ID: 1182241679

View in Genome Browser
Species Human (GRCh38)
Location 22:28921025-28921047
Sequence CAAACAGGAGGGAAGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 844}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182241670_1182241679 18 Left 1182241670 22:28920984-28921006 CCAGCCCACTGGCCACATGCTTC 0: 1
1: 0
2: 1
3: 18
4: 273
Right 1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG 0: 1
1: 0
2: 2
3: 68
4: 844
1182241671_1182241679 14 Left 1182241671 22:28920988-28921010 CCCACTGGCCACATGCTTCTCCT 0: 1
1: 0
2: 1
3: 20
4: 268
Right 1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG 0: 1
1: 0
2: 2
3: 68
4: 844
1182241673_1182241679 6 Left 1182241673 22:28920996-28921018 CCACATGCTTCTCCTTTTCACCT 0: 1
1: 0
2: 0
3: 60
4: 620
Right 1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG 0: 1
1: 0
2: 2
3: 68
4: 844
1182241672_1182241679 13 Left 1182241672 22:28920989-28921011 CCACTGGCCACATGCTTCTCCTT 0: 1
1: 0
2: 1
3: 42
4: 414
Right 1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG 0: 1
1: 0
2: 2
3: 68
4: 844
1182241674_1182241679 -6 Left 1182241674 22:28921008-28921030 CCTTTTCACCTGAATTTCAAACA 0: 1
1: 0
2: 3
3: 32
4: 296
Right 1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG 0: 1
1: 0
2: 2
3: 68
4: 844
1182241669_1182241679 19 Left 1182241669 22:28920983-28921005 CCCAGCCCACTGGCCACATGCTT 0: 1
1: 0
2: 2
3: 21
4: 231
Right 1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG 0: 1
1: 0
2: 2
3: 68
4: 844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182241679 Original CRISPR CAAACAGGAGGGAAGATGAA AGG Intronic
900802427 1:4745640-4745662 CACAGAGGATGGGAGATGAAAGG + Intronic
900903194 1:5531054-5531076 CAATCAGGGAGGAAGATGAAGGG - Intergenic
901563306 1:10090515-10090537 AAAAGAGGAGGGAAGATGGTTGG + Intronic
901700785 1:11043935-11043957 CACACAGGAAGGAGGAAGAAGGG + Intronic
901718635 1:11177028-11177050 CAGACAGGAGGGGAAGTGAAGGG + Intronic
902445298 1:16459406-16459428 CAATCAGGAGGGAAATTGGAAGG + Exonic
902799481 1:18820328-18820350 GAAGCAGGAGGAATGATGAATGG - Intergenic
902883023 1:19385378-19385400 CAAACGGAAGGAAAGCTGAATGG + Intronic
903395275 1:22997190-22997212 AAAATAGGAGGGAAAAGGAAAGG - Intergenic
904151700 1:28446856-28446878 CAATCATGGTGGAAGATGAAGGG - Intronic
904437908 1:30511251-30511273 CAATCATGATGGAAGGTGAAGGG - Intergenic
904879550 1:33685116-33685138 AAAAGAAGAGGGAAGAGGAAAGG - Intronic
905290118 1:36915744-36915766 CAATCATGATGGAAGGTGAAAGG - Intronic
905792828 1:40799318-40799340 CAAAGTTGAGGGAAGATGATTGG + Intronic
906314913 1:44780339-44780361 CACACAGGAGGGAAAATCCAGGG - Intergenic
906637312 1:47417766-47417788 CAAACTTGTGGGAAAATGAAGGG - Exonic
906909420 1:49931427-49931449 CAATCATGATGGAAGGTGAAGGG + Intronic
907296473 1:53459274-53459296 CCAAAAGGAGGGAAAATGCAAGG + Intergenic
907448012 1:54521751-54521773 CAATCATGGTGGAAGATGAAAGG + Intergenic
907729135 1:57049099-57049121 AGAACAGAACGGAAGATGAAAGG + Intronic
907863131 1:58372833-58372855 CAATCATGATGGAAGGTGAATGG - Intronic
907910845 1:58824786-58824808 CAAACAGGAAAGAGGAGGAAGGG + Intergenic
907934201 1:59027641-59027663 CAAACACGAGGGATGAGGGATGG - Intergenic
908322200 1:62989180-62989202 CAAACATGGCGGAAGGTGAAAGG + Intergenic
908354823 1:63319108-63319130 GCAACAGGAGGCAAGAAGAATGG - Intergenic
908600741 1:65737240-65737262 CAATCATGACAGAAGATGAAAGG - Intergenic
908724390 1:67159376-67159398 CAATCATGATGGAAGACGAAGGG - Intronic
908874916 1:68661991-68662013 CAATCATGATGAAAGATGAAGGG - Intergenic
908879171 1:68711114-68711136 CAATCATGTTGGAAGATGAAGGG - Intergenic
909125646 1:71665469-71665491 CAAACAGGAGGATAGATGCAAGG + Intronic
909434892 1:75629848-75629870 AAAACAGTATTGAAGATGAAAGG + Intergenic
909553386 1:76925039-76925061 CAATCATGATGGAAGGTGAAGGG + Intronic
910087241 1:83418128-83418150 CAATCATGATGGAAGGTGAAGGG + Intergenic
910359203 1:86397371-86397393 CAATCATGACGGAAGGTGAAGGG - Intergenic
910546133 1:88421131-88421153 CAATCATGCTGGAAGATGAAGGG - Intergenic
910722167 1:90298490-90298512 GAAAGATAAGGGAAGATGAAGGG - Intergenic
910950944 1:92647675-92647697 CTAGCAAGAGGGAAGGTGAAGGG + Intronic
910978497 1:92933994-92934016 CCAACAGCAGTGAAGATAAAGGG + Intronic
911082941 1:93951142-93951164 CAATCATGGGGGAAGGTGAAGGG + Intergenic
911180199 1:94853698-94853720 GAAACAGGAGGTAAGATCATGGG + Intronic
911256038 1:95634698-95634720 GATATAGGAGGGAAGATGGAAGG - Intergenic
911739972 1:101376549-101376571 CTAACAGGAAGAAAGATTAATGG - Intergenic
911902411 1:103523047-103523069 CAAAGAGGAGGGAATGAGAAAGG + Intergenic
911941524 1:104053352-104053374 CAATCATGGTGGAAGATGAAGGG + Intergenic
911955464 1:104228249-104228271 CAATCATGATGGAAGATGAAGGG - Intergenic
911985319 1:104615695-104615717 CAATCAGAGTGGAAGATGAAGGG + Intergenic
912055035 1:105585341-105585363 TCAACATAAGGGAAGATGAAGGG - Intergenic
912170517 1:107093701-107093723 CAATCATGGTGGAAGATGAAAGG - Intergenic
912948375 1:114103733-114103755 CACACAAGAGGGCAGATGAGGGG + Intronic
913171797 1:116239954-116239976 GAAAAGTGAGGGAAGATGAAAGG - Intergenic
913253059 1:116928303-116928325 CAGATAGGAGGGAATCTGAAAGG - Intronic
913349095 1:117838150-117838172 CAAACATGGCAGAAGATGAAGGG + Intergenic
914880096 1:151540352-151540374 CGACCCCGAGGGAAGATGAACGG + Exonic
914925362 1:151881425-151881447 CCAACAGGTGGGAGGATGAAAGG - Intronic
915130326 1:153691297-153691319 TAAACAGGAGGCAAGAGCAAGGG - Intronic
915839840 1:159205021-159205043 CAAACAGCAGGGGAAATGAGGGG - Intronic
916028829 1:160859020-160859042 TAAACAGGATGGAACATAAATGG + Intronic
916424655 1:164669097-164669119 CAAAGAGGAGGGAAGAAGAGGGG - Intronic
916435246 1:164771918-164771940 CAAACATGAGGGAAGGAGAATGG + Intronic
916457318 1:164984175-164984197 GAAACAGGAGGGAGGAGAAAAGG - Intergenic
916805954 1:168261350-168261372 CACAAAAGATGGAAGATGAAAGG - Intergenic
917628079 1:176865818-176865840 CAATCATGGTGGAAGATGAAAGG + Intronic
917628426 1:176869503-176869525 GAAGCAGGAGCGAAGATAAAGGG + Intronic
919126952 1:193406485-193406507 TAAGAAGGAGGGATGATGAAGGG - Intergenic
920347622 1:205316946-205316968 CAATCAGGACTGAAGATGGAAGG + Intronic
920925490 1:210337651-210337673 CTTACAGGAGGGAAGCTGAAGGG - Intronic
921136761 1:212267792-212267814 CAAAAATGAGGTAAGAGGAAAGG + Intergenic
921524803 1:216203575-216203597 AAAACAGAAGAGAAGATGACAGG - Intronic
921928285 1:220731696-220731718 CAAACATGGCGGAAGGTGAAAGG - Intergenic
922120498 1:222662639-222662661 CAAACAGGAGAGAGGAGAAAAGG - Intronic
922204106 1:223431670-223431692 AAAAAAGCAAGGAAGATGAAAGG + Intergenic
922273296 1:224054171-224054193 CAATCAGGGAGGAAGGTGAAGGG - Intergenic
922553097 1:226511674-226511696 CAGAAGGGAGGGAAGAAGAAAGG - Intergenic
922662988 1:227446591-227446613 CAATCATGAGGGAAGGTGAAAGG + Intergenic
922927917 1:229365843-229365865 CAATCATGATGGAAGGTGAAGGG - Intergenic
923202211 1:231723802-231723824 CAAAAAAGAGGGAGGAAGAAGGG - Intronic
923422407 1:233830284-233830306 CAATCATGATGGAAGGTGAAAGG + Intergenic
923773974 1:236961767-236961789 CAATCACGGTGGAAGATGAAAGG - Intergenic
1062831918 10:611239-611261 CAATCAGGGTGGAAGGTGAAGGG - Intronic
1063551536 10:7038579-7038601 CAAACAAAAGGGAAAATGAGAGG - Intergenic
1063803939 10:9615657-9615679 CAAAAGAGAGGGAAGTTGAAGGG + Intergenic
1064386659 10:14899361-14899383 CAAAGAGGTGGGAAAATGAGGGG - Intronic
1064569765 10:16680550-16680572 CAAACATGGCAGAAGATGAAGGG + Intronic
1064896779 10:20246175-20246197 CAAACAGGTGGGAAGACAAGGGG + Intronic
1064960945 10:20964442-20964464 CAATCATGATGGAAGGTGAAGGG + Intronic
1065211366 10:23406611-23406633 CAATCATGGCGGAAGATGAAGGG + Intergenic
1065501061 10:26382789-26382811 CAATCATGATGGAAGGTGAAGGG - Intergenic
1066054802 10:31670846-31670868 CAATCATGACGGAAGGTGAAGGG - Intergenic
1066148034 10:32583269-32583291 AGAACAGGAGGTAAAATGAATGG - Exonic
1066305087 10:34132863-34132885 CAAACAGAAGGGCAGAAGAGTGG + Intronic
1067351411 10:45479685-45479707 CAATCATGGGGGAAGATGAAAGG - Intronic
1067363865 10:45606965-45606987 CAATCATGATGGAAGGTGAAAGG - Intergenic
1067479432 10:46585375-46585397 CAAAGAGGAAGGAAAAGGAAGGG + Intronic
1067517695 10:46967150-46967172 GAAAGAGGAGAGAAGGTGAAGGG - Intronic
1067615306 10:47756423-47756445 CAAAGAGGAAGGAAAAGGAAGGG - Intergenic
1067644554 10:48084679-48084701 GAAAGAGGAGAGAAGGTGAAGGG + Intergenic
1068288198 10:54966777-54966799 CAATCATGGTGGAAGATGAAAGG - Intronic
1068424425 10:56840203-56840225 GGAGAAGGAGGGAAGATGAAAGG + Intergenic
1068765356 10:60757396-60757418 GGGAGAGGAGGGAAGATGAAGGG - Intergenic
1069098113 10:64284966-64284988 AATAAAGGAGGGAAGGTGAAGGG - Intergenic
1069266424 10:66463934-66463956 AAGACAGTAGGGAAGAGGAATGG + Intronic
1069388895 10:67911651-67911673 CTAACAGAAGGAAGGATGAATGG - Intronic
1069539082 10:69280004-69280026 CAGACACGAGGAAGGATGAAAGG + Intronic
1069597754 10:69683472-69683494 CAAGGAAGAGGGAAGATGAAGGG + Intergenic
1070363717 10:75715786-75715808 GAAAAGGGAGGGAAGAGGAAGGG - Intronic
1070371719 10:75788413-75788435 TAAGCAGGAAGGAAGAAGAAGGG + Intronic
1071327987 10:84535445-84535467 CAATCATGGTGGAAGATGAAAGG - Intergenic
1071427690 10:85575772-85575794 AAAAAATGAGGGAAGATAAAGGG - Intergenic
1071429457 10:85595226-85595248 AAAGCAGGAGGCAAGGTGAAAGG + Intergenic
1071516530 10:86301360-86301382 ACAACAGGAAGGAAAATGAATGG - Intronic
1071630707 10:87216374-87216396 CAAAGAGGAAGGAAAAGGAAGGG - Intergenic
1071713953 10:88076433-88076455 CCAACAGTGGGGAAGAGGAAGGG + Intergenic
1071788427 10:88929257-88929279 CAATCATGATGGAAGACGAAAGG + Intronic
1071953318 10:90729312-90729334 GGAAGAGGAGGGAAGATGAGAGG - Intergenic
1072542445 10:96408563-96408585 CTAACAGGAGGGAGGCAGAAAGG - Intronic
1072624849 10:97104694-97104716 CAAAGACGAGGGAAGATGTGTGG - Intronic
1072765699 10:98093615-98093637 CCAACAGGAAGCAAGATGAAAGG + Intergenic
1073216326 10:101838714-101838736 CCAAAAGGAGGGTAGATGGATGG - Intronic
1073785598 10:106885907-106885929 CAATCATGGGGGAAGGTGAAAGG - Intronic
1073915348 10:108396887-108396909 CAAAAAGAAGAGAAGATGAGAGG + Intergenic
1074100333 10:110349592-110349614 CAATCAGGGTGGAAGGTGAAGGG + Intergenic
1074758099 10:116642542-116642564 TGAACAGCTGGGAAGATGAATGG - Intronic
1075236314 10:120732967-120732989 CAACATGGAGGAAAGATGAAGGG - Intergenic
1075354434 10:121757856-121757878 CAAATATGAGGGAATATGATGGG - Intronic
1075760352 10:124850659-124850681 CAACCAAGAGGGGACATGAAGGG - Intergenic
1075764727 10:124884354-124884376 CAGACAGGAGGGAAACTGAAGGG + Intergenic
1075849914 10:125578631-125578653 CAGACAGGATGGAAAATGAGAGG - Intronic
1075883966 10:125880810-125880832 CAGACAAGATGGAAGAAGAAGGG - Exonic
1075939303 10:126375433-126375455 AAAACAGGAGGCACAATGAAGGG + Intronic
1076123577 10:127955816-127955838 CAATCATGGAGGAAGATGAAGGG + Intronic
1076639919 10:131908258-131908280 GAAACAGGAGCAAAGATCAAGGG - Intronic
1077956313 11:7023774-7023796 CAATCATGATGGAAGGTGAAGGG + Intronic
1078133232 11:8630706-8630728 CAAAAAAGAGGCAAGAGGAAAGG - Intronic
1078958687 11:16236071-16236093 AAAACGGGAGGGAAGAAGTAAGG - Intronic
1079952800 11:26825003-26825025 CAATCATGATGGAAGGTGAAGGG + Intergenic
1079972887 11:27058219-27058241 CAATCATGATGGAAGGTGAAGGG - Intronic
1080558939 11:33444108-33444130 CAAAAAGAAGGGAAAATAAATGG + Intergenic
1081209100 11:40309927-40309949 CCAGCAGGAGGGAAGAAGATGGG - Intronic
1081338135 11:41893299-41893321 TAAAAAGGAGGAAAGAAGAAAGG - Intergenic
1081507752 11:43735818-43735840 CAATCATGGTGGAAGATGAAGGG + Intronic
1081918649 11:46751592-46751614 CAAAGCTTAGGGAAGATGAATGG - Intronic
1082711884 11:56562185-56562207 CAATCATGATGGAAGGTGAAGGG - Intergenic
1083161768 11:60858807-60858829 CAAACAGGAAGTGAGATGCAGGG + Intergenic
1083479521 11:62934564-62934586 GAAACAGGAGGTAAGAAGAAAGG - Intergenic
1083861881 11:65424478-65424500 CAAACAGGTGGGTAGGTGAGAGG - Intergenic
1084205251 11:67587521-67587543 CAATCAGGGTGGAAGGTGAAGGG - Intergenic
1084443969 11:69192687-69192709 GAAGCAGAAAGGAAGATGAAAGG - Intergenic
1084478603 11:69403206-69403228 CAATCATGGTGGAAGATGAAAGG - Intergenic
1085196660 11:74676768-74676790 CAGACAGGTGGGAAGAGGGAGGG - Intergenic
1085652407 11:78280315-78280337 AAAACAGGAGGGATGAGGAACGG + Intronic
1085857673 11:80194178-80194200 CAAATAGATGGGTAGATGAATGG - Intergenic
1086202201 11:84217442-84217464 CAATCATGGTGGAAGATGAAGGG - Intronic
1086242035 11:84706690-84706712 GAGACAGGAGGAAAGAAGAAAGG + Intronic
1087202043 11:95355338-95355360 CGAACATGAGGGAAGAAGGAGGG + Intergenic
1087266637 11:96068899-96068921 AAAAAAGGAGGGAAGAAGGAAGG - Intronic
1087438445 11:98152098-98152120 CATTCATGATGGAAGATGAAAGG - Intergenic
1087497733 11:98911130-98911152 CAATCATGGTGGAAGATGAAGGG - Intergenic
1087578655 11:100024281-100024303 CAATCATGGGGGAAGGTGAAAGG - Intronic
1087690802 11:101318499-101318521 CAATCACGGTGGAAGATGAAAGG + Intergenic
1087933347 11:104003424-104003446 CAAACTGGAGGGAAAATGCCTGG + Intronic
1087995044 11:104795490-104795512 CAGACAGGAGAGGAGATAAAGGG + Intergenic
1088086218 11:105983851-105983873 AAAAGTGGTGGGAAGATGAATGG - Intergenic
1089759875 11:120715518-120715540 CAAACAGGAAAGAAAAGGAAAGG - Intronic
1089788523 11:120925269-120925291 CAAGTGGGAGGGAAAATGAAAGG + Intronic
1091285203 11:134405052-134405074 GGAAGAGGAGGGAAGAAGAAGGG + Intronic
1091507889 12:1091455-1091477 GAAACAGGAGGGAGGCTGGAGGG + Intronic
1091910459 12:4226662-4226684 CAAAGAGGAAGGAAGAGGGAGGG - Intergenic
1092196406 12:6552198-6552220 GACACAGGAAGGAAGATGGAGGG - Intronic
1092598824 12:10036154-10036176 CAAACAGTAGTGAAAATGAAGGG - Intronic
1093238693 12:16642062-16642084 CAAAGATGAAGGAAGAGGAAAGG + Intergenic
1093690759 12:22106063-22106085 CAACCAGGACAGAAGGTGAAGGG + Intronic
1094169943 12:27480754-27480776 CAATCATGGTGGAAGATGAAGGG - Intronic
1094671203 12:32570880-32570902 CAAAGAAGGGGGCAGATGAAGGG + Intronic
1094746540 12:33350880-33350902 CAATCATGATGGAAGGTGAAAGG + Intergenic
1095555054 12:43492449-43492471 CATGCAGGAGGGAAGAGTAAAGG + Intronic
1095956253 12:47808101-47808123 CAAACAGGAGGCTGGATGTAAGG + Intronic
1096633859 12:52946333-52946355 TATACAGGAGGGCAGATAAAGGG - Intronic
1096914248 12:55014386-55014408 CAATCATGAGGGAAGGTGAAAGG - Intergenic
1096951876 12:55481415-55481437 CATATATGATGGAAGATGAAGGG - Intergenic
1098001055 12:65943822-65943844 CACACAGGAGGCACAATGAATGG + Intronic
1098150334 12:67539878-67539900 CAAACAGGAAAGAAAATAAAGGG + Intergenic
1098465679 12:70783800-70783822 CAAAAAGAAGGGAAGCTAAAAGG - Intronic
1098480701 12:70956364-70956386 CAAACAATAGGGAGGAAGAAAGG + Intergenic
1098577718 12:72062724-72062746 CAAATAAGAAGGAAAATGAATGG + Intronic
1098601831 12:72340688-72340710 CAAGCAGCAGGAAAGAGGAAAGG + Intronic
1098625264 12:72658408-72658430 CAAACAGGAGAGAAGAGAAGAGG - Intronic
1098660920 12:73093252-73093274 CAATCATGATGGAAGGTGAACGG - Intergenic
1098666766 12:73173218-73173240 GTTACAGGAAGGAAGATGAAAGG + Intergenic
1098715306 12:73822379-73822401 CAATCATGATGGAAGGTGAAGGG + Intergenic
1099281288 12:80650599-80650621 CAAAAATGAGAGAAGATTAATGG + Intronic
1099415205 12:82375998-82376020 AAAACAAAATGGAAGATGAATGG + Intronic
1099451318 12:82810874-82810896 CAATCATGAGGGAAGGTGAAGGG - Intronic
1099760429 12:86913351-86913373 CAATCATGATGGAAGATGAAAGG - Intergenic
1100046493 12:90387554-90387576 CAATCATGACAGAAGATGAAGGG - Intergenic
1100604902 12:96143619-96143641 CAAACAGGAAGGAAGAACAAAGG + Intergenic
1100663122 12:96722182-96722204 CAAACAGGTGGGAAAATGTATGG - Intronic
1100698477 12:97120693-97120715 CAATCATGATGGAAGGTGAAAGG - Intergenic
1100877241 12:98975181-98975203 GAAAGAGGAAGGAAGAGGAAAGG - Intronic
1100898592 12:99213368-99213390 CAGACTTAAGGGAAGATGAAGGG - Intronic
1101008887 12:100429931-100429953 GAAAGAGAAGGGAAGAGGAAGGG - Intergenic
1101042478 12:100770905-100770927 AACACAGTTGGGAAGATGAAAGG + Intronic
1101047423 12:100823455-100823477 AAAGCAAGAGGGAAAATGAAAGG - Intronic
1101517933 12:105454116-105454138 CAATCATGGTGGAAGATGAAAGG - Intergenic
1102070978 12:110019247-110019269 CAAAAAGCAGGGAAGTTGAGCGG + Exonic
1103123447 12:118400063-118400085 CAGAGAGGAGTGAAGAAGAAGGG + Intronic
1103318234 12:120074276-120074298 AAGATAGTAGGGAAGATGAAGGG - Intronic
1104481783 12:129114010-129114032 CTCACAGCAGGGAAAATGAATGG - Intronic
1104597047 12:130126979-130127001 GAAACAGGATGGCAGAAGAAGGG + Intergenic
1104697735 12:130876698-130876720 CAAACAGGATGGAACATCAGTGG + Exonic
1104888115 12:132124049-132124071 CAGACAGGTGGGTAGATGGATGG - Intronic
1104957004 12:132471895-132471917 CAAACAGGAAGCAGGAAGAAGGG + Intergenic
1105573248 13:21623999-21624021 GAATCATGAGGAAAGATGAAAGG - Intergenic
1105937156 13:25112853-25112875 CATACAGGAGGGATGACAAAGGG - Intergenic
1106256009 13:28022573-28022595 AAAACAGGAGAGAAGAGGCAAGG + Intronic
1106652838 13:31710258-31710280 CTAGCAGGAGGGAAGGAGAAGGG - Intergenic
1107907381 13:45073888-45073910 CAATCATGATGGAAGGTGAAGGG + Intergenic
1108226435 13:48294448-48294470 GAAACTGGAGTGAAGACGAACGG + Intergenic
1108257077 13:48621257-48621279 CAAGAAGGAGGGAAAAAGAAAGG - Intergenic
1108270469 13:48754979-48755001 CAAACATGGTGGAAGGTGAAAGG - Intergenic
1108450433 13:50557133-50557155 CAAAAAAGGTGGAAGATGAAGGG + Intronic
1108799787 13:54081578-54081600 CAAACAGAAGGGTAGAAGAATGG + Intergenic
1108922303 13:55691451-55691473 CAATCATGGGGCAAGATGAAAGG - Intergenic
1109551217 13:63902884-63902906 CAAACATGACAGAAGGTGAAGGG + Intergenic
1109681924 13:65763196-65763218 CAATCATGATGGAAGATGAAGGG + Intergenic
1109691192 13:65892024-65892046 AACACAGGAGGAAAGAGGAAGGG + Intergenic
1109886479 13:68552198-68552220 GAAACAAGAGGGAAGATAGAGGG - Intergenic
1110720146 13:78752250-78752272 CAATCAGGGTGGAAGGTGAAGGG - Intergenic
1110868703 13:80425113-80425135 CAATCATGATGGAAGGTGAAGGG + Intergenic
1111403209 13:87768597-87768619 CAATCATGGTGGAAGATGAAAGG + Intergenic
1111637741 13:90927766-90927788 CCACCAGGAAAGAAGATGAAGGG + Intergenic
1112268882 13:97950340-97950362 CAAACATGGCGGAAGGTGAAAGG - Intergenic
1112414732 13:99194874-99194896 CAGGCAGGAGGGAAGATGGTTGG - Intergenic
1112918468 13:104579989-104580011 CAAACTGAAGGGAAGATCATTGG - Intergenic
1113116206 13:106877139-106877161 CAATCACGGTGGAAGATGAAGGG + Intergenic
1113196229 13:107809970-107809992 AAAATAGGAGAGAAGAAGAAAGG - Intronic
1113351356 13:109532523-109532545 CAATCAGGGTGGAAGGTGAAGGG + Intergenic
1113499860 13:110764677-110764699 CAATCATGGCGGAAGATGAAGGG - Intergenic
1114137625 14:19869636-19869658 CAAACATGAGGGAAGGAGGATGG + Intergenic
1114390662 14:22304441-22304463 GAAGCAGGAGGGACGATTAATGG + Intergenic
1114935845 14:27535130-27535152 CAATCATGGTGGAAGATGAAGGG - Intergenic
1114967862 14:27985602-27985624 CAGTCAGCAGGAAAGATGAAAGG - Intergenic
1115012485 14:28566319-28566341 GAGAGAGGAGGGAAGATGCAGGG - Intergenic
1115975254 14:38990151-38990173 CAGAAAAGAGGGAAGAGGAAAGG - Intergenic
1116020065 14:39449505-39449527 CAATCATGATGGAAGGTGAAGGG - Intergenic
1116076491 14:40117707-40117729 GAAGCAGGAGAGAAAATGAAGGG - Intergenic
1116452934 14:45084404-45084426 CCAACAGGTGGGAAGGAGAAAGG - Intronic
1116713279 14:48396905-48396927 GGACCAGGAGGGAAGAAGAATGG + Intergenic
1116989445 14:51259667-51259689 CAAAAAGCAGAGCAGATGAATGG - Intergenic
1117271381 14:54147018-54147040 CAATCATGATGGAAGGTGAAGGG + Intergenic
1117320411 14:54617163-54617185 AATAAAGGAGGGAAGATGGAAGG + Intronic
1117356137 14:54925503-54925525 AAAACATGAGGGATGATCAAGGG - Intergenic
1118470350 14:66069408-66069430 CAAACAACCTGGAAGATGAAAGG - Intergenic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1119101233 14:71881615-71881637 CAATCATGATGGAAGGTGAAAGG - Intergenic
1120454473 14:84714899-84714921 AATACAGCAGGGAAGATAAAAGG + Intergenic
1120610938 14:86640595-86640617 CAATCACGATGGAAGGTGAAGGG - Intergenic
1121066964 14:90976666-90976688 CACACAGGAGGCAGAATGAAGGG + Intronic
1121554585 14:94826583-94826605 CAAACAGATGGAAAGATGGATGG + Intergenic
1121666498 14:95676479-95676501 CAAACAGAAGAGCAGAAGAATGG + Intergenic
1121860756 14:97315858-97315880 CAAACATGCCGGAAGATGAAGGG + Intergenic
1121870099 14:97399551-97399573 CAATCATGGTGGAAGATGAAGGG + Intergenic
1123792329 15:23734269-23734291 GAAAGAAGAGGGAAGATGGAAGG + Intergenic
1123977834 15:25569748-25569770 AAATCATTAGGGAAGATGAATGG - Intergenic
1124083427 15:26522366-26522388 CATAAAGGAGGGAAGAGGAAGGG + Intergenic
1124157720 15:27242131-27242153 CAAACAGCAGGAATGAGGAAGGG + Intronic
1124798824 15:32809623-32809645 CAAACAGAAGGGTAGGAGAAGGG - Intronic
1125246632 15:37647955-37647977 CAATCATGATGGAAGGTGAAGGG - Intergenic
1125281575 15:38047499-38047521 CAATCATGGCGGAAGATGAAAGG + Intergenic
1125465886 15:39952045-39952067 CAAAAACAATGGAAGATGAAGGG - Intronic
1125812112 15:42550309-42550331 CAAACATGATGGAAGATTTACGG + Intronic
1126322951 15:47445133-47445155 CAAACAGGAGAGCAGAAGAATGG - Intronic
1126738834 15:51757713-51757735 CTAACAGGACGGAAGACAAATGG + Intronic
1127374479 15:58370455-58370477 CAAGCAGGAGGGAAGGAGAGGGG + Intronic
1127578577 15:60316043-60316065 CAATCATGGTGGAAGATGAAAGG + Intergenic
1128548890 15:68584998-68585020 CAAAAAGGAGGGATGAGGAAGGG - Intronic
1128582989 15:68821387-68821409 CCAGCGGGAGGGCAGATGAAAGG + Intronic
1128593743 15:68926270-68926292 CTAACTGGAGGGATGATGGAGGG + Intronic
1128766629 15:70255084-70255106 CAATCATGACTGAAGATGAAGGG + Intergenic
1129098565 15:73236253-73236275 CAAACATTGGGGAATATGAAGGG - Intronic
1129119525 15:73387525-73387547 CAAACAGGAGGGAAAAAAGAGGG + Intergenic
1130189373 15:81717911-81717933 CAAACATAAAGGAAGATGGAAGG - Intergenic
1131318687 15:91366009-91366031 CAAAGAGGAGGAAGGATGAGGGG - Intergenic
1131653378 15:94427430-94427452 CAATCATGATGGAAGGTGAAGGG + Intronic
1131798054 15:96040695-96040717 CGAGCAGCAGGGAAGAGGAATGG + Intergenic
1132194863 15:99906734-99906756 CCAAAAGGAGGGAAGAGAAAGGG - Intergenic
1132418002 15:101638143-101638165 CAAACAGGAGGGACTCTGATGGG - Intronic
1133028766 16:2999980-3000002 GGAAGAGGAGGGAAGAGGAAGGG - Intergenic
1133074431 16:3269161-3269183 CAAACAGGATGGAAAATCACAGG + Intronic
1133493882 16:6297731-6297753 CAAACAGAAGGGCAGAAGAATGG + Intronic
1133575313 16:7083362-7083384 CAAGCAGGTGGGAGAATGAATGG + Intronic
1133816539 16:9201852-9201874 CAAACAAGATGGATGCTGAAGGG - Intergenic
1133937634 16:10282067-10282089 GAGACAGGAGGGCAGAAGAAGGG - Intergenic
1134405652 16:13956454-13956476 AAAACAGGAGGGAATTTCAAGGG + Intergenic
1135721139 16:24819480-24819502 AAAAAGGGAGGGAAGAAGAAAGG - Intronic
1136387902 16:29941480-29941502 CCAACAGCAGAGAAGAGGAAAGG - Intronic
1137273459 16:46918216-46918238 CAAATAGGAGGTCAGAGGAAAGG + Intronic
1137384257 16:48027004-48027026 CAGAGAGTAGGGAACATGAAGGG + Intergenic
1138238688 16:55408441-55408463 CAAAGAGGAGGTAAGATGTAGGG - Intronic
1138266981 16:55666654-55666676 AGAAAAGGAGGGAAGATGATGGG - Intronic
1138808252 16:60118880-60118902 GAAACAGAAAGGAAGATGATAGG - Intergenic
1138927661 16:61612066-61612088 AAAAAAGGAGGGGAGAGGAAAGG + Intergenic
1139017536 16:62708275-62708297 CAAATTGGAGGAAAGATGAAGGG - Intergenic
1139553636 16:67691611-67691633 TACAGAGGAGGGAAGATGTAGGG - Intronic
1140648518 16:77061861-77061883 CAAACAGGAGTGAATCTGATGGG + Intergenic
1140661417 16:77193783-77193805 CAAACAGGTGGGAGGCAGAATGG + Intronic
1140695002 16:77524083-77524105 AAGACAGAGGGGAAGATGAATGG + Intergenic
1140741080 16:77942180-77942202 CAATCATGGTGGAAGATGAAAGG + Intronic
1140953925 16:79845092-79845114 GAAAGAGGAAGGGAGATGAAAGG - Intergenic
1141120130 16:81347461-81347483 CAAACAGGAAGGAAGTGAAAGGG - Intronic
1141760797 16:86027190-86027212 TAAACAGCAGGGAAGAGGCAGGG - Intergenic
1141789638 16:86225831-86225853 CGAACAGGTGGGTGGATGAATGG - Intergenic
1141932495 16:87215418-87215440 AAAAGAGGAGGGAAGAGGAAGGG + Intronic
1143633604 17:8152123-8152145 CAAGCTGGAGGTAAGATGAGTGG + Intronic
1143769177 17:9157069-9157091 CAAACAAGAGAGAAGATAGATGG - Intronic
1146684437 17:34831589-34831611 CAAACAGGAGAGAAGCTAAGGGG + Intergenic
1146732507 17:35206084-35206106 CACACATGGTGGAAGATGAAGGG - Intergenic
1148523005 17:48299954-48299976 CATGTAGGAGGTAAGATGAAAGG + Intronic
1148640899 17:49186400-49186422 CAATCATGATGGAAGGTGAAAGG - Intergenic
1148882425 17:50740024-50740046 AGAAAAGGAGGGAAGGTGAAAGG - Intronic
1149117120 17:53110795-53110817 CAATCATGATGGAAGGTGAAGGG - Intergenic
1149310263 17:55386371-55386393 CAATCATGGGGGAAGGTGAAGGG - Intergenic
1149445826 17:56712564-56712586 CAATCATGACGGAAGGTGAAGGG - Intergenic
1149586289 17:57789748-57789770 CAAACAGGAGGGATATTGAGTGG + Intergenic
1149895921 17:60428254-60428276 CAAGTAGGAAGGAAGAGGAAGGG + Intronic
1150689423 17:67351738-67351760 CCAAAAGCAGGGAGGATGAAAGG - Intronic
1150919543 17:69468739-69468761 CAGAAAAGAGGGATGATGAAGGG - Intronic
1151099761 17:71543396-71543418 CAATCATGATGGAAGGTGAAAGG + Intergenic
1151146385 17:72045488-72045510 CAATCATGATGGAAGGTGAAAGG + Intergenic
1151179754 17:72318558-72318580 CAAAGAGGAGGAAAGAAGGAAGG + Intergenic
1152148487 17:78583973-78583995 CAATCATGATGGGAGATGAAGGG - Intergenic
1152386360 17:79977224-79977246 CGAAGAGAAGGGAAGATGCATGG + Intronic
1152506268 17:80750770-80750792 TAAACAAGAGGGAAGAGGGAAGG - Intronic
1152792487 17:82288956-82288978 CAAACATGAGAGAAGCTGAGAGG + Intergenic
1152890686 17:82880139-82880161 CATACAGGAAGGAAGAAGGAAGG - Intronic
1153026373 18:676504-676526 CAATCATGATGGAAGGTGAAGGG - Intronic
1153574074 18:6503407-6503429 CAAAGAGGAGGGAAGCGGATCGG + Intergenic
1153877128 18:9383945-9383967 CCAAAAGGAGGGAAAAGGAATGG + Intronic
1154101873 18:11482891-11482913 CAAACTGAAGGTAAGATGAAAGG + Intergenic
1154155945 18:11944204-11944226 TAAACAGAAGTGAAGAAGAATGG - Intergenic
1155086503 18:22464153-22464175 CAATCATGACGGAAGGTGAAAGG + Intergenic
1155394887 18:25376820-25376842 CAAACAGAAAGGCAGAAGAATGG + Intergenic
1155435055 18:25803883-25803905 GAAACATTAGGTAAGATGAAAGG - Intergenic
1156048032 18:32898770-32898792 CAACCATGGGAGAAGATGAAGGG - Intergenic
1156243206 18:35272832-35272854 CAAACATGGTGGAAGGTGAAAGG + Intronic
1157226902 18:45874513-45874535 CAATCATGGTGGAAGATGAAAGG + Intronic
1157405618 18:47420198-47420220 GAGACAGGAGGGCGGATGAAAGG + Intergenic
1159752844 18:72324402-72324424 CAAAAAGGGAGGAAGAAGAAAGG - Intergenic
1160479519 18:79226033-79226055 CAGAAAGGAGGGAAGCTGAAGGG - Intronic
1160546598 18:79661078-79661100 CAGGAAGGAGGGAAGCTGAACGG - Intergenic
1161209520 19:3058898-3058920 CACACAGCAGGGAAGACGAAGGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163007782 19:14407257-14407279 CAAATAGGTGGGAGGATGACAGG - Intronic
1163351248 19:16777670-16777692 GAAAAAGGAGGGAAGGAGAAAGG + Intronic
1163482793 19:17568005-17568027 CAGACAGGAGGGAAGAATAGAGG + Intronic
1163675678 19:18654187-18654209 CAGACAGAAGGGCAGATGGATGG - Intronic
1164391295 19:27823328-27823350 CAAGAAGGAGGAAAGATGCAAGG + Intergenic
1164815983 19:31203842-31203864 AATACAGGAGGGAAGAAGGAAGG - Intergenic
1164950243 19:32330948-32330970 CAATCATGGTGGAAGATGAAGGG + Intergenic
1165009439 19:32833185-32833207 CAAACAGGAAGTAAAATAAAAGG + Exonic
1165009979 19:32838157-32838179 CAAACAGGAAGTAAAATAAAAGG + Intronic
1165815135 19:38637184-38637206 CAAGGAGGAGGGAGTATGAATGG + Intergenic
1166252862 19:41583589-41583611 CAATCATGATGGAAGGTGAAAGG + Intronic
1166588968 19:43978519-43978541 CACACACGAGGGTAGATGGAAGG - Intronic
1166647725 19:44544456-44544478 CAGACAGAAGGGAAGATCAATGG - Intergenic
1166965327 19:46526438-46526460 CAATCATGGTGGAAGATGAAAGG + Intronic
1167025601 19:46915037-46915059 CAGACAGGAGTGCTGATGAAGGG - Intergenic
1167176051 19:47865188-47865210 GAAAAAGGAGGGAAATTGAATGG - Intergenic
1167309127 19:48726756-48726778 CAAACAGGAAGTAAGAGGCAAGG + Intronic
1167461692 19:49628115-49628137 CAAAAAAGAGGGATGAGGAAGGG - Intergenic
1167758904 19:51431040-51431062 CAATCATGACGGAAGGTGAAGGG - Intergenic
1167958775 19:53089745-53089767 CACACAGGAAGGAAGAAGGAGGG - Intronic
1168528400 19:57106551-57106573 CAGGCAGGAGGGAGGATGCAGGG - Intergenic
1168677514 19:58289729-58289751 CATATAGGAGGGAAGCAGAAGGG - Intronic
925277454 2:2660551-2660573 CAATCATGATGGAAGGTGAAAGG + Intergenic
925422952 2:3726514-3726536 CAAACAGGAGAGAAGGCGGAGGG + Intronic
925620655 2:5789365-5789387 CAAACATGATGAAAGGTGAAAGG + Intergenic
925804876 2:7638656-7638678 AAAACAAGAGGGAAGCAGAACGG - Intergenic
925813067 2:7720250-7720272 CAATCATGATGGAAGGTGAAGGG + Intergenic
925867923 2:8245112-8245134 TAAACAGGAGGGAAAGAGAAAGG - Intergenic
926240939 2:11084551-11084573 CAATCATGATGGAAGGTGAAGGG + Intergenic
926283234 2:11466880-11466902 CAAACAGGAAGGAGGAAGGAAGG - Intergenic
926283800 2:11471625-11471647 CAAACTGGAGGCAAGAAGAACGG + Intergenic
926508257 2:13742045-13742067 CAATCACGGTGGAAGATGAAAGG - Intergenic
926554588 2:14342028-14342050 CTAACAGCTGGGCAGATGAAAGG + Intergenic
926663391 2:15493162-15493184 CAATCATGGCGGAAGATGAAGGG - Intronic
926993881 2:18712707-18712729 TAAAAAGTAGGGAAGATAAAGGG - Intergenic
927009653 2:18889851-18889873 GAAACCTGCGGGAAGATGAAAGG + Intergenic
927243734 2:20940456-20940478 CTAATAGGAGGGAAAATGCAGGG + Intergenic
927605772 2:24484897-24484919 CAATCATGGCGGAAGATGAAAGG - Intergenic
928610118 2:32984320-32984342 CTATCAGAAGGAAAGATGAAAGG - Intronic
928690010 2:33789544-33789566 AAAAAAGGAGGGAAGAATAAAGG - Intergenic
928723670 2:34147861-34147883 AGCACAGGAGGGAAGCTGAAGGG - Intergenic
928773894 2:34735649-34735671 CAAAGAAGAAGGAAGAAGAAAGG + Intergenic
929025017 2:37592117-37592139 CACTCATGATGGAAGATGAAGGG - Intergenic
929284592 2:40121086-40121108 CAGACAGGAGGGATGTCGAAGGG + Intronic
929437470 2:41939519-41939541 CAAACAGGAAGGCAGATGGATGG - Intronic
929833788 2:45375296-45375318 CAATCATGATGGAAGGTGAAGGG + Intergenic
930200751 2:48549966-48549988 CAGACAGGAGGGAAGAGTACTGG + Intronic
930306101 2:49676530-49676552 CAAGCAGGAGGGAGGAGGGATGG + Intergenic
930630819 2:53753059-53753081 CAACCAGGAGGTAAAAGGAAGGG + Intronic
931092464 2:58900715-58900737 AAAGCAGGAGGCAAAATGAATGG - Intergenic
931196605 2:60057818-60057840 CCAACAGAAGAGAAGAAGAAGGG - Intergenic
931471438 2:62541688-62541710 CAGACAGGAGAGAAGGAGAAGGG + Intergenic
931597314 2:63962596-63962618 CAAAATGGAAGGAAGATAAAGGG + Intronic
931807198 2:65818674-65818696 CTGACAGGAGGGAAGAGGTAAGG - Intergenic
932108060 2:68967058-68967080 TAAAGAGGAGGGAAGATATAAGG + Intergenic
932434578 2:71695495-71695517 CAGATAGGAGGGAAAAGGAAAGG - Intergenic
932455700 2:71848575-71848597 CAATCATGATGGAAGGTGAAGGG + Intergenic
932564922 2:72900262-72900284 CAAGCAGGAGAGGAGATGGAGGG - Intergenic
932862912 2:75313165-75313187 CAAACAGAAGGGATGAGGCAAGG + Intergenic
933174342 2:79158883-79158905 AAAACATAAGGGAAGATGAAGGG - Intronic
933204731 2:79493212-79493234 AAAACAGGAGGGAAGGGGAGGGG + Intronic
933309432 2:80641882-80641904 AAAACAGTAAGGAATATGAAAGG + Intronic
933476561 2:82799050-82799072 CAATCATAGGGGAAGATGAAGGG + Intergenic
933627081 2:84613260-84613282 AAAGGAGGAGGGAAGATCAAAGG + Intronic
933769628 2:85734797-85734819 CAAGCAGCAGGGTAGAGGAAGGG + Intergenic
934294563 2:91732000-91732022 CAATCATGGTGGAAGATGAAGGG + Intergenic
934514545 2:94977921-94977943 CTCCCAGGAGGGAAGATGAGAGG + Intergenic
934698309 2:96416507-96416529 CAATCAGGAGTGAAGACTAAAGG - Intergenic
935018546 2:99207792-99207814 CAATCAGGGTGGAAGGTGAAGGG + Intronic
935758627 2:106298108-106298130 CAATCATGACGGAAGGTGAAGGG + Intergenic
935888908 2:107654130-107654152 CAATCATGACGGAAGGTGAAGGG - Intergenic
936547938 2:113408953-113408975 CATGCAGCAAGGAAGATGAATGG + Intergenic
936578661 2:113676399-113676421 CAATCATGGGGGAAGGTGAAAGG - Intergenic
936677991 2:114738009-114738031 CAATCATGACGGAAGGTGAAGGG + Intronic
937005007 2:118503357-118503379 GAAAGAAGAGGGAAGAAGAAGGG + Intergenic
937018733 2:118631397-118631419 CAAACAGAAAGGATGAGGAAAGG - Intergenic
937036034 2:118783114-118783136 CAAACAGGATCTATGATGAAGGG + Intergenic
937151620 2:119690296-119690318 CAAACATGGCGGAAGGTGAAGGG - Intergenic
939128558 2:138206061-138206083 CAATCATGACAGAAGATGAAAGG + Intergenic
939462523 2:142515244-142515266 TTAAAAAGAGGGAAGATGAAAGG + Intergenic
939565607 2:143783371-143783393 CAATCATGGTGGAAGATGAAGGG + Intergenic
939831101 2:147071939-147071961 CCAAAAGGTGGGAAGATGAGAGG - Intergenic
943119351 2:183714919-183714941 AAAACAGGACTGAAGGTGAAAGG + Intergenic
943393163 2:187296302-187296324 CAATCATGATGGAAGGTGAAAGG + Intergenic
944412606 2:199458355-199458377 CAGGGAGGAGGGAAGAGGAAGGG + Intronic
944517966 2:200531400-200531422 TAGGGAGGAGGGAAGATGAATGG + Intronic
944636663 2:201681744-201681766 CACACAGCAGGGCAGATGCAGGG - Intronic
945059836 2:205899405-205899427 CAATCATGATGGAAGGTGAAAGG - Intergenic
945336417 2:208598377-208598399 CAATCATGATGGAAGGTGAAAGG + Intronic
945484641 2:210381155-210381177 CAAACATGGTGGAAGGTGAAAGG - Intergenic
945838936 2:214865815-214865837 CATACAGGAGGAAAGGGGAAGGG - Intergenic
946398615 2:219456440-219456462 CAGACAGGAGGGTAGAGGAAGGG - Intronic
946414250 2:219531718-219531740 AGAGCAGGAGGGGAGATGAAAGG - Intronic
946474083 2:219991205-219991227 CAAGCAGGAGGGAAGAGAATTGG - Intergenic
946757896 2:222965246-222965268 CAATCATGATGGAAGGTGAAAGG + Intergenic
947213500 2:227728892-227728914 CAGAAAGGAGGGAAAAGGAATGG - Intergenic
947319307 2:228898394-228898416 CCAACAAGAGGGAACATGGAGGG - Intronic
947421381 2:229944045-229944067 CAATCATGATGGAAGGTGAAGGG - Intronic
948129767 2:235591909-235591931 CAATCATGTGGGAAGACGAAGGG - Intronic
1168900628 20:1361551-1361573 CAATCATGAGGGTAGAAGAAAGG + Intronic
1169463871 20:5820755-5820777 CAAAAAGGAGAAAAGATCAAAGG - Intronic
1169551788 20:6708546-6708568 CCAGCAAGAGGGAAGATGAATGG - Intergenic
1169864331 20:10183779-10183801 AAACCAGGAGGGAAGCTGACAGG + Intergenic
1170499487 20:16960322-16960344 CAATCAAGATGGAAGGTGAAAGG + Intergenic
1170735425 20:19010037-19010059 CAAACAGGATTGAATATGCAAGG + Intergenic
1171117273 20:22535770-22535792 TGAGCAGGAGGGAAGATGCAGGG - Intergenic
1171976011 20:31595179-31595201 AAAACAGGATGGGAGGTGAAAGG + Intergenic
1173694953 20:45002055-45002077 AAAACAGGAGGGGAGGAGAAGGG - Intronic
1173814265 20:45975043-45975065 GAAAGAGGAGGGAAGATGCCAGG + Intergenic
1173932845 20:46836048-46836070 CAAAGAGGAGGTGAGATGATGGG - Intergenic
1174028808 20:47603801-47603823 CAAACAGAAGAGCAGAAGAATGG - Intronic
1174121795 20:48271340-48271362 CAATCATGGGGGAAGGTGAAGGG + Intergenic
1174334998 20:49853641-49853663 CAGGCAGGTGGGAAGAAGAAAGG - Intronic
1174723476 20:52838028-52838050 GAAGGAGGAGGGAAGAAGAAGGG - Intergenic
1174949727 20:55030493-55030515 CCAGCAGGAGTGAAGATGATAGG + Intergenic
1175043199 20:56075763-56075785 CAATCATGGTGGAAGATGAAGGG - Intergenic
1175975856 20:62710097-62710119 TCAACAGGAGGGAAGAAGATAGG - Intronic
1176925736 21:14746507-14746529 CAATCAGGGTGGAAGGTGAAGGG + Intergenic
1176936814 21:14876864-14876886 CAAAGAAGAAGGAAGAAGAAGGG - Intergenic
1177265720 21:18780651-18780673 CAATCATGACGGAAGGTGAAAGG + Intergenic
1177381564 21:20351572-20351594 CATACAGCAGGGCAGAGGAAAGG - Intergenic
1177393396 21:20504357-20504379 CAATCATGATGGAAGGTGAAGGG - Intergenic
1177416543 21:20800543-20800565 TAATCATGACGGAAGATGAAAGG - Intergenic
1177478272 21:21652013-21652035 CAAACATGGCGGAAGTTGAAAGG - Intergenic
1177502427 21:21975438-21975460 CAATCATGATGGGAGATGAAGGG + Intergenic
1177619216 21:23565094-23565116 CAATCATGGTGGAAGATGAAAGG - Intergenic
1177803102 21:25847682-25847704 CAATCATGGTGGAAGATGAAAGG - Intergenic
1177835593 21:26183589-26183611 CAATCATGATGGAAGGTGAAGGG + Intergenic
1177945943 21:27469939-27469961 CAATCATGATGGAAGCTGAAAGG - Intergenic
1177997294 21:28117010-28117032 CAACCATGACGGAAGGTGAAGGG + Intergenic
1178154721 21:29838388-29838410 CAAACAAGATGGAAGCTAAATGG - Intronic
1178249058 21:30984745-30984767 CAAAGAGGAGAGAAGAGGTAAGG + Intergenic
1178544099 21:33479371-33479393 CAAACGGGAGGGGCGAAGAAGGG + Intronic
1178603476 21:34015107-34015129 CAGTCATGGGGGAAGATGAAGGG + Intergenic
1178686082 21:34711718-34711740 CAAAAAGGAAGGGAGAAGAAGGG - Intronic
1178767363 21:35466908-35466930 CAATCATGATGGAAGGTGAAAGG - Intronic
1179113683 21:38469790-38469812 TAAACAGGAGGGAATGTAAAAGG - Intronic
1179257739 21:39731403-39731425 CAAAGAGAAGGGAATATGGAAGG - Intergenic
1179899922 21:44385740-44385762 CAATCATGGTGGAAGATGAAGGG + Intronic
1180075942 21:45462355-45462377 CAAACAGAAGAGAAAAAGAAAGG - Intronic
1180785221 22:18543430-18543452 CAGGCAGCAAGGAAGATGAAGGG + Intergenic
1181128803 22:20717471-20717493 CAGGCAGCAAGGAAGATGAAGGG + Intronic
1181242124 22:21482783-21482805 CAGGCAGCAAGGAAGATGAAGGG + Intergenic
1181331918 22:22099283-22099305 CAGACAGGAGGGAAAGTGAGAGG + Intergenic
1181618542 22:24071734-24071756 CAACCTGGAGGGAACATGAAGGG - Intronic
1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG + Intronic
1183122818 22:35743588-35743610 AAGACAGGAGGGAAGAGGAGAGG + Intronic
1183220884 22:36512281-36512303 CAAACAGCAGGCATGCTGAATGG - Intronic
1183256598 22:36766341-36766363 CAGGCACGAGAGAAGATGAAGGG + Intronic
1183341864 22:37285971-37285993 CAACCAGAAGGGAGTATGAAAGG + Intronic
1184318046 22:43713847-43713869 CAAACAGGATGAAAAATAAATGG + Intronic
1184427894 22:44423818-44423840 CAAACCCAAGGGAAGGTGAACGG - Intergenic
1184495168 22:44836841-44836863 GAAACAGGAGGGAAGGGGGAGGG - Intronic
1184946102 22:47805222-47805244 CAATCATGGTGGAAGATGAAGGG + Intergenic
1184952773 22:47856170-47856192 CACATAGGAGGGAAGAATAAAGG + Intergenic
1184999418 22:48235315-48235337 GAAAAAGGAGGGATAATGAATGG - Intergenic
949135034 3:554382-554404 TAGACAGGAAGGAAGATGTAGGG - Intergenic
949224780 3:1681465-1681487 TAAACAGAAAGGAAAATGAAAGG + Intergenic
949316743 3:2764912-2764934 CACACAGCTGGGAAGTTGAAGGG + Intronic
949346956 3:3085389-3085411 AAAACACGAAGGAAGATGAAAGG - Intronic
949650675 3:6155466-6155488 CAAACAGAAGTGAAGTTGAGAGG - Intergenic
949787411 3:7757244-7757266 CAATCATGATGGAAGGTGAAAGG + Intergenic
950997130 3:17514017-17514039 CAGAAAGGAGGAAAGAAGAAAGG + Intronic
951035148 3:17924931-17924953 CAAACAGTAGGGAAAAGGTAGGG + Intronic
951506105 3:23446550-23446572 CTATCAGTAGGGAAGATGAAAGG - Intronic
951773363 3:26282921-26282943 CAATCATGGTGGAAGATGAAAGG + Intergenic
952134297 3:30399650-30399672 CAAACAGAAGGGAAGGGGAGGGG + Intergenic
952185422 3:30962717-30962739 CAATCATGATGGAAGGTGAAGGG + Intergenic
952221242 3:31326378-31326400 CAATCATGGTGGAAGATGAAGGG + Intergenic
952320804 3:32276140-32276162 AAAACAGAAGGGGAGAAGAATGG - Intronic
952611360 3:35214702-35214724 CAATCATGGTGGAAGATGAAGGG + Intergenic
952733462 3:36664625-36664647 CAAACATGACGGAAGGGGAAGGG - Intergenic
952785849 3:37154185-37154207 AAAAAAGAAGGAAAGATGAAAGG + Intronic
953197367 3:40746933-40746955 CAAAAGGGTGGGAAGCTGAATGG + Intergenic
953284641 3:41594780-41594802 CAAACAGCAGGGGAGATGAAAGG + Intronic
953428210 3:42813457-42813479 CAATCATGGTGGAAGATGAAGGG + Intronic
953826767 3:46260000-46260022 CAATCATGAGGGAAGGTGAAAGG + Intronic
955359228 3:58258707-58258729 CAGAAAGGAGGGCAGATAAAGGG - Intronic
955482897 3:59407351-59407373 CATACAGGAGGGAAGAGGGAGGG - Intergenic
955735044 3:62029691-62029713 CCAAAAGGAGGCAGGATGAAGGG + Intronic
955882575 3:63563566-63563588 AAAAGAGGAGAGAAGAGGAAAGG - Intronic
956350255 3:68327149-68327171 CAATCATGATGGAAGGTGAAGGG - Intronic
956676078 3:71733030-71733052 CAAAAAGCAGAGAAGATGTAGGG - Intronic
956689261 3:71860947-71860969 CAAACAGGAGAACAGAAGAATGG + Intergenic
956723915 3:72141464-72141486 AACACAGCAGGGAAGCTGAAGGG + Intergenic
956731133 3:72197734-72197756 CAAAAAGGAGGGAAGAAGTGAGG - Intergenic
957145875 3:76423060-76423082 GAAACAGGAGGGACAGTGAAAGG + Intronic
957242222 3:77674092-77674114 CAATCATGGGGGAAGATGAATGG + Intergenic
957260741 3:77898093-77898115 CAAACATGGTGGAAGGTGAAAGG + Intergenic
957738258 3:84229918-84229940 CATACAGTAGGGAAGCTTAATGG - Intergenic
957903993 3:86534510-86534532 CAATCATGATGGAAGGTGAAGGG + Intergenic
957907768 3:86579321-86579343 CAATCATGATGGAAGATAAAGGG - Intergenic
958513560 3:95081602-95081624 CATAGAGGAGGTAAGATAAATGG - Intergenic
958564412 3:95790346-95790368 CCAAAAGGAGGGAAGAAGAGAGG - Intergenic
958639047 3:96780766-96780788 CAACCATGATGGAAGGTGAAAGG - Intergenic
958745541 3:98129300-98129322 CAATCATGGGGGAAGCTGAAGGG + Intergenic
958777494 3:98503716-98503738 CAATCACGGGGGAAGGTGAAAGG + Intronic
958869096 3:99536042-99536064 CAAACTGGAAGGAAAAGGAATGG - Intergenic
958900907 3:99885733-99885755 CAGAGAGGAGGGAAGAAGAAGGG - Intronic
959203056 3:103272533-103272555 CAATCATGACGGAAGGTGAAAGG + Intergenic
959486751 3:106935576-106935598 CAAAGAGGAGGTAAGGTGAGTGG - Intergenic
960169159 3:114438119-114438141 AAAGCAGAAGGGAAGATGAGGGG + Intronic
960263981 3:115599219-115599241 CAATCACGATGGAAGACGAAAGG + Intergenic
960265022 3:115611373-115611395 AAAACAGGAGGGAGGAAGAAAGG - Intergenic
960350483 3:116586912-116586934 CAAACAGATGGAAAAATGAAAGG + Intronic
960542116 3:118872351-118872373 CAATCATGGTGGAAGATGAAGGG - Intergenic
961341742 3:126227690-126227712 CAAACAGGATGGAGGAACAAGGG + Intergenic
961447213 3:126986492-126986514 GAAACAGGAGTGAAGAAGCATGG + Intergenic
961836188 3:129662024-129662046 CAAACAGTAGGGGAGAAAAAGGG + Intronic
962162609 3:133014624-133014646 CAATCATGATGGAAGGTGAAGGG - Intergenic
962420138 3:135220694-135220716 CAAAGAGGAGAGAAGAGGAGAGG + Intronic
962650470 3:137483647-137483669 CAATCATGGCGGAAGATGAAGGG - Intergenic
962966720 3:140362109-140362131 AAAACAGGAGTAAAGATCAACGG + Intronic
963455700 3:145543877-145543899 CAATCATGATGGAAGGTGAAGGG - Intergenic
963834076 3:150038634-150038656 TAATCATGATGGAAGATGAAAGG - Intronic
963926106 3:150952661-150952683 TTAACAGGTGGGGAGATGAATGG - Intronic
963954142 3:151234598-151234620 TACACAGGAAGAAAGATGAAGGG + Intronic
964302088 3:155300084-155300106 CAATCATGATGGAAGGTGAAGGG + Intergenic
964318182 3:155465902-155465924 GAAAAAGGAGGGAAGAGGAGTGG + Intronic
965119157 3:164529005-164529027 CAAATAGGAGGGAAGAAGGGAGG - Intergenic
965387069 3:168057466-168057488 CAATCATGGTGGAAGATGAAGGG + Intronic
966291077 3:178360686-178360708 AAAACAGGACTGGAGATGAAAGG - Intergenic
966317888 3:178669182-178669204 CAAACATAAGTGAAGATGGATGG + Intronic
966400928 3:179546432-179546454 AAAAGAAGAGGGAAGAAGAAAGG + Intergenic
966417190 3:179701747-179701769 AAAAGAGAAGGGAAGAGGAAGGG - Intronic
966575874 3:181502318-181502340 CAAGCTGCAGGTAAGATGAAAGG - Intergenic
966582543 3:181584455-181584477 GAATCGGGAGGGTAGATGAAGGG + Intergenic
966760817 3:183417814-183417836 CAATCATGGTGGAAGATGAAAGG + Intronic
967154855 3:186683001-186683023 CAATCATGGTGGAAGATGAAAGG + Intergenic
967355148 3:188560923-188560945 GAAACAGGATGGGAGATGAAAGG + Intronic
967576820 3:191104438-191104460 CAAACATGGTGGAAGATAAAGGG + Intergenic
967712356 3:192723922-192723944 GAGAAAGGAGGGAAGAGGAAAGG + Intronic
967993824 3:195151861-195151883 AAAAGAGGAGTGAAGATTAAGGG + Intronic
967994199 3:195154450-195154472 CAAAGAGGAATGAAGATTAAGGG + Intronic
968360891 3:198145967-198145989 CACACAGGAGGGAAGACACAAGG - Intergenic
968476656 4:813483-813505 CAGACATGAGGGATGGTGAAAGG + Intronic
968945826 4:3663703-3663725 CAAACAGGAGGGGAGAGGACAGG + Intergenic
969085929 4:4656362-4656384 CAAACATGGTGGAAGGTGAAGGG + Intergenic
969103494 4:4787680-4787702 CAATCATGGCGGAAGATGAAGGG - Intergenic
969256748 4:6007643-6007665 CAAACAGGTGTTAGGATGAATGG + Intergenic
969996911 4:11322841-11322863 CAATCAAGGTGGAAGATGAAAGG + Intergenic
970645216 4:18112430-18112452 AAAAAAGAAGGGAAGATCAAAGG - Intergenic
970916066 4:21336794-21336816 CAAGTAGGACGGAAGGTGAAAGG - Intronic
970919282 4:21374295-21374317 CAAACATGGCGGAAGGTGAAAGG + Intronic
970976365 4:22047319-22047341 CAATCATGGTGGAAGATGAAAGG + Intergenic
971001704 4:22330634-22330656 CACACAGAAGGGAGAATGAAGGG - Intergenic
971072590 4:23111406-23111428 CAATCATGATGGAAGATGAAGGG + Intergenic
971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG + Intronic
971546079 4:27889287-27889309 GAAAAAGGAAGAAAGATGAAAGG - Intergenic
971948578 4:33314416-33314438 CAATCATGGTGGAAGATGAAAGG - Intergenic
972018033 4:34271007-34271029 CAATCATGGCGGAAGATGAAGGG + Intergenic
972242672 4:37210200-37210222 CAATCATGATGGGAGATGAAGGG - Intergenic
973002638 4:44970385-44970407 AAAACAGGATGGCAGAGGAAAGG - Intergenic
974183528 4:58415004-58415026 CAATCATGACGGAAGGTGAAGGG - Intergenic
974304501 4:60116137-60116159 CAATCATGATGGAAGGTGAAGGG + Intergenic
975206243 4:71646897-71646919 CAAAAGGGAGGGAACATAAAAGG + Intergenic
975705942 4:77112172-77112194 CTAACTGGAGGGAAAATGAGAGG - Intergenic
976013105 4:80516458-80516480 CAATCATGATGGAAGGTGAAGGG + Intronic
976457554 4:85265801-85265823 CAATCATGGTGGAAGATGAAGGG + Intergenic
976484887 4:85590327-85590349 TAAAAAGGAGGAAAGAAGAAAGG - Intronic
977015741 4:91691675-91691697 CAATCATGAAGGAAGATGAAGGG + Intergenic
977039288 4:91994875-91994897 CAATCATGGGGGAAGGTGAAAGG + Intergenic
977382396 4:96292419-96292441 CAAACATGGTGGAAGGTGAAGGG + Intergenic
977650837 4:99467367-99467389 CAGCCAGGCGTGAAGATGAATGG + Intergenic
977854663 4:101875440-101875462 CAATCATGGTGGAAGATGAAGGG + Intronic
978591441 4:110328864-110328886 CAATCATGGTGGAAGATGAAGGG - Intergenic
978905551 4:114001386-114001408 CAAAGAGGATGGAAGCTGGAAGG + Intergenic
979082377 4:116360253-116360275 CAACCAGGTGTGGAGATGAATGG + Intergenic
979200426 4:117971338-117971360 CAAACAGGAAGGAAGTAAAAAGG + Intergenic
979483665 4:121246898-121246920 CAAAGAGGAGGTATGCTGAAGGG + Intergenic
979721335 4:123904177-123904199 CAATCATGATGGAAGGTGAAGGG - Intergenic
979891353 4:126099255-126099277 CAAAAAGAAGGAAAGAAGAAAGG + Intergenic
979891797 4:126106583-126106605 CAATCATGGTGGAAGATGAAAGG - Intergenic
979907432 4:126313263-126313285 CAACCATGGTGGAAGATGAAAGG + Intergenic
979996489 4:127437893-127437915 CAAACATGGTGGAAGGTGAAGGG + Intergenic
980069127 4:128224085-128224107 AAAAGAGGAGGAAAGATGGAAGG + Intergenic
980153940 4:129081499-129081521 CAATCATGGTGGAAGATGAAGGG + Intronic
980232777 4:130065488-130065510 CAAGCATGGTGGAAGATGAATGG - Intergenic
980273286 4:130615255-130615277 CAATCATGATGGAAGGTGAAGGG + Intergenic
980492294 4:133543622-133543644 CCAACATGAGGGAAGATGATTGG + Intergenic
980686444 4:136236454-136236476 CAAACATGGTGGAAGGTGAAGGG - Intergenic
980864260 4:138536087-138536109 CAATCATGGCGGAAGATGAAGGG - Intergenic
981239503 4:142459397-142459419 AAAACATGAGGGTAGATAAAAGG + Intronic
981722152 4:147812479-147812501 CCAACAGGAGGAAAGAAGGAAGG - Intronic
982231537 4:153212382-153212404 CCAAAAGGTGGGAAGATGGAAGG + Intronic
982608329 4:157541023-157541045 CAATCATGGTGGAAGATGAAGGG - Intergenic
982635285 4:157887885-157887907 CAAACAGCAGACAAGATGAAAGG - Intergenic
982855480 4:160376923-160376945 CAATCATGATGGAAGGTGAAGGG + Intergenic
983484410 4:168317427-168317449 AAAAAAGGAGGGAAGAGGAAAGG + Intronic
984907065 4:184638168-184638190 AGAACTGAAGGGAAGATGAAAGG - Intronic
985144452 4:186880199-186880221 CAATCAGGGTGGAAGGTGAAGGG - Intergenic
986063717 5:4215744-4215766 CAGACAAAAGGGATGATGAAAGG - Intergenic
986120568 5:4832049-4832071 CAAAAGGGAGGGAGGAAGAAAGG + Intergenic
986316858 5:6595119-6595141 CAATCATGACGGAAGGTGAATGG - Intergenic
986327834 5:6690977-6690999 CTAACAGGCTGGAAGTTGAAGGG + Intergenic
986605854 5:9522085-9522107 AACAGAGGAGGGAAGAAGAAAGG - Intronic
986851400 5:11817538-11817560 CCAACGGGAGGGAAGGAGAAAGG + Intronic
987378360 5:17259133-17259155 CAATCATGGGGGAAGGTGAAAGG + Intronic
987447267 5:18035118-18035140 CAATCATGACGGAAAATGAAGGG - Intergenic
987659435 5:20854007-20854029 CAAACATGGCGGAAGGTGAAGGG - Intergenic
987670715 5:21003858-21003880 CAAGCAGAAGGGGAGAAGAATGG - Intergenic
987736987 5:21859268-21859290 CAATCAGGAGGGAAGGTGAAGGG + Intronic
987909512 5:24123387-24123409 CAATCATGGTGGAAGATGAATGG + Intronic
988099366 5:26657910-26657932 CAATCATGACAGAAGATGAAGGG + Intergenic
988281779 5:29157811-29157833 TAAACAGCAAGGAAGAGGAAAGG - Intergenic
988327461 5:29788273-29788295 CAATCATGATGGAAGGTGAAAGG - Intergenic
988383428 5:30529526-30529548 CAATCATGGCGGAAGATGAAGGG - Intergenic
988425506 5:31058796-31058818 CAATCATGGTGGAAGATGAAAGG - Intergenic
988459241 5:31417757-31417779 CAAATGGGACTGAAGATGAATGG + Intronic
988764214 5:34351640-34351662 CAAACATGGCGGAAGGTGAAGGG + Intergenic
988946217 5:36203386-36203408 CAAAAAGGACAAAAGATGAATGG + Intronic
989499643 5:42150423-42150445 CAATCATGGTGGAAGATGAAGGG - Intergenic
989776837 5:45219262-45219284 CAATCATGATGGAAGATGAAGGG + Intergenic
990032895 5:51283245-51283267 CAATCATGACGGAAGGTGAAGGG - Intergenic
990765740 5:59179998-59180020 AAAATAGGAGGAAAGATGAGAGG - Intronic
992205161 5:74423608-74423630 GAAAGAGGAGGGAAGGGGAAGGG + Intergenic
992364858 5:76081742-76081764 CAGAGAGGAGGGAAAATGAGAGG + Intergenic
993253227 5:85554728-85554750 CAATCATGATGGAAGGTGAAGGG + Intergenic
993431083 5:87832490-87832512 CAATCAGGGTGGAAGGTGAAAGG + Intergenic
993649531 5:90502333-90502355 CCAACAGGAGGAAAAATGAGAGG - Intronic
993683732 5:90912264-90912286 CAAGCAGGAGGGAAAGGGAAAGG + Intronic
994597435 5:101858053-101858075 CAATCAGGACGGAAGGCGAAAGG + Intergenic
994813617 5:104556106-104556128 CAATCATGATGGAAGGTGAAAGG + Intergenic
994818045 5:104609954-104609976 CAAACAGCAGAGAAGGTGAGAGG + Intergenic
995069678 5:107904966-107904988 GGAAGAGGAGGGAAGAGGAAAGG + Intronic
995260616 5:110100001-110100023 CAAACAGAAGGACAGATGAGAGG + Intergenic
996184648 5:120461087-120461109 CAATCATGGGGGAAGGTGAAGGG - Intergenic
996538552 5:124604590-124604612 CAATCAGAAGGGGACATGAAAGG + Intergenic
997860520 5:137411327-137411349 CAAGCAGGAGGCAAGATGGAGGG + Intronic
999017599 5:148125233-148125255 AAAACAGAAGGGAAGCTAAAAGG - Intronic
999857155 5:155607214-155607236 CACATAGGAGAAAAGATGAAAGG - Intergenic
1000369850 5:160524521-160524543 CCAACAGGAGGGAAAATTAGAGG + Intergenic
1000574919 5:162965784-162965806 CAATCATGGTGGAAGATGAAGGG + Intergenic
1001004763 5:168040343-168040365 CAAAGAAGAGGAAAGATGAGAGG - Intronic
1002157809 5:177296534-177296556 CACTCAGGAGGGAAAAGGAATGG - Exonic
1002601473 5:180356288-180356310 CCAGGAGGAGGGAAGATGCAGGG + Intergenic
1002829155 6:803231-803253 CACAGATGATGGAAGATGAATGG - Intergenic
1003515851 6:6818246-6818268 CAAACAGAAGTGAATATGATGGG - Intergenic
1003663685 6:8088790-8088812 CAGGCAGGCTGGAAGATGAAGGG + Intronic
1003963127 6:11227948-11227970 CAAACAGAGAGGCAGATGAATGG + Intronic
1004058826 6:12170590-12170612 CAAATAGTAGGGAACGTGAAAGG + Intergenic
1004334236 6:14749769-14749791 CAAACAAGAGGACAGATTAATGG - Intergenic
1004483828 6:16046955-16046977 CAATCATGGTGGAAGATGAAGGG + Intergenic
1004906393 6:20240240-20240262 CATTCAGGAAGGAAAATGAATGG + Intergenic
1005022568 6:21432133-21432155 AAAAGAGGAGGGGAGACGAAGGG + Intergenic
1005134844 6:22556236-22556258 TAACCAGGAAGAAAGATGAAAGG + Intergenic
1005472853 6:26179069-26179091 CAAACGGAAGGGAAGGGGAAGGG + Intergenic
1006213146 6:32414493-32414515 CAAAAAGAAGGAAAGAAGAAAGG + Intergenic
1006236761 6:32640113-32640135 CAAAGACCAGGGAACATGAAAGG + Intronic
1006399952 6:33811771-33811793 CAAGGAGGATGGAATATGAAAGG + Intergenic
1006433016 6:34009756-34009778 CCAGCAGGAGGGGAGAGGAAAGG + Intergenic
1007002084 6:38323369-38323391 CAAACAGATGGGAAGAAAAAGGG + Intronic
1007534690 6:42576017-42576039 AAAACAGAAGGGAAAAGGAAAGG - Intronic
1007650218 6:43414828-43414850 GAAACAGTACTGAAGATGAACGG + Intergenic
1007775937 6:44224319-44224341 CAAGCAGGAGGAAAGTTGGAGGG - Intronic
1007984695 6:46196451-46196473 CAAACATGGTGGAAGGTGAAAGG + Intergenic
1008067408 6:47063839-47063861 CAATCATGATGGAAGGTGAAGGG + Intergenic
1008137886 6:47797826-47797848 CTGACAGGAGAGAAGATGATGGG - Intronic
1008902530 6:56637803-56637825 CCAAAAGGAGGGAAAATGACAGG - Intronic
1009214459 6:60903815-60903837 CAAAGAGGAGGGAGGAAGAGAGG - Intergenic
1009547597 6:65041180-65041202 AAAAAAGGAGAGAAGAAGAAAGG + Intronic
1009787866 6:68361548-68361570 CAATCACGAGAGAAGGTGAAGGG - Intergenic
1010170471 6:72969561-72969583 AGTAGAGGAGGGAAGATGAAGGG - Intronic
1010233532 6:73556167-73556189 GAAATAGGAAGGAAAATGAAAGG - Intergenic
1010468390 6:76196185-76196207 CAAAAAGGAGAGAAGAGAAATGG - Intergenic
1010573569 6:77506828-77506850 CAACAAGAAGGGAACATGAAAGG - Intergenic
1010704295 6:79089630-79089652 AAAACAGGAGGAAAGAAGGAGGG - Intergenic
1010743651 6:79537025-79537047 CTTAAAGCAGGGAAGATGAAGGG - Intronic
1011238531 6:85245046-85245068 CAACCAGGAGTGAAGAGGCAAGG + Intergenic
1011283667 6:85702264-85702286 CAAAAAGGAAGGAAGAAGGAAGG - Intergenic
1011298350 6:85847649-85847671 CAATCATGGTGGAAGATGAAAGG + Intergenic
1011341463 6:86319890-86319912 CAATCATGACAGAAGATGAAAGG + Intergenic
1011343896 6:86347732-86347754 CAATCATGATGGAAGGTGAAAGG + Intergenic
1011800304 6:91005195-91005217 GACACAGGAGGAAACATGAAGGG - Intergenic
1012767359 6:103385857-103385879 CAATCATGATGGAAGGTGAATGG - Intergenic
1012805803 6:103891195-103891217 CGAAGAGGAGGGAAGTAGAAAGG + Intergenic
1012907824 6:105088491-105088513 CAATCATGGTGGAAGATGAAAGG - Intergenic
1013232759 6:108171722-108171744 CAAGAAGGAGGGGAGAGGAAGGG - Intronic
1013527808 6:110990901-110990923 AAAACAGGAGGCATGTTGAAAGG - Intronic
1014071759 6:117189846-117189868 CAAACATGGTGGAAGGTGAAGGG - Intergenic
1014431982 6:121381826-121381848 CACACAGGAGGGAAGATCCTGGG + Intergenic
1014611529 6:123553657-123553679 CAATCATGATGGAAGGTGAAAGG + Intronic
1014831719 6:126110529-126110551 AAAACATCAGGGAAGAAGAAAGG - Intergenic
1014968609 6:127787169-127787191 CAAACAGGAAGCAAGATATAGGG + Intronic
1015195548 6:130521541-130521563 CAACCATGATGGAAGGTGAAAGG + Intergenic
1015717779 6:136209978-136210000 CAATCATGGCGGAAGATGAAGGG + Intergenic
1016166669 6:140953834-140953856 CAATCATGGCGGAAGATGAAGGG - Intergenic
1016421732 6:143892203-143892225 CAATCATGATGGAAGGTGAAGGG + Intronic
1016557413 6:145353964-145353986 CAATCATGATGGAAGGTGAAAGG - Intergenic
1016621184 6:146110406-146110428 CAATCATGATGGAAGGTGAAAGG - Intronic
1016625160 6:146158283-146158305 GAAACAAGAGGGAGGATGGAAGG + Intronic
1016876181 6:148867686-148867708 CAATCAGGGCGGAAGGTGAAAGG - Intronic
1018452066 6:163918623-163918645 GAAACAAGAGGAAAGATGAGGGG - Intergenic
1018609997 6:165639009-165639031 CAAATGGGAGGGAAGAAGGAAGG + Intronic
1018999406 6:168736282-168736304 AAAAAAGGAAGGAAGATAAAAGG - Intergenic
1019259119 7:70687-70709 CACACAGGAGGGAAGACACAAGG + Intergenic
1019829903 7:3317470-3317492 AAATGAGGAGCGAAGATGAAGGG - Intronic
1021525105 7:21578041-21578063 CAATCATGATGGAAGATGAAGGG + Intronic
1021607991 7:22428512-22428534 GAGAAAGGAGGAAAGATGAACGG + Intronic
1022218305 7:28287220-28287242 CAATCATGATGGAAGGTGAAAGG + Intergenic
1022237846 7:28479074-28479096 CATACAGAAGAGGAGATGAAAGG - Intronic
1022530906 7:31066309-31066331 CATCCAGGAGGGAAGAATAAAGG + Intronic
1022994920 7:35745520-35745542 CAAAGTGGAGGAAAGATGGAAGG - Intergenic
1023329316 7:39097963-39097985 CAAAAAGTAGGGAAGAAGAAAGG + Intronic
1023589094 7:41762185-41762207 CAATCATGATGGAAGGTGAAGGG - Intergenic
1023619591 7:42056072-42056094 CAATCATGGTGGAAGATGAAAGG - Intronic
1023733269 7:43211795-43211817 GAAACAGAAGGGAAGCTCAAAGG - Intronic
1024207439 7:47175997-47176019 CAAACATGGTGGAAGGTGAAAGG - Intergenic
1026494905 7:70893671-70893693 CAAAGAGAAGAGAAGATGAGCGG + Intergenic
1026517906 7:71088454-71088476 CAATCATGACGGAAGGTGAAGGG - Intergenic
1027713507 7:81639645-81639667 CAAGTATGAGGGAAGAGGAAGGG + Intergenic
1027916786 7:84334720-84334742 AAGACAGGAGGGAAGAAGCAGGG - Intronic
1027916792 7:84334757-84334779 AAAACAAGAGAGAAGATGGAGGG - Intronic
1028118641 7:87030919-87030941 CAATCATGGTGGAAGATGAAAGG + Intronic
1028257176 7:88613545-88613567 CAATCATGAGGGAAGGTGAAGGG + Intergenic
1029184159 7:98726710-98726732 CAATCATGATGGAAGTTGAAGGG - Intergenic
1029882263 7:103827349-103827371 AAAAGAGGGGGGAAAATGAAGGG + Intronic
1030541538 7:110836524-110836546 CAATCATGATGGAAGGTGAAAGG - Intronic
1030545928 7:110895096-110895118 CAAACATGGAGGAAGGTGAAAGG + Intronic
1031172357 7:118308191-118308213 CAATCACGATGGAAGGTGAAGGG + Intergenic
1031365350 7:120894656-120894678 CAATCATGGCGGAAGATGAAAGG - Intergenic
1031800817 7:126242560-126242582 CAATCATGATGGAAGATGAAGGG - Intergenic
1032103668 7:129005645-129005667 CAATCATGGGGGAAGGTGAAGGG - Intronic
1032678226 7:134152881-134152903 CATACAGTAGAGAAAATGAATGG + Intronic
1032875726 7:136036151-136036173 CAATCATGACGGAAGGTGAAGGG + Intergenic
1033790229 7:144783930-144783952 AAAACAGATGGGCAGATGAACGG + Intronic
1034641480 7:152607445-152607467 CAGAGATGAGGGAAGGTGAAAGG + Intergenic
1034745775 7:153522712-153522734 AAAACAGGAGGCAAGAAAAAAGG + Intergenic
1035339584 7:158151654-158151676 GAAACAAGAGGGAAGAAGGAGGG - Intronic
1035451969 7:158983038-158983060 CAATCATGGTGGAAGATGAAAGG + Intergenic
1036037054 8:5031125-5031147 CAAACAGTATTGGAGATGAAGGG + Intergenic
1036125818 8:6061247-6061269 CAATCATGATGGAAGATGAACGG + Intergenic
1036182655 8:6598427-6598449 CAGACATGAGGGGAGAAGAAGGG + Intronic
1036406415 8:8459448-8459470 CAATCAGGGCGGAAGCTGAAAGG + Intergenic
1036435432 8:8728971-8728993 CAAAAAGGTGGGAGGATGAAAGG - Intergenic
1036693181 8:10957588-10957610 CCAACAGGAAGGAAAATGAGAGG + Intronic
1036698131 8:10992687-10992709 CTAACAGGAGGGAAGAGGTCAGG - Intronic
1037449614 8:19003626-19003648 AAAAGAGGAGGGAAGAAGGAGGG + Intronic
1037564036 8:20102063-20102085 CAATCATGATGGAAGGTGAAAGG - Intergenic
1037628494 8:20629813-20629835 AGAAAAGGAGGGAAGAAGAATGG - Intergenic
1037712549 8:21366951-21366973 AAAACAGGAGCTAAGATCAACGG + Intergenic
1038085035 8:24186790-24186812 CAAGCATGCAGGAAGATGAATGG + Intergenic
1038149998 8:24934388-24934410 CAATCATGGTGGAAGATGAAGGG - Intergenic
1038376051 8:27041535-27041557 CAATCATGATGGAAGGTGAAGGG - Intergenic
1038486591 8:27939670-27939692 CTAACTGGATGGAAGAAGAAAGG + Intronic
1039042448 8:33421020-33421042 AAGACAGGTGGGAAGAAGAAGGG + Intronic
1039829113 8:41198922-41198944 CAATCATGATGGAAGGTGAAGGG - Intergenic
1040599629 8:48870757-48870779 CAAATAGGAGGAAGGAGGAAAGG - Intergenic
1040835057 8:51722734-51722756 CAAACAGAAGAGCAGAAGAATGG - Intronic
1040889442 8:52301803-52301825 AAAAAAGGAGGAAGGATGAAAGG - Intronic
1041248714 8:55914134-55914156 GAAAGAAGAGGGAATATGAATGG + Intronic
1041943369 8:63413426-63413448 AAAACAGAATGGAAGATAAAAGG - Intergenic
1042161995 8:65905727-65905749 CAATCATGGTGGAAGATGAAGGG - Intergenic
1043266660 8:78274598-78274620 CAATCATGGTGGAAGATGAATGG - Intergenic
1043330363 8:79109825-79109847 CAATCATGGCGGAAGATGAAGGG + Intergenic
1043438144 8:80253945-80253967 CAAATAGTAAGGAAGAAGAAAGG - Intergenic
1043500556 8:80850534-80850556 GAAACAGGAAGGAGGGTGAAAGG - Intronic
1043591254 8:81835787-81835809 CAATCATGATGGAAGGTGAAAGG + Intronic
1043815131 8:84792426-84792448 CAAACAGAAGAGCAGAAGAAAGG - Intronic
1044066695 8:87707302-87707324 CAATCATGATGGAAGGTGAAGGG + Intergenic
1044250447 8:89999638-89999660 CAATCATGGTGGAAGATGAAGGG + Intronic
1044582760 8:93838487-93838509 GGAGCAGGAGGGAAGAAGAAAGG + Intergenic
1044818988 8:96143439-96143461 CCATCAGGAGGGAAGATGGTGGG - Exonic
1044929948 8:97242409-97242431 CACACAGGCAGGAAGAAGAAAGG - Intergenic
1045558031 8:103233624-103233646 CAGGCAGGAGGAAAGTTGAATGG + Intergenic
1045946134 8:107798315-107798337 CAATCATGATGGAAGGTGAAAGG + Intergenic
1046367745 8:113258569-113258591 CAAGCAGCAGAGAAGATGAAGGG - Intronic
1046543137 8:115612490-115612512 AAAACAGGAGTAAAGAAGAAAGG + Intronic
1046703347 8:117425048-117425070 CAATCATGATGGAAGGTGAAAGG + Intergenic
1047250764 8:123180667-123180689 CAGAGAGGAAGGAAGATGAGAGG + Intronic
1047552890 8:125895855-125895877 GAGACAGGAGGGAAGAAGGAAGG - Intergenic
1047900437 8:129415629-129415651 CATGCAGGAGGCAAGAGGAACGG + Intergenic
1047936902 8:129790581-129790603 AAATCAGGAGGGAAGTTGATGGG + Intergenic
1048127763 8:131656336-131656358 GAAACAGCAGGAGAGATGAAAGG + Intergenic
1048555940 8:135476131-135476153 CAAAAAAGTGGGAAGATGGAAGG - Intronic
1048731136 8:137442134-137442156 CTAACAGAAGGGCAGAAGAATGG - Intergenic
1048738971 8:137532878-137532900 CAATCAAGACAGAAGATGAAGGG - Intergenic
1048872171 8:138808210-138808232 CAGACAGGAGGAATAATGAATGG + Intronic
1049152166 8:141041945-141041967 TAAACAGGAGGCAAGAAGGAGGG + Intergenic
1049320415 8:141993284-141993306 GAAACAGCGGAGAAGATGAAAGG - Intergenic
1049569615 8:143362999-143363021 GTAACAGGAGAGAAGATGGAGGG - Intergenic
1049626435 8:143624485-143624507 CAATCATGATGGAAGGTGAAAGG + Intergenic
1050037681 9:1454499-1454521 CAAACAAGTGAGTAGATGAATGG + Intergenic
1050134100 9:2443233-2443255 CAATCATGATGGAAGGTGAAAGG - Intergenic
1050207530 9:3212816-3212838 CTATCATGACGGAAGATGAAAGG - Intergenic
1050407152 9:5321657-5321679 GAAAAAGGAGGGAAGAGGGAGGG + Intergenic
1050697351 9:8293870-8293892 CAAACATGGTGGAAGGTGAAGGG - Intergenic
1051146535 9:14033076-14033098 CAATCATGATGGAAGGTGAAAGG + Intergenic
1051302142 9:15663440-15663462 CAGGCAGGAGGGTAGAGGAATGG - Intronic
1051309952 9:15758855-15758877 CAATCATGGTGGAAGATGAAAGG - Intronic
1051351509 9:16202169-16202191 CAAACAGGAGGTGAGGTGGATGG - Intergenic
1051554216 9:18364774-18364796 CAATCATGGGGGAAGGTGAAGGG + Intergenic
1051873932 9:21770384-21770406 CAATCATGATGGAAGGTGAAGGG - Intergenic
1052203611 9:25811473-25811495 CCAGCAGGACAGAAGATGAAGGG - Intergenic
1052217924 9:25989428-25989450 CAATCATGAAGGAAGGTGAAAGG + Intergenic
1052462817 9:28788625-28788647 CAATCATGGTGGAAGATGAAGGG + Intergenic
1052609921 9:30758985-30759007 AACACAGGAGGGAGGCTGAAGGG - Intergenic
1052709233 9:32032905-32032927 AAATCATGATGGAAGATGAAGGG + Intergenic
1053525282 9:38824010-38824032 CAATCACGGCGGAAGATGAAAGG + Intergenic
1054197513 9:62048458-62048480 CAATCATGGCGGAAGATGAAAGG + Intergenic
1054640897 9:67540244-67540266 CAATCATGGCGGAAGATGAAAGG - Intergenic
1055168755 9:73228565-73228587 CAATCATGGTGGAAGATGAAAGG - Intergenic
1056513366 9:87327167-87327189 CAAAGAAGAAGGAAGAAGAAGGG + Intergenic
1057633021 9:96736239-96736261 CAAAGAGGAGGGGAGGGGAAGGG - Intergenic
1057692233 9:97295464-97295486 CAGACATGAGGGAGGTTGAAGGG - Intergenic
1057798461 9:98174735-98174757 CAATCATGACGGAAGGTGAAGGG - Intronic
1058109101 9:101011289-101011311 CCAACAGGAAGGAAGAAGAATGG + Intergenic
1058195970 9:101976339-101976361 TACAGAGAAGGGAAGATGAAGGG + Intergenic
1058337040 9:103842805-103842827 CTAAAATGAGGGCAGATGAAAGG + Intergenic
1058407277 9:104691167-104691189 CAAAGATGAAGGAAGAAGAATGG - Intergenic
1059043949 9:110843909-110843931 CAATCATGGTGGAAGATGAAGGG - Intergenic
1059050415 9:110918626-110918648 CAAACAGAAGGGATGAAGGAAGG + Intronic
1059502463 9:114766737-114766759 CAAAAAGAAGGGAGGAAGAAAGG - Intergenic
1059675043 9:116529820-116529842 CAAACATGGTGGAAGTTGAAGGG - Intronic
1059741694 9:117157248-117157270 CACAGAGGAGGGAAGCAGAAAGG + Intronic
1059833244 9:118122181-118122203 AAGACAGGAGGGAGGATGCATGG + Intergenic
1059909276 9:119024432-119024454 CAAATAGGGGGGAGCATGAATGG + Intergenic
1059953323 9:119490381-119490403 CAGTCATGATGGAAGATGAATGG + Intergenic
1060881677 9:127122309-127122331 CAAGCAGGAGGGAAGAGGTAAGG - Exonic
1061401065 9:130368686-130368708 CAATCATGGCGGAAGATGAAGGG + Intronic
1062745596 9:138209798-138209820 CACACAGGAGGGAAGACACAAGG - Intergenic
1185800149 X:3003209-3003231 GAAATAGAAGGGAAGATGGATGG + Intergenic
1185828720 X:3277656-3277678 CAATCATGACAGAAGATGAAGGG + Intronic
1185886048 X:3784150-3784172 CAATCATGGTGGAAGATGAAAGG + Intergenic
1185967007 X:4617533-4617555 CAAAGAAGAGGGCAGAAGAAGGG + Intergenic
1186000331 X:5002170-5002192 CACTCATGATGGAAGATGAAGGG - Intergenic
1186122017 X:6373546-6373568 CAATCATGATGGAAGGTGAAGGG + Intergenic
1186222596 X:7365672-7365694 CAATCATGTTGGAAGATGAAAGG - Intergenic
1186277730 X:7957988-7958010 CAATCATGATGGAAGGTGAAAGG + Intergenic
1187506422 X:19882049-19882071 AAAACAGCAGTGAAGAGGAAAGG + Intronic
1187634546 X:21212118-21212140 CAAACATGGTGGAAGGTGAAGGG - Intergenic
1187706682 X:22016145-22016167 CAGACATGTGGGAAGATGGAAGG - Intergenic
1188379258 X:29471207-29471229 CAAATAGGAGGGAAAAGAAAGGG + Intronic
1188531210 X:31143379-31143401 CAATCATGGGGGAAGGTGAAGGG - Intronic
1188875687 X:35427361-35427383 CAATCATGGTGGAAGATGAAGGG - Intergenic
1189067595 X:37827354-37827376 CAAAGAGAAGACAAGATGAAGGG + Intronic
1189679607 X:43501933-43501955 GAAACAGGAGGCAATATGACAGG + Intergenic
1190133960 X:47777451-47777473 CAATCATGATGGAAGGTGAAGGG + Intergenic
1190269521 X:48851941-48851963 CAATCATGGTGGAAGATGAAGGG + Intergenic
1191636189 X:63379784-63379806 GAAACTGAAGGGAAGATGGAAGG - Intergenic
1192091446 X:68161404-68161426 CAAAATGGAGGAAAAATGAATGG + Intronic
1192667738 X:73105576-73105598 CAAACAGGAAGCAAAATGAAGGG + Intergenic
1192698006 X:73438393-73438415 CAAACATAGTGGAAGATGAAGGG + Intergenic
1192746428 X:73943392-73943414 AAAAGAAGAGGGAAGATGGAAGG + Intergenic
1193225909 X:78984665-78984687 CAATTATGATGGAAGATGAAGGG + Intergenic
1193634368 X:83930193-83930215 CAATCATGGGGGAAGGTGAAGGG + Intergenic
1193756779 X:85418619-85418641 TAAACAAGAGGGAAGAGTAAGGG - Intergenic
1193858335 X:86634047-86634069 CAATCATGGTGGAAGATGAAGGG + Intronic
1194564107 X:95461756-95461778 CAAAAAGGAGAGAAGAATAAGGG + Intergenic
1195159700 X:102158987-102159009 CAATCATGGTGGAAGATGAAAGG + Intergenic
1195237842 X:102919295-102919317 GAGACAGGAGGGGAGAGGAAAGG - Intergenic
1195318780 X:103704333-103704355 CAAACCAAAGGGAAGATGGAGGG + Intergenic
1195385882 X:104313283-104313305 CAAAGAGGGAGGAAGGTGAAGGG - Intergenic
1197172007 X:123444800-123444822 CAAAAGGGAGGGAAGAAGAGAGG - Intronic
1197731430 X:129813503-129813525 CAACCAGAATGGAAGATGACCGG - Intronic
1197779464 X:130145209-130145231 AAAACAGGAAGGATGAGGAAGGG + Intronic
1197865106 X:131009199-131009221 CAATCATGGTGGAAGATGAAGGG - Intergenic
1197867487 X:131034659-131034681 AAAACAGGAGGGAAGAGCAAGGG + Intergenic
1198550257 X:137737500-137737522 CAATCATGACGGAAGGTGAAGGG - Intergenic
1199719047 X:150529055-150529077 CAATCATGACGGAAGGTGAAGGG + Intergenic
1200208029 X:154332067-154332089 GAAACAGTAGGGCAGATCAAAGG + Intergenic
1200395981 X:155988141-155988163 CAATCATGATGGAAGGTGAAGGG - Intergenic
1201520725 Y:14870631-14870653 CAAGTAATAGGGAAGATGAAAGG + Intergenic
1201592235 Y:15628046-15628068 CAACCATGGGGGAAGATGAAAGG - Intergenic