ID: 1182230198

View in Genome Browser
Species Human (GRCh38)
Location 22:28831969-28831991
Sequence CACTGTGAGCCGTCGTAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182230191_1182230198 5 Left 1182230191 22:28831941-28831963 CCAGCCTAAGCCTTTAAGAGTGG No data
Right 1182230198 22:28831969-28831991 CACTGTGAGCCGTCGTAATCTGG No data
1182230194_1182230198 1 Left 1182230194 22:28831945-28831967 CCTAAGCCTTTAAGAGTGGGTTC No data
Right 1182230198 22:28831969-28831991 CACTGTGAGCCGTCGTAATCTGG No data
1182230195_1182230198 -5 Left 1182230195 22:28831951-28831973 CCTTTAAGAGTGGGTTCCCACTG No data
Right 1182230198 22:28831969-28831991 CACTGTGAGCCGTCGTAATCTGG No data
1182230189_1182230198 28 Left 1182230189 22:28831918-28831940 CCTCAGTCTCTGCTTCTGGGAGC No data
Right 1182230198 22:28831969-28831991 CACTGTGAGCCGTCGTAATCTGG No data
1182230190_1182230198 6 Left 1182230190 22:28831940-28831962 CCCAGCCTAAGCCTTTAAGAGTG No data
Right 1182230198 22:28831969-28831991 CACTGTGAGCCGTCGTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182230198 Original CRISPR CACTGTGAGCCGTCGTAATC TGG Intergenic
No off target data available for this crispr