ID: 1182237009

View in Genome Browser
Species Human (GRCh38)
Location 22:28883829-28883851
Sequence TGCACCGGAGGCCGCGGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182237009_1182237023 18 Left 1182237009 22:28883829-28883851 CCGCCCCCGCGGCCTCCGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 320
Right 1182237023 22:28883870-28883892 CGCCGCTGCCGCTGCTGCTCGGG 0: 2
1: 3
2: 13
3: 112
4: 573
1182237009_1182237026 28 Left 1182237009 22:28883829-28883851 CCGCCCCCGCGGCCTCCGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 320
Right 1182237026 22:28883880-28883902 GCTGCTGCTCGGGCTGCTGCTGG 0: 1
1: 2
2: 16
3: 231
4: 835
1182237009_1182237022 17 Left 1182237009 22:28883829-28883851 CCGCCCCCGCGGCCTCCGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 320
Right 1182237022 22:28883869-28883891 CCGCCGCTGCCGCTGCTGCTCGG 0: 1
1: 2
2: 30
3: 158
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182237009 Original CRISPR TGCACCGGAGGCCGCGGGGG CGG (reversed) Exonic