ID: 1182231070

View in Genome Browser
Species Human (GRCh38)
Location 22:28837928-28837950
Sequence CAACCACCAGTAGCATGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182231065_1182231070 19 Left 1182231065 22:28837886-28837908 CCACACAGCCAAAGACTTAAAAC No data
Right 1182231070 22:28837928-28837950 CAACCACCAGTAGCATGATGAGG No data
1182231068_1182231070 11 Left 1182231068 22:28837894-28837916 CCAAAGACTTAAAACAAGGGAAG No data
Right 1182231070 22:28837928-28837950 CAACCACCAGTAGCATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182231070 Original CRISPR CAACCACCAGTAGCATGATG AGG Intergenic
No off target data available for this crispr