ID: 1182245354

View in Genome Browser
Species Human (GRCh38)
Location 22:28953134-28953156
Sequence ACCAGGGTGTCAAGGGCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182245348_1182245354 3 Left 1182245348 22:28953108-28953130 CCCATTCATCTTAGAGTGTGGAT 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 171
1182245342_1182245354 29 Left 1182245342 22:28953082-28953104 CCAGCATGTTGCATAACTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 100
Right 1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 171
1182245349_1182245354 2 Left 1182245349 22:28953109-28953131 CCATTCATCTTAGAGTGTGGATT 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 171
1182245347_1182245354 4 Left 1182245347 22:28953107-28953129 CCCCATTCATCTTAGAGTGTGGA 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182245354 Original CRISPR ACCAGGGTGTCAAGGGCCCT AGG Intronic
900329072 1:2125021-2125043 GCCAGGCTGGCAAGGCCCCTGGG - Intronic
901678761 1:10901442-10901464 ACCAGGGTGCCAGGGCCCCTGGG - Intergenic
903105345 1:21073692-21073714 ACTAGGCTGTCATGAGCCCTTGG - Intronic
903230751 1:21920973-21920995 ACCAGGGTGACAATGGCCGTTGG - Intronic
903350284 1:22712695-22712717 CCTAGGGTGCCACGGGCCCTGGG + Intronic
903659295 1:24967004-24967026 ACCAGGAGGTCAAGGCCCCTTGG - Intergenic
904291461 1:29488614-29488636 AGCAGGGCCGCAAGGGCCCTCGG - Intergenic
904425357 1:30419306-30419328 GCCTGGGTGTCAGGAGCCCTGGG + Intergenic
904491035 1:30859201-30859223 GCCAGGCTGTTAAGGCCCCTGGG - Intergenic
904550910 1:31316981-31317003 ACTAGGGAGTCAAGGGACCGAGG + Intronic
904707276 1:32400979-32401001 ACCTGGGTGTCAGGGCTCCTTGG - Intergenic
907299341 1:53476797-53476819 AGCAGAGGGTCAAGGGGCCTGGG + Intergenic
907518166 1:55006423-55006445 ACCCGGGTGACATGGACCCTAGG - Intronic
907997456 1:59647322-59647344 AACAAGGTGTGAAGGGCCTTTGG + Intronic
913240590 1:116826275-116826297 ACCAGGATGTGTAGGGACCTGGG - Intergenic
913240601 1:116826316-116826338 GCCAGGGTGTGTAGGGACCTGGG - Intergenic
913240618 1:116826396-116826418 ACCAGGGTGTGCAAGGGCCTGGG - Intergenic
915035868 1:152924337-152924359 GCCTGGCTGTCAAGAGCCCTGGG + Intergenic
918181576 1:182089203-182089225 ACCAGGGCTGCAAGGGCCCAGGG - Intergenic
920192003 1:204199684-204199706 CCCCGGGTGTCCTGGGCCCTGGG + Intronic
923048547 1:230373448-230373470 ACGAGGGTGCCAAGGGCCATGGG + Intronic
923801162 1:237210607-237210629 ACCAGGGAGTCTATGGGCCTTGG - Intronic
924624762 1:245688875-245688897 GCCAGGGTGTCCCGTGCCCTGGG + Intronic
924624790 1:245688956-245688978 GCCAGGGTGTCCCGTGCCCTGGG + Intronic
1064310505 10:14208320-14208342 TTCAGGGTGCCAATGGCCCTGGG + Intronic
1065288965 10:24211283-24211305 ACAATGGTTTCATGGGCCCTAGG - Intronic
1067231355 10:44413169-44413191 ACCAGGTTGTGCAGGGCCATGGG + Intergenic
1074438484 10:113454624-113454646 ATCAGGGTGTCGGGGGGCCTTGG - Intergenic
1075646845 10:124102430-124102452 ACCAGGGTATGGAGGGCCCTTGG - Intergenic
1077014520 11:393805-393827 CCCTGGGGGTCTAGGGCCCTAGG - Intronic
1077234186 11:1472049-1472071 CCCAGGGTGTCCATGTCCCTAGG - Intronic
1079416254 11:20238892-20238914 ACCAGGGTGGCACGTGACCTGGG - Intergenic
1079490230 11:20980754-20980776 CCCAGGGAGTCCAAGGCCCTGGG + Intronic
1082059452 11:47848136-47848158 AACAGGGCGTCAGGGACCCTGGG + Intronic
1083598577 11:63932237-63932259 GCCAGGGAGTCCAGGGGCCTCGG + Intergenic
1084019354 11:66408750-66408772 ACCAGAGGGTCAAGGACCCCTGG + Intergenic
1084177912 11:67433121-67433143 ACCAGAATCTCAGGGGCCCTGGG - Exonic
1089120929 11:116134466-116134488 ACCAGGCTGTCAAGGGCATCTGG - Intergenic
1091652326 12:2319481-2319503 GCCAGGGTGTCAGGGGCCTGGGG - Intronic
1094473599 12:30824690-30824712 ATCAGGATGGCAAGGTCCCTAGG - Intergenic
1095358053 12:41300702-41300724 ACCAGTATGTGAAAGGCCCTAGG - Intronic
1100622714 12:96294753-96294775 ACAAGGGTCTCAGGAGCCCTAGG + Intronic
1101001502 12:100362243-100362265 ACCATGGTGGCAAGGGTCATGGG + Intronic
1102331634 12:112037488-112037510 ACCAGTGGGTGAAGGGCCATTGG + Intronic
1103022433 12:117546632-117546654 AGCAGAGTATCAAGGACCCTTGG - Intronic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1103793903 12:123490355-123490377 ACCTGGGTGGGAAGGGCCCTTGG - Intronic
1104069180 12:125329744-125329766 ACCTGAGTGTCAAGGGGCCGGGG - Intronic
1105263568 13:18797524-18797546 ACCTTGCTGTCACGGGCCCTGGG - Intergenic
1106288202 13:28336534-28336556 CCCAGCGTGTCCAGGGCCCCTGG - Intronic
1115014270 14:28590861-28590883 ACCAGGGTCTCCCGGGCCTTTGG + Intergenic
1117566580 14:56999874-56999896 TCCAGTGTGTCAAGGGGCTTTGG + Intergenic
1118899266 14:69972979-69973001 CCATGGGAGTCAAGGGCCCTGGG + Intronic
1118909133 14:70046656-70046678 CCCAGGGTGTCAAGGTTCCCTGG - Intronic
1119506471 14:75177051-75177073 ATCAAGGTGTCAAAGGCGCTTGG - Intergenic
1119904707 14:78291034-78291056 AGCATGGTTTAAAGGGCCCTGGG - Intronic
1122055520 14:99095634-99095656 AACACAGTGTCATGGGCCCTTGG - Intergenic
1122360028 14:101153552-101153574 ACCAGGGTGTCAGGGGCAGTAGG - Intergenic
1122629118 14:103099327-103099349 GCCACGGTGCCGAGGGCCCTGGG + Intergenic
1122810856 14:104287244-104287266 CCCAGGGTGTCAGGGGCCCCAGG + Intergenic
1125721005 15:41845136-41845158 AGCAGGGTGGGAAAGGCCCTGGG + Intronic
1128248188 15:66147286-66147308 AGGAGGCTGGCAAGGGCCCTGGG - Intronic
1132819888 16:1859744-1859766 ACCAGCCTGTAAAGGGCTCTTGG - Intronic
1133325636 16:4940662-4940684 ATCAGGATGTCAAGGGTCCCAGG - Intronic
1134367946 16:13596659-13596681 ACCTGGGTGTCAGGAGGCCTGGG - Intergenic
1136995953 16:35188135-35188157 TACAAGGTGTCAAGGCCCCTGGG + Intergenic
1138487073 16:57352708-57352730 CCCAGGAGGTCAAGGGCACTGGG + Intergenic
1140266541 16:73426121-73426143 ACCAGGCTGTCCAGGGCTCATGG - Intergenic
1140479001 16:75252522-75252544 ACCAGGGTGCCAGAGCCCCTGGG + Intronic
1143166520 17:4899775-4899797 ATCAGGGTGTCCAGGGAGCTGGG - Exonic
1143442974 17:6989911-6989933 GCCAAGTTCTCAAGGGCCCTAGG - Intronic
1144188069 17:12815004-12815026 ACCAGGGTTTCTAATGCCCTGGG - Intronic
1146568696 17:33935015-33935037 AGCTGGCTGTCTAGGGCCCTGGG + Intronic
1148232042 17:45942373-45942395 CCCAGGGTGTCACGGGACCAGGG + Intronic
1148395830 17:47307476-47307498 ACCAGGATGTCAGGGCCCTTGGG - Exonic
1148816090 17:50329212-50329234 AACAGAGGGACAAGGGCCCTGGG + Intergenic
1151728636 17:75898382-75898404 CTGAGGGTGTCAGGGGCCCTGGG - Intergenic
1154427465 18:14283214-14283236 ACCTTGTTGTCAAGGGCCCTAGG + Intergenic
1154430191 18:14302750-14302772 ACCTTGTTGTCACGGGCCCTGGG + Intergenic
1157593348 18:48849064-48849086 ACCTGGGGGTCAGAGGCCCTGGG - Intronic
1158976850 18:62716941-62716963 CCCGGGCTGTCAATGGCCCTCGG - Exonic
1161490621 19:4559268-4559290 ACCAGGGTCACAGAGGCCCTTGG - Intronic
1161588839 19:5119597-5119619 ACCAGGGAGGGAAGAGCCCTAGG - Intronic
1162615467 19:11797610-11797632 AGCAGGGTGTCACTGGCCTTAGG - Intergenic
1163638931 19:18450749-18450771 GCCAGGGGGTCGTGGGCCCTCGG + Exonic
1164053510 19:21603383-21603405 GCCAGTGTGTCTAGGGCCCCGGG + Intergenic
1166255352 19:41600644-41600666 CCCACGTTGTGAAGGGCCCTGGG + Intronic
1166270251 19:41709129-41709151 CCCAGGCTGTGGAGGGCCCTGGG + Intronic
1167598032 19:50437542-50437564 ACCAGGGTCCCAAGGACCATGGG + Intronic
1168297499 19:55384485-55384507 CCCTGGGTGGCACGGGCCCTAGG - Exonic
925310113 2:2875996-2876018 AGCAGGGTGGCAAGGGCCGGTGG + Intergenic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
926303668 2:11621718-11621740 ACCAGTGTCTGAAGGGCACTTGG + Intronic
927159319 2:20242756-20242778 AGCAGGGTGGCAAGGGCCTGGGG - Intergenic
927172342 2:20380781-20380803 TCCAGGGTATCAAAGGCCCTGGG + Intergenic
930609451 2:53524883-53524905 GCCTGGATGTCAAAGGCCCTGGG - Intergenic
932047610 2:68365413-68365435 ACCAGGGTGTCAGTGGACATGGG + Intronic
934646670 2:96063063-96063085 CTCAGGTTGTCAAGGGCCCCAGG - Intergenic
934840072 2:97619145-97619167 CTCAGGTTGTCAAGGGCCCCAGG - Intergenic
936153655 2:110035118-110035140 CCCAGGGTGGCACAGGCCCTGGG + Intergenic
936191028 2:110336297-110336319 CCCAGGGTGGCACAGGCCCTGGG - Intergenic
936474105 2:112824591-112824613 AGCAGGGTGCCAGGGGCCCTGGG - Intergenic
938380274 2:130832521-130832543 TCCAGGCTGTCTAGGGCCGTGGG - Intergenic
938489724 2:131755261-131755283 ACCAGGGTGGCCAGGGTCCATGG - Intronic
946405798 2:219491519-219491541 AGCAGGGTGACAAGCTCCCTTGG - Intronic
947811679 2:233008543-233008565 ACCTGGGGGTCAAGGGCCTTAGG + Intronic
949035692 2:241814844-241814866 ACCAGGACGTCCAGGGACCTGGG - Intronic
1168837538 20:887926-887948 ATCAGGGTGTCCTGGGCCCCAGG + Intronic
1168879368 20:1193786-1193808 ACCTGGAAGTCAGGGGCCCTTGG - Intergenic
1170438138 20:16350912-16350934 ACAAGACTGACAAGGGCCCTGGG + Intronic
1170792403 20:19518866-19518888 CCCAGAGTCCCAAGGGCCCTAGG + Intronic
1172563060 20:35906451-35906473 ACCAGGCTCTAAAGGTCCCTGGG + Intronic
1172563072 20:35906497-35906519 ACCAGGATCTGAAGGTCCCTGGG + Intronic
1172832048 20:37844243-37844265 ACCTGGGAGTCAGGGGACCTAGG + Intronic
1175744892 20:61449252-61449274 ACCTTGGTTTCAAGGTCCCTCGG - Intronic
1180596039 22:16974065-16974087 AGCAGGGTGTCCAGAGCCCTGGG - Intronic
1180844154 22:18972385-18972407 AGCACTGTGGCAAGGGCCCTGGG + Intergenic
1181057317 22:20266326-20266348 AGCACTGTGGCAAGGGCCCTGGG - Intronic
1181169748 22:21001436-21001458 ACCAGGCTGTCCACAGCCCTGGG + Intronic
1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG + Intronic
1182751340 22:32644456-32644478 ACGTGAGTGTCAGGGGCCCTGGG + Intronic
1185098801 22:48826549-48826571 GCCAGGGAGACAAGGGGCCTAGG - Intronic
1185110818 22:48899181-48899203 CCCAGGATGTCAGTGGCCCTGGG - Intergenic
949249102 3:1961264-1961286 ACCATGATGTCAGGGGCCCTCGG - Intergenic
950262668 3:11553996-11554018 CCCTGGGTGCCAGGGGCCCTGGG + Intronic
950707820 3:14793874-14793896 CCCAGGGTGGCGAGGGGCCTGGG - Intergenic
952684840 3:36135490-36135512 CCCAGGGTGTCAAAGGCACTAGG + Intergenic
953419618 3:42744304-42744326 ACCAGGGTCAGAAGGACCCTAGG - Intronic
955460989 3:59183056-59183078 ACCAGGGTGAGATGGGCCATTGG + Intergenic
956650679 3:71501836-71501858 ACCAGGGTTTTCAGGGCACTGGG - Intronic
958712594 3:97736081-97736103 ACCAGGGTGTGAAGGGCACTGGG - Exonic
960928143 3:122816687-122816709 ACGAGGTTGTCTAGGGACCTGGG + Intronic
961448438 3:126991854-126991876 CCCAGGAGGTCAAGTGCCCTTGG - Intronic
962733543 3:138304439-138304461 ATCAGGGTGTCTGAGGCCCTCGG - Intronic
964968212 3:162525405-162525427 ACCAGAGTGTCACGGATCCTAGG + Intergenic
966928114 3:184658718-184658740 CCCAGGGTGTCCAATGCCCTGGG - Intronic
967036559 3:185652478-185652500 ACCAGGGAGTCAAAAGCTCTAGG + Intronic
967675114 3:192288972-192288994 AGCAGGATGTCAAGGGCACTCGG - Intronic
967792478 3:193564147-193564169 ACCAGGGTGGCAAGGCCTCTGGG - Intronic
981154009 4:141412701-141412723 TGTAGGGTGACAAGGGCCCTTGG - Intergenic
983228333 4:165106021-165106043 ATCAAGGTGCCAAGAGCCCTGGG - Intronic
985591394 5:767185-767207 TCCAGGGTGTGGAGGACCCTGGG + Intergenic
985868059 5:2530817-2530839 ACCAGAGTTTCAGGGGCCCTGGG - Intergenic
989204027 5:38793816-38793838 ACCAGGGTGTGAAGAGGTCTGGG - Intergenic
992090225 5:73310543-73310565 ACCATGGTGACAAGGGGTCTGGG - Intergenic
993041696 5:82822096-82822118 ACCAAGTTGTTAAGGCCCCTGGG + Intergenic
999285894 5:150394053-150394075 TCCAGGCTGTCCAGGGCCATGGG - Intronic
1001129207 5:169049630-169049652 TGCAGGGAGTCTAGGGCCCTAGG - Intronic
1002503730 5:179664657-179664679 AGCAGGCTGTCATGGGCCTTTGG + Intergenic
1003495624 6:6660895-6660917 ACCGGGGTGGCAAGGGGCCTGGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006794196 6:36721711-36721733 ACCCAGATGACAAGGGCCCTGGG + Exonic
1006803694 6:36775305-36775327 CCCAGGGTGTCAGGAGCCCTGGG + Intronic
1007620019 6:43206289-43206311 AGAAGGATTTCAAGGGCCCTTGG - Intronic
1009450156 6:63790996-63791018 ACCAGGCTGTCAAGGACCTAAGG - Intronic
1011650269 6:89499731-89499753 AGCAGTGTCTCAAGAGCCCTGGG - Intronic
1012444759 6:99296521-99296543 CCCCGGGTGTGAAGGGACCTAGG + Intronic
1014860725 6:126464643-126464665 ACCAGGGTCTCTTGGGCCTTTGG + Intergenic
1019065430 6:169292186-169292208 ACAGGGGTGTCAGAGGCCCTGGG - Intergenic
1019147413 6:169984210-169984232 TCCAGGGTGACGAGGGCCCCTGG + Intergenic
1019555941 7:1631416-1631438 GCCAGAGTGTGAAGGGCCCTGGG - Intergenic
1019613180 7:1947173-1947195 AGCTGGGTGCCATGGGCCCTTGG + Intronic
1020086536 7:5313535-5313557 AGTCGGGTGCCAAGGGCCCTCGG - Exonic
1020371109 7:7432683-7432705 CCCAGGGTGTCCAAGGCCCTCGG - Exonic
1020571910 7:9873992-9874014 GCCAGGGTCTCAAGGGCCTACGG - Intergenic
1022220784 7:28311668-28311690 AACAGGGAGTCAGGAGCCCTGGG + Intronic
1022596797 7:31720327-31720349 ACCCTGCTCTCAAGGGCCCTAGG - Intergenic
1025207777 7:57003603-57003625 AGTCGGGTGCCAAGGGCCCTCGG + Intergenic
1025664159 7:63573269-63573291 AGTCGGGTGCCAAGGGCCCTCGG - Intergenic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1026181025 7:68041131-68041153 ACTAGGGTGCTAAAGGCCCTTGG - Intergenic
1031776353 7:125912384-125912406 GCCAGAGTTTCAAGGGCTCTGGG - Intergenic
1033481008 7:141740447-141740469 GCATTGGTGTCAAGGGCCCTGGG + Intronic
1034090653 7:148361303-148361325 TCCAGAGTGTCAAGGGGCCCGGG + Intronic
1035023707 7:155813436-155813458 CCCAAGGGGTCAGGGGCCCTGGG + Intergenic
1038452523 8:27649153-27649175 ATCAGGGTGTCAAAGGGCCTTGG - Intronic
1040521437 8:48179317-48179339 ACCAGGTTGCCAACGGTCCTGGG + Intergenic
1042327367 8:67542128-67542150 AACCTGATGTCAAGGGCCCTGGG + Intronic
1048820102 8:138372513-138372535 GCCTGGGTCTCAATGGCCCTGGG + Intronic
1049523023 8:143104320-143104342 TACAGGTTGTCAAGGGACCTGGG - Intergenic
1049621622 8:143600817-143600839 ACCAGGGTTTGACAGGCCCTGGG - Exonic
1053283552 9:36836688-36836710 ACCAGGGTGTCCACAGCCCCTGG - Exonic
1053379361 9:37636220-37636242 ACCAGGGGATCCAGGGCCCTGGG - Intronic
1055886547 9:81069919-81069941 ACTAGGGTGGCAAGTGACCTAGG - Intergenic
1056776391 9:89516172-89516194 CCTGGGGTGTCAAGGGCACTGGG - Intergenic
1056776663 9:89518139-89518161 TCTGGGGTGTCAAGGGCACTGGG - Intergenic
1057807481 9:98230127-98230149 ACAAGCTTCTCAAGGGCCCTTGG - Intronic
1059970634 9:119664418-119664440 ATCATGGAGTCATGGGCCCTTGG + Intergenic
1060720391 9:125972644-125972666 ACCAGGGTGTCAGAAGACCTGGG - Intergenic
1060758799 9:126231757-126231779 ACCAGGCTGCCAAGTCCCCTTGG - Intergenic
1061865318 9:133489108-133489130 CCCAGGGTGGCAAGGGCCAGAGG - Intergenic
1186053209 X:5622274-5622296 ACCAGGGGCTCTAGGGCCTTCGG + Intergenic
1186339693 X:8630885-8630907 ACCAGGGTGTCAGAGGACATTGG + Intronic
1192184026 X:68934441-68934463 AACTGGGAGTCAAGGGGCCTAGG - Intergenic
1194842036 X:98754526-98754548 ACTAGGGTGTCATGTGACCTAGG - Intergenic
1194955505 X:100174513-100174535 AAAAGGCTGTGAAGGGCCCTGGG - Intergenic
1197089976 X:122524359-122524381 TGCAGGGTGTCCAGTGCCCTGGG - Intergenic