ID: 1182231068

View in Genome Browser
Species Human (GRCh38)
Location 22:28837894-28837916
Sequence CTTCCCTTGTTTTAAGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182231068_1182231070 11 Left 1182231068 22:28837894-28837916 CCAAAGACTTAAAACAAGGGAAG No data
Right 1182231070 22:28837928-28837950 CAACCACCAGTAGCATGATGAGG No data
1182231068_1182231071 12 Left 1182231068 22:28837894-28837916 CCAAAGACTTAAAACAAGGGAAG No data
Right 1182231071 22:28837929-28837951 AACCACCAGTAGCATGATGAGGG No data
1182231068_1182231074 23 Left 1182231068 22:28837894-28837916 CCAAAGACTTAAAACAAGGGAAG No data
Right 1182231074 22:28837940-28837962 GCATGATGAGGGCTGCAGTCAGG No data
1182231068_1182231076 28 Left 1182231068 22:28837894-28837916 CCAAAGACTTAAAACAAGGGAAG No data
Right 1182231076 22:28837945-28837967 ATGAGGGCTGCAGTCAGGGCAGG No data
1182231068_1182231075 24 Left 1182231068 22:28837894-28837916 CCAAAGACTTAAAACAAGGGAAG No data
Right 1182231075 22:28837941-28837963 CATGATGAGGGCTGCAGTCAGGG No data
1182231068_1182231077 29 Left 1182231068 22:28837894-28837916 CCAAAGACTTAAAACAAGGGAAG No data
Right 1182231077 22:28837946-28837968 TGAGGGCTGCAGTCAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182231068 Original CRISPR CTTCCCTTGTTTTAAGTCTT TGG (reversed) Intergenic
No off target data available for this crispr