGGAGAGGG - Intronic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1057007941 9:91577017-91577039 CATTCTGTCTGCAGTGGAAAAGG + Intronic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1058175919 9:101737248-101737270 CCTGGTGCGTGGAGTGGAGATGG - Intronic
1058555726 9:106164465-106164487 CATTGTTTTTGGAGAGGAGAGGG + Intergenic
1058578766 9:106431927-106431949 CACTGTTGCTGGAGTGTAAACGG - Intergenic
1058906496 9:109486431-109486453 CAGTTTGGGTGGAGTGGAAAAGG + Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059571467 9:115441624-115441646 TATTGTGGCTGGTGTGGTGATGG + Intergenic
1059760696 9:117334610-117334632 CACTGTGGCTGGTGTGTAAAAGG - Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1060050853 9:120377123-120377145 CAGTCTGGAGGGAGTGGAGAAGG + Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061203579 9:129150656-129150678 CACTGTGGTGGGAGTGGGGACGG + Intergenic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061904288 9:133688659-133688681 CATTGAGGCTGGGATGGAGCAGG - Intronic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1186496763 X:10016689-10016711 CATTCTGGCTGCAGTACAGAAGG - Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1187969024 X:24640972-24640994 CACTCAGGCTGGAGTGCAGAGGG + Intronic
1187993017 X:24896176-24896198 GGTTGTAGCTGGAGTGGGGAGGG + Intronic
1188000981 X:24981348-24981370 TATTGGGGCTGGAGGGGGGAAGG - Intronic
1188230182 X:27652764-27652786 CATTGCCTCTGGAGTGGAGGAGG + Intronic
1188278094 X:28226560-28226582 CATTGAAGCTGGAGTGGTGCTGG - Intergenic
1189447062 X:41089952-41089974 CACTGAGGCTGGAGTGGTCACGG + Intronic
1190579794 X:51881253-51881275 CAGTGTGACTGTATTGGAGATGG - Intronic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1194442233 X:93946780-93946802 CATTCTGACTGGAGTTGAGATGG - Intergenic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1196326697 X:114413901-114413923 CTATATGGCTGGAGTAGAGAAGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196756225 X:119159746-119159768 CATTGTGTTTGGAGGGGACAGGG - Intergenic
1196764353 X:119229452-119229474 CATTATGGTTGGAGTGTTGAGGG + Intergenic
1197270048 X:124415366-124415388 AATTCTGGCTGGAGTTAAGAAGG + Intronic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198839074 X:140836831-140836853 CATTGTGGGTGGAGTGCGGGTGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199733720 X:150664183-150664205 GATTATGGATGGAGTGGAGGTGG - Intronic
1200110211 X:153737120-153737142 CAGCGGGGCTGGGGTGGAGAGGG - Intronic
1200164099 X:154024325-154024347 CCTGGGGGCTGGAGCGGAGACGG - Intronic
1201370658 Y:13259523-13259545 CAATGTGGCTGGAAAGTAGATGG - Intronic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201593612 Y:15641677-15641699 CATTGTTGCTTGTTTGGAGATGG - Intergenic