ID: 1182248114

View in Genome Browser
Species Human (GRCh38)
Location 22:28976698-28976720
Sequence CAGTTTTACTTCAAATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 389}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182248114_1182248115 19 Left 1182248114 22:28976698-28976720 CCTTGCAATTTGAAGTAAAACTG 0: 1
1: 0
2: 3
3: 18
4: 389
Right 1182248115 22:28976740-28976762 AGAGAACAATACTTGTCATCTGG 0: 1
1: 0
2: 1
3: 10
4: 149
1182248114_1182248116 23 Left 1182248114 22:28976698-28976720 CCTTGCAATTTGAAGTAAAACTG 0: 1
1: 0
2: 3
3: 18
4: 389
Right 1182248116 22:28976744-28976766 AACAATACTTGTCATCTGGTAGG 0: 1
1: 0
2: 0
3: 22
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182248114 Original CRISPR CAGTTTTACTTCAAATTGCA AGG (reversed) Intronic
902134260 1:14291421-14291443 CAGTCTGAGATCAAATTGCAAGG - Intergenic
902850412 1:19151326-19151348 CAGATTGACATGAAATTGCAAGG - Intronic
904877165 1:33664396-33664418 CAATTTCACATGAAATTGCAAGG + Intronic
907154740 1:52323167-52323189 CAGTGTTCCTTGAAATTCCAGGG + Intronic
907631780 1:56090041-56090063 CAGTCTGAGATCAAATTGCAAGG + Intergenic
908158445 1:61381483-61381505 CATTTTTAATTCAAATCACATGG + Intronic
908452569 1:64270411-64270433 AAGTTTTACTTAAAAATGGATGG - Intergenic
908898104 1:68923883-68923905 CAGTCTGACATCAAACTGCAAGG + Intergenic
910210885 1:84791734-84791756 TAGATTTACCACAAATTGCAGGG - Intergenic
910329820 1:86058927-86058949 AAGTTTTATTTAAAATTGGAAGG - Intronic
911381992 1:97126825-97126847 CAGTTTTTCTTAAAATTCCCTGG + Intronic
912639976 1:111335606-111335628 CAGTCTGACATCAAACTGCAAGG + Intergenic
912644764 1:111382309-111382331 CAGTTTTATTTTACATTGGAAGG - Intergenic
912812784 1:112806406-112806428 CAGTGTTTGTACAAATTGCAGGG + Intergenic
913562635 1:120037490-120037512 AAGTTTTGTTTGAAATTGCAGGG - Intronic
913635487 1:120756117-120756139 AAGTTTTGTTTGAAATTGCAGGG + Intergenic
914201695 1:145490864-145490886 CAGTTTTACTTTAAATTTAGGGG - Intergenic
914283231 1:146196871-146196893 AAGTTTTGTTTGAAATTGCAGGG - Intronic
914480820 1:148063988-148064010 CAGTTTTACTTTAAATTTAGGGG - Intergenic
914544261 1:148647591-148647613 AAGTTTTGTTTGAAATTGCAGGG - Intronic
914622373 1:149423421-149423443 AAGTTTTGTTTGAAATTGCAGGG + Intergenic
914731255 1:150372648-150372670 CAGTTTTACATTAAATGGTAAGG + Intronic
915026021 1:152830639-152830661 CAGTCTGAGTTCAAACTGCAAGG + Intergenic
916363059 1:163992321-163992343 GTGTTTTACTTCCAATTACATGG - Intergenic
917684949 1:177406528-177406550 CAGTCTGAGATCAAATTGCAAGG - Intergenic
917823019 1:178785536-178785558 CATTTTTACTTTATATTTCAGGG + Exonic
919276404 1:195423331-195423353 AAGTTTTAATTCTAATTTCATGG - Intergenic
920994421 1:210975069-210975091 TAGTTTTAACTCAAATTCCAAGG - Intronic
921267269 1:213431974-213431996 CAGTTTTATTTAAAATGGCAGGG + Intergenic
923980156 1:239312446-239312468 CAGCTTTCTTTCAAATTGCTTGG - Intergenic
924018825 1:239758658-239758680 CAGTTCTGCTTCAAATCGCCTGG + Intronic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
924242098 1:242051171-242051193 CAGTCTGAGTTCAAACTGCAAGG - Intergenic
924323761 1:242875071-242875093 CACTATTCCCTCAAATTGCAGGG + Intergenic
1062809466 10:451444-451466 CAGCTTTTCTTCAAGTTGTAGGG + Intronic
1066610943 10:37248006-37248028 CAGTTTTACTTTAAGTTGAGGGG - Intronic
1068333471 10:55602270-55602292 CAGTCTGACATCAAACTGCAAGG + Intronic
1068567881 10:58595451-58595473 GTGTTTTACTTCCAATTACATGG - Intronic
1069669445 10:70189429-70189451 CATTTTTCCTTCAAAATTCATGG + Intergenic
1070147934 10:73788295-73788317 CATTTTAAATTCAAATTACATGG - Intronic
1070760580 10:79021787-79021809 TATTTTAACTTCAACTTGCAAGG + Intergenic
1070893021 10:79956562-79956584 CAGTCTGAGATCAAATTGCAAGG + Intronic
1071354369 10:84778844-84778866 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1073505303 10:103982312-103982334 CAGTTTTCCTGCTTATTGCAAGG - Intronic
1073728049 10:106257597-106257619 CAGTCTGAGATCAAATTGCAAGG + Intergenic
1074221268 10:111440592-111440614 CAGTTTTGCAGCAAATTACAAGG + Intergenic
1077127957 11:952206-952228 AAGTTTTGCTGCACATTGCAAGG + Intronic
1077950770 11:6954471-6954493 CAGTCTGACATCAAACTGCAAGG - Intronic
1078485307 11:11717024-11717046 CAGTTTGAGATCAAACTGCAAGG - Intergenic
1079382431 11:19949613-19949635 CACACCTACTTCAAATTGCATGG - Intronic
1079670954 11:23170370-23170392 TTGTTTTACTTCAAATTACATGG - Intergenic
1079858839 11:25642122-25642144 CAGCTTTACTTCAAATTTTTAGG - Intergenic
1080251827 11:30242334-30242356 TAGTTTTAGTTCCAATTCCATGG - Intergenic
1080820787 11:35804540-35804562 CAGTTTTATTTCAAATATGAGGG - Intronic
1081433794 11:43005098-43005120 CAGTTGGAGATCAAATTGCAAGG - Intergenic
1081827169 11:46066853-46066875 CATTTATACTTGAAAATGCATGG - Intronic
1083031014 11:59592281-59592303 CAGTGTTACCTCTAATTTCATGG - Intronic
1085495396 11:76964225-76964247 CAGTCTGAGATCAAATTGCAAGG + Intronic
1086571863 11:88294388-88294410 CAGTCTTCCTTCATTTTGCATGG + Exonic
1086745697 11:90424407-90424429 CAGTTTGTCTTCAAAATTCATGG + Intergenic
1087411142 11:97791397-97791419 CAGTTTTATTTCAAATATAAAGG - Intergenic
1087824283 11:102747048-102747070 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1087925432 11:103913237-103913259 GTGTTTTACTTAAAATTACATGG - Intronic
1091045433 11:132320558-132320580 CAGTCTGACATCAAACTGCAAGG + Intronic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1095059561 12:37666327-37666349 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1097433452 12:59533539-59533561 AAATGTTACTTCTAATTGCAAGG - Intergenic
1099053590 12:77810062-77810084 CAGTTTAATTTCAAATTCTATGG + Intergenic
1099729446 12:86480941-86480963 TAGTTTTACTTCAAAGTGACTGG - Intronic
1100380531 12:94057593-94057615 CCCTTTGACTTCAAATTCCAGGG + Intergenic
1101112312 12:101497918-101497940 CACTTTTTCTTCATATTGCAAGG - Intergenic
1101194026 12:102364327-102364349 CAGCATTACTTCAAATTTCAAGG + Intergenic
1101495081 12:105246197-105246219 CAGTCTGAGTTCAAACTGCAAGG + Intronic
1103291076 12:119846827-119846849 CACTGTAACCTCAAATTGCAGGG - Intronic
1106320960 13:28638371-28638393 CAGTCTTACTTAAAATTAGAGGG + Intergenic
1106991686 13:35427863-35427885 CAGTCTGAGATCAAATTGCAAGG - Intronic
1107505088 13:41025948-41025970 CAGTTTCCTTTCAAATGGCAAGG + Intronic
1107730590 13:43344414-43344436 CATTTTTACTCCATATTGAATGG - Intronic
1107946860 13:45426809-45426831 CATTTTAAATTGAAATTGCAAGG + Intergenic
1108657747 13:52551738-52551760 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1108815382 13:54284727-54284749 GTGTTTTACTTCCAATTACATGG + Intergenic
1109132780 13:58610046-58610068 CAAATTTGTTTCAAATTGCAGGG + Intergenic
1109240377 13:59879488-59879510 CAGATTTCCTTTAAAATGCATGG + Intronic
1109434255 13:62277818-62277840 GAATTTTACTTCAAATTCAATGG - Intergenic
1110389989 13:74962181-74962203 GTGTTTTACTTCCAATTACATGG - Intergenic
1110665638 13:78115033-78115055 CAGTGTTATTTTGAATTGCATGG + Intergenic
1111001505 13:82189855-82189877 CATTTTTATTTCAAGTTTCAGGG - Intergenic
1111167732 13:84484187-84484209 TTATGTTACTTCAAATTGCAAGG + Intergenic
1111284905 13:86076572-86076594 CAGTTTTAAATCAAACTGCCTGG + Intergenic
1111628232 13:90815936-90815958 GTGTTTTACTTCCAATTACATGG - Intergenic
1111650465 13:91084336-91084358 TAGTTATAACTCAAATTGCAGGG + Intergenic
1111818209 13:93181603-93181625 CACTTTTATTTAAAATTACATGG - Intergenic
1112108142 13:96264669-96264691 CAGTTTTATTTTACAGTGCAGGG + Intronic
1112745455 13:102522413-102522435 CAGTCTGACATCAAACTGCAGGG + Intergenic
1112835410 13:103508231-103508253 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1113009924 13:105752376-105752398 GACTTTTACATCAAATTGTAGGG + Intergenic
1115389261 14:32836064-32836086 ATGATTTACTTCAAAATGCAAGG - Exonic
1116339068 14:43699038-43699060 CAGTCTGACATCAAACTGCAAGG + Intergenic
1116681125 14:47971552-47971574 GTGTTTTACTTCTAATTACATGG + Intergenic
1116739049 14:48732242-48732264 CAGTTTTTCCTCAAATTAAAAGG + Intergenic
1117501192 14:56353295-56353317 ACATTTCACTTCAAATTGCAAGG + Intergenic
1117822123 14:59660476-59660498 GTGTTTTACTTCCAATTACATGG - Intronic
1118094325 14:62519557-62519579 CTGTTTTACTTCTAATTGTGTGG - Intergenic
1118565669 14:67137810-67137832 CAGTTTTAATTTAATTTGGATGG - Intronic
1120512582 14:85433511-85433533 GAATTTTCCTTCAAATCGCAGGG + Intergenic
1124084473 15:26534089-26534111 GTGTTTTACTTCCAATTACATGG - Intergenic
1125784574 15:42304091-42304113 GTGTTTTACTTCCAATTACATGG - Intronic
1128412763 15:67415749-67415771 CAGATTTACTTTAGGTTGCAGGG - Intronic
1130660720 15:85829788-85829810 CAGCTTTCCTGCAACTTGCAGGG + Intergenic
1130672593 15:85925786-85925808 CTGTTTCCCTCCAAATTGCAGGG - Intergenic
1130735194 15:86540752-86540774 ATGTGTTTCTTCAAATTGCAGGG - Intronic
1130798417 15:87235478-87235500 CAGTCTCACATCAAACTGCAAGG - Intergenic
1130806648 15:87330804-87330826 CAGCTTTACTTCCAAGTACATGG + Intergenic
1131729635 15:95266298-95266320 CATTTTTACTACAAATTTCAAGG - Intergenic
1132818291 16:1846489-1846511 CAGTTTTACTTTTAATTTCCTGG - Intronic
1133251980 16:4488455-4488477 CAGTTTTACAGCAAACTGCTGGG + Intronic
1134253533 16:12592150-12592172 CAGTCTGACATCAAACTGCAAGG + Intergenic
1134430263 16:14197617-14197639 ATGTTTTACTTAAATTTGCATGG - Intronic
1135176478 16:20234126-20234148 CATTTTTATTTAAAATTTCATGG - Intergenic
1135566455 16:23514862-23514884 CAGGTTTGTTGCAAATTGCAGGG + Intronic
1135840370 16:25870719-25870741 CAGTTTCTCTTCAATTTGCTTGG - Intronic
1136529573 16:30858709-30858731 CAGTTTCACATGTAATTGCAGGG - Intronic
1136672148 16:31868016-31868038 CAATTTTACTTTAACTTCCAGGG - Intergenic
1137792749 16:51188658-51188680 CAGTTTTTCTTGAAATTGAAGGG + Intergenic
1139101516 16:63772939-63772961 AACTATTACTCCAAATTGCAGGG + Intergenic
1140843757 16:78866828-78866850 CAGTTTTTCTTAAAATAGTAGGG + Intronic
1141027862 16:80564858-80564880 GAGTTTTACTGCAAATTGGGTGG + Intergenic
1141794628 16:86262564-86262586 CAGTCTGACATCAAACTGCAAGG + Intergenic
1143422748 17:6808196-6808218 CAGTCTGAGATCAAATTGCAAGG - Intronic
1143523414 17:7459063-7459085 CAGTTTTCTTTCAATTTGGAAGG + Intergenic
1143547812 17:7609650-7609672 CACTTTTACTTCTACTTGCCTGG + Intronic
1144275051 17:13658529-13658551 CAATTTTAATTCAAAATACATGG + Intergenic
1144333977 17:14252828-14252850 AAGTTATACTTCAAATTGGCAGG - Intergenic
1148724358 17:49777805-49777827 CATTTTTACTTCTGATTGAAGGG + Intronic
1149059197 17:52402024-52402046 GAGTTTTACTTAGAATTGGAAGG - Intergenic
1150987673 17:70216745-70216767 CAGTTTTGCTCCAAAATGAAAGG + Intergenic
1152383235 17:79952998-79953020 CAGTTCTACTTCCACTTGGATGG + Intronic
1153084858 18:1272983-1273005 TATTTTTACTTTAAAGTGCAGGG - Intergenic
1153743014 18:8149056-8149078 GAGTTTTACTTCAAATTTTGTGG + Intronic
1153754636 18:8268126-8268148 TAGTTTTGTTTGAAATTGCATGG + Intronic
1156206818 18:34895170-34895192 CAGTTTGAGATCAAACTGCAAGG + Intergenic
1156434464 18:37111933-37111955 CAGTCTGAGTTCAAACTGCAAGG + Intronic
1156868490 18:41915775-41915797 CAGTTTTTCTCCAAATTCTAGGG + Intergenic
1158033838 18:53000425-53000447 AAGTTTTACGTATAATTGCAGGG - Intronic
1158305606 18:56101989-56102011 CAGTTTTCCTTGAGATTACAAGG - Intergenic
1159433784 18:68388979-68389001 CAATTTTATTTCAATTTGGATGG - Intergenic
1159983024 18:74809156-74809178 CACTTTTGCATAAAATTGCATGG - Intronic
1160398711 18:78592106-78592128 CAGTTTTACTTCATATATCCTGG - Intergenic
1163605017 19:18269558-18269580 CAGTGTTGCTGCATATTGCATGG - Exonic
925111191 2:1339584-1339606 CAGTTTTCCCTCAAATTGAGTGG + Intronic
927302070 2:21526696-21526718 CAGTTTGAGATCAAACTGCAAGG - Intergenic
927432915 2:23042029-23042051 CAGCTTTCCTTCAAAGTTCAGGG + Intergenic
928248902 2:29657459-29657481 CCATTTTAATTCATATTGCACGG - Intronic
928809192 2:35200999-35201021 CAATTTTATTTCAAATTTCTAGG - Intergenic
929702253 2:44173446-44173468 TAGTTTTCCTTCAAATTACAGGG + Intronic
929988275 2:46759642-46759664 CTGATTTGCTTCAAATTACAGGG + Exonic
930205432 2:48583005-48583027 CAGTCTTATTTCAAAGAGCAGGG - Intronic
930927678 2:56839073-56839095 CAGTTTTATTTTTAATTACATGG + Intergenic
932542798 2:72674055-72674077 CAGTGTTACTTCTAAATGAAGGG - Intronic
933602258 2:84345443-84345465 GTGTTTTACTTCCAATTACATGG + Intergenic
935412719 2:102782446-102782468 CATTTTTATTTCAAATTAAATGG + Intronic
939033533 2:137104118-137104140 GTGTTTTACTTCCAATGGCATGG - Intronic
939190986 2:138916587-138916609 CAGTGTCACTTCAAAAGGCAAGG - Intergenic
939893662 2:147766918-147766940 CAGTCTGAGATCAAATTGCAAGG + Intergenic
940030280 2:149255072-149255094 GTGTTTTACTTCCAATTGTATGG + Intergenic
940080574 2:149796335-149796357 CAGTCTGACATCAAACTGCAAGG - Intergenic
940401882 2:153257061-153257083 CAGTCTGAGATCAAATTGCAAGG - Intergenic
940672892 2:156692410-156692432 CTGTTTTTCTTCACATTTCATGG + Intergenic
940809168 2:158223229-158223251 CAGTCTTAGATCAAACTGCAAGG + Intronic
941363820 2:164585246-164585268 GAGATTTATTTCAAAATGCATGG - Intronic
943140477 2:183975834-183975856 CAGTCTGAGATCAAATTGCAAGG + Intergenic
945214792 2:207421785-207421807 CAGTTTTTCCTCAAATTTTATGG + Intergenic
945511626 2:210710068-210710090 CAATTATACTTCAAATTTGACGG + Intergenic
945533241 2:210982202-210982224 GTGTTTTACTTCCAATTACATGG + Intergenic
946774246 2:223120974-223120996 CAGTCTTACTTCCAAGTGCCAGG - Intronic
947632829 2:231665110-231665132 CTGTTTTAATTCAAGATGCACGG - Intergenic
948132053 2:235608213-235608235 CAGTTCTTCTTCATCTTGCAGGG + Intronic
1169074983 20:2754917-2754939 CAATTTTAAAGCAAATTGCAGGG - Intronic
1170412720 20:16108131-16108153 CACTTTTACTTTATATTACAGGG + Intergenic
1170707782 20:18760964-18760986 CAGTCTGAGATCAAATTGCAAGG - Intronic
1174617613 20:51848112-51848134 TAGTTTTACTTCAATATTCAGGG - Intergenic
1175469075 20:59213184-59213206 CATTTTTACATAAAATTGTAGGG - Intronic
1176994770 21:15542808-15542830 CAGTTTTCCAACAAACTGCATGG - Intergenic
1179579617 21:42332894-42332916 CAGTTTTCCAGCAAATGGCATGG + Intergenic
1180117008 21:45714683-45714705 CTGTTTTAATTCACATTTCATGG - Intronic
1180245949 21:46547363-46547385 CTGTTTTAATTCACATTCCAAGG - Intronic
1182167585 22:28191701-28191723 CAGTCTGAGATCAAATTGCAAGG + Intronic
1182248114 22:28976698-28976720 CAGTTTTACTTCAAATTGCAAGG - Intronic
1185123703 22:48991375-48991397 CAGTCTGAGATCAAATTGCAAGG - Intergenic
950596529 3:13988530-13988552 GTGTTTTACTTCTAATTACATGG + Intronic
951861990 3:27263546-27263568 CAGTCTGAGTTCAAACTGCAAGG - Intronic
952146794 3:30542126-30542148 TAGATTCACTTCAAATTCCAGGG + Intergenic
952563270 3:34621360-34621382 CAAATTTATTTGAAATTGCAAGG - Intergenic
952842331 3:37658094-37658116 GTGTTTTACTTCCAATTACATGG + Intronic
953554960 3:43937843-43937865 GTGTTTTACTTCCAATTACATGG + Intergenic
953641178 3:44709754-44709776 CTGATTTGCTTCAAATTACAGGG - Intergenic
954497496 3:50978754-50978776 CAGTTTCAGATCAAACTGCAAGG - Intronic
954537296 3:51370687-51370709 CATTTTTACTTCAAATGGCTTGG + Intronic
955021486 3:55125915-55125937 CTTTTTAACTTAAAATTGCATGG - Intergenic
955622160 3:60876325-60876347 CAATTGTACTTCTAATTGCAGGG - Intronic
956877604 3:73479202-73479224 CAGTTTTATTTGAAGTTGCTGGG - Intronic
957444671 3:80300208-80300230 CAGATTCACTTCAGATTACAAGG + Intergenic
957475101 3:80712162-80712184 GTGTTTTACTTCCAATTACATGG - Intergenic
957867092 3:86039495-86039517 CAGTCTGACATCAAACTGCAAGG + Intronic
958512413 3:95065540-95065562 CAGTCTGAGATCAAATTGCAAGG - Intergenic
958514538 3:95096354-95096376 CTGTATTAATTAAAATTGCATGG + Intergenic
958812169 3:98873496-98873518 CAGGTTTATTTCTAATTGGAAGG - Intronic
959073047 3:101721143-101721165 CACTTTAAGTTCAACTTGCAAGG - Intergenic
961151300 3:124640676-124640698 CAACTTTCCTTCAAATTACATGG - Intronic
961303420 3:125937033-125937055 CAGTCTGAGATCAAATTGCAAGG + Exonic
963930185 3:150996082-150996104 CATTTCTACTTCAAACTTCATGG + Intergenic
964118640 3:153161144-153161166 CACTTTTACTTCAAAACGCCAGG + Intergenic
964341343 3:155711838-155711860 CAGTTTTACTTGAAGTTGCAAGG + Intronic
964888062 3:161507485-161507507 AAGTTTTGGTTCAAATTGTAAGG + Intergenic
965228911 3:166026710-166026732 CAGTTTGAGATCAAACTGCAAGG - Intergenic
966147422 3:176827434-176827456 CAGTCTGACATCAAACTGCAAGG + Intergenic
967532269 3:190562347-190562369 ACTTTTTACTTCATATTGCAGGG + Intronic
967665393 3:192165785-192165807 CAGGCTTACTTCAGATTGAAGGG + Intronic
968009027 3:195260885-195260907 CAGTTTTGGTTCATATTGAATGG + Intronic
970643243 4:18090631-18090653 CAGTCTGAGTTCAAACTGCAAGG + Intergenic
970835376 4:20398911-20398933 CAGTTATACTTCAAATTAATTGG + Intronic
972982206 4:44719177-44719199 CATTTTAACTTCAAACTGAAAGG + Intronic
973858939 4:55041688-55041710 CAGTCTGAGATCAAATTGCAAGG + Intergenic
973935477 4:55842134-55842156 CAGTCTGAGATCAAATTGCAAGG + Intergenic
973984459 4:56336972-56336994 CAGTTTGAAATCAAACTGCAAGG - Intergenic
975034271 4:69661364-69661386 CAGTCTGACATCAAAGTGCAAGG - Intergenic
975219206 4:71795063-71795085 GTGTTTTACTTCCAATTACATGG + Intronic
975726911 4:77301222-77301244 CAGTCTGAGATCAAATTGCAAGG - Intronic
976490742 4:85667232-85667254 CAGTTTGAGATCAAACTGCAAGG - Intronic
976676637 4:87710768-87710790 CAGTTTGAGATCAAACTGCAAGG + Intergenic
976698055 4:87939129-87939151 CAGTTTGTTTTCAAGTTGCAGGG - Intergenic
976807149 4:89061157-89061179 GTGTTTTACTTCCAATTACATGG + Intronic
977093399 4:92708188-92708210 CAGTTTTACTTAAATTTTAAAGG + Intronic
977778698 4:100954787-100954809 CAGTTTTCCTTTAAATAGAAGGG - Intergenic
977860728 4:101956751-101956773 CAGTTTCATTACAAATTTCAAGG - Intronic
977926681 4:102707824-102707846 CATTTTTATTTCCATTTGCATGG - Intronic
978243204 4:106540837-106540859 CAGTCTGAGCTCAAATTGCAAGG - Intergenic
979037541 4:115743500-115743522 CAGTCTTACTTCAGATTGCAAGG - Intergenic
979583618 4:122389263-122389285 GTGTTTTACTTCCAATTACATGG + Intronic
979925222 4:126554627-126554649 GTGTTTTACTTCAAATTACGTGG + Intergenic
981338546 4:143593957-143593979 CAGTCTGACATCAAACTGCAAGG - Intronic
981387991 4:144153637-144153659 CAGTCTGACATCAAACTGCAAGG - Intergenic
981494845 4:145379406-145379428 CAGTCTGACATCAAACTGCAAGG - Intergenic
982459563 4:155651907-155651929 CATTTTTACTTCAAGTTTGAAGG + Intergenic
982844136 4:160228479-160228501 TAGTTTACCTTCAAATTGTAAGG - Intergenic
983602454 4:169546387-169546409 GTGTTTTACTTCCAATTACATGG + Intronic
983800032 4:171916732-171916754 CATTTTTATTTTAAAATGCAGGG + Intronic
985329674 4:188817316-188817338 CAGTTTTAATTCATTTTTCAGGG - Intergenic
986374513 5:7116330-7116352 TCGTTTTACTTCAAGTTGCTAGG - Intergenic
986623185 5:9697137-9697159 CAGATTTAGTTCAAATTAAAAGG - Intronic
989156034 5:38345873-38345895 GTATTTTACTACAAATTGCAAGG + Intronic
990215208 5:53523816-53523838 TAGTTTCATTTCAAATAGCACGG - Intergenic
990438761 5:55822196-55822218 AAGTTTTACATAAAATTGCAGGG + Intergenic
990678624 5:58216307-58216329 CAGTTTGAGATCAAACTGCAAGG + Intergenic
990860388 5:60320211-60320233 CAGTCTGAGTTCAAACTGCAAGG - Intronic
990870577 5:60427244-60427266 CAGTTTTACTACAATGTGCCTGG - Intronic
991304700 5:65164413-65164435 CAGTCTGAGATCAAATTGCAAGG + Intronic
992288050 5:75255722-75255744 CAGTTTGAGATCAAACTGCAAGG - Intergenic
993135555 5:83957183-83957205 CGGTTTCACTCCATATTGCATGG - Intronic
993577636 5:89621923-89621945 CAGTTTGAGATCAAACTGCAAGG + Intergenic
994015314 5:94958006-94958028 CAGTTTTACTTCCAATTATGTGG - Intronic
994574985 5:101566908-101566930 GAGTTTTACTTCTAATTGTGTGG + Intergenic
994634196 5:102323411-102323433 AAGTGTTTCTTTAAATTGCATGG + Intergenic
994825018 5:104702070-104702092 CAATTTTAATTAAAATTGAAGGG - Intergenic
995023496 5:107393060-107393082 CATTTTAACTACAAATTGCTGGG + Intronic
995334133 5:110979335-110979357 CAATTTTACTTTAAATTTAATGG - Intergenic
995491519 5:112697216-112697238 CAGGTTTACTTTAAAATGAAAGG - Intergenic
995729209 5:115219107-115219129 CAGATTCATATCAAATTGCAAGG + Intronic
996158525 5:120132610-120132632 CAGTCTGAAATCAAATTGCAAGG - Intergenic
996586433 5:125092973-125092995 AACTTTTACTTTAAATTACAGGG - Intergenic
996594919 5:125189432-125189454 CAGTTTTGCTTCACAAGGCATGG - Intergenic
996748750 5:126868414-126868436 CTGTTTTACTTCACAGGGCAGGG + Exonic
996825471 5:127677126-127677148 CAATTTGACTTCAACTGGCAAGG + Intergenic
997024333 5:130040177-130040199 CAGTTTTATTTCAGATTTAATGG - Intronic
998320342 5:141224422-141224444 CTGTATTACTTCAAAATCCAGGG - Exonic
998755360 5:145372350-145372372 GTGTTTTACTTCCAATTACATGG + Intergenic
998769453 5:145525291-145525313 CAATTTACCTGCAAATTGCAAGG - Intronic
1000738180 5:164931837-164931859 GTGTTTTACTTCCAATTACATGG + Intergenic
1000815816 5:165920192-165920214 CAGTCTTACTTCAGATTGCAAGG - Intergenic
1001851604 5:174972397-174972419 CAGTTTTACTGCCATTAGCATGG - Intergenic
1202775174 5_GL000208v1_random:63055-63077 CAGTCTGAGTTCAAACTGCAAGG - Intergenic
1202775395 5_GL000208v1_random:65673-65695 CAGTCTTAGATCAAACTGCAAGG + Intergenic
1004598962 6:17129323-17129345 CAGTTTTAAGACAAACTGCATGG + Intronic
1004760388 6:18659162-18659184 GTGTTTTACTTCCAATTACATGG - Intergenic
1006853932 6:37119700-37119722 CAGTTTTAGGTAAAAGTGCAGGG + Intergenic
1006871327 6:37254890-37254912 CAGTTCCACTTCAAATCACAAGG + Intronic
1008093097 6:47311967-47311989 CATTGTTACTTCAAAATGGAAGG - Intergenic
1008421283 6:51302284-51302306 CAGTTTCACTTCAACCTTCATGG - Intergenic
1008580068 6:52898643-52898665 CAGGTTTACTTCAGATCCCAGGG - Intronic
1008736804 6:54554784-54554806 GTGTTTTACTTCCAATTACATGG - Intergenic
1009176058 6:60460956-60460978 CAGTTTGAGATCAAACTGCAAGG - Intergenic
1009361379 6:62818519-62818541 CAGTTTGAGATCAAACTGCAAGG - Intergenic
1009374030 6:62945466-62945488 CACATTTACTTGAAATTGAAAGG + Intergenic
1009648795 6:66446288-66446310 GTGTTTTACTCCTAATTGCATGG - Intergenic
1009688992 6:67002347-67002369 CATTTTTAGTTCATTTTGCAAGG - Intergenic
1010080351 6:71854680-71854702 CAGTTTTACTTCAACCTGTTGGG - Intergenic
1010288294 6:74105339-74105361 AATTTTAACCTCAAATTGCATGG - Intergenic
1010526460 6:76905811-76905833 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1011265841 6:85518047-85518069 ATGTTTTACTTTTAATTGCAGGG - Exonic
1011358529 6:86497836-86497858 CAGTTTGAGATCAAACTGCAAGG - Intergenic
1012546012 6:100420337-100420359 CAGTCTGTGTTCAAATTGCATGG + Intronic
1013974551 6:116061877-116061899 CTGTTCTTTTTCAAATTGCAAGG + Intergenic
1014919072 6:127191243-127191265 AAAACTTACTTCAAATTGCATGG - Intronic
1015075749 6:129154782-129154804 CAGTTGAACTTCAAATTAAAAGG + Intronic
1015179518 6:130346483-130346505 CAGTCTGACATCAAACTGCAAGG + Intronic
1015611560 6:135026807-135026829 CATTTTTATTTCATATTGCCTGG - Intronic
1015759497 6:136643622-136643644 TATTTTTACTTTAAGTTGCATGG - Intronic
1015918426 6:138242287-138242309 CAGACTTACTTCCCATTGCAGGG - Intronic
1016627425 6:146188487-146188509 AAGTTTTAGTACAAATTGCAAGG - Intronic
1017312695 6:152992396-152992418 CAGTTTTGCATATAATTGCAGGG - Intronic
1018455323 6:163946567-163946589 CAGTTTCACTGCAAGGTGCACGG + Intergenic
1018533008 6:164787567-164787589 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1021032008 7:15748994-15749016 GAGTTTTACATCTAATTCCACGG - Intergenic
1021319685 7:19194657-19194679 CAGTTTGAGATCAAACTGCAAGG - Intergenic
1021379893 7:19954438-19954460 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1021386576 7:20038273-20038295 GAGTTTGAATTCAAAATGCAAGG + Intergenic
1022376533 7:29817310-29817332 CAGTCATACTACAAATTGCAGGG - Intronic
1023164201 7:37326859-37326881 CAGTTTCCCTTCCAATTGAAGGG - Intronic
1023562437 7:41490112-41490134 CAGTATTACTTAAGATTGGATGG - Intergenic
1023601113 7:41882709-41882731 GAGTATAATTTCAAATTGCAAGG + Intergenic
1023611639 7:41977787-41977809 CAGTTTTTCATCAACTTGGAGGG - Intronic
1024901566 7:54323854-54323876 CAGTCTGATTTCAAACTGCAAGG - Intergenic
1024998241 7:55292328-55292350 GTGTTTTACTTCCAATTACATGG + Intergenic
1025577530 7:62667258-62667280 CAGTCTGAGATCAAATTGCAAGG + Intergenic
1027348344 7:77285205-77285227 CAGTTTTTCCTCAAATGCCAAGG + Intronic
1027456429 7:78397536-78397558 CACTTATACTTCAATTTTCATGG - Intronic
1027792355 7:82650251-82650273 CAGTCTGAGTTCAAACTGCAAGG + Intergenic
1028139430 7:87256924-87256946 GTGTTTTACTTCCAATTACATGG - Intergenic
1028350141 7:89836866-89836888 CAAATTTACTTTAAATTGTAGGG - Intergenic
1028451736 7:90992887-90992909 CAGTTGTACTTCAAACTCCGTGG - Intronic
1028453232 7:91009306-91009328 CAGTTTTACTTGTAATAGAAAGG - Intronic
1029670404 7:102026467-102026489 GAGTTTTATTTCTAATGGCAAGG + Intronic
1029911457 7:104153692-104153714 CAGTTTTCCTTAAAATTCCATGG - Intronic
1029979464 7:104864528-104864550 CAGTCTGAGATCAAATTGCAAGG + Intronic
1030289825 7:107861030-107861052 TAGTTTTACTTAAAATTGGAGGG + Intergenic
1031089121 7:117332085-117332107 CACTTTTACTTCAACTAGCAAGG - Intergenic
1031154059 7:118087877-118087899 TAGTTTTCCTACAAATTCCATGG - Intergenic
1031263087 7:119547980-119548002 CAGTTTTATTTTAATTTGAAGGG - Intergenic
1033911056 7:146263527-146263549 AAGTTTTACTTGAAAATGTAAGG - Intronic
1034371889 7:150605995-150606017 CAGTCTGACATCAAACTGCAAGG + Intergenic
1035176952 7:157058291-157058313 CATTTTCACTTCCAACTGCAAGG - Intergenic
1036464716 8:8985922-8985944 CATTTGTACCTCACATTGCAGGG - Intergenic
1037221061 8:16522017-16522039 CATTTTTACTTCATTTTGCAAGG - Intronic
1038034184 8:23673268-23673290 AAATTTTACTTTAAAATGCAAGG + Intergenic
1038136602 8:24792623-24792645 CAGATTTACTCCAAAGGGCACGG - Intergenic
1038250999 8:25904148-25904170 AAGTTTTAATTAAAATTTCAGGG - Intronic
1038619220 8:29124351-29124373 CAGTTTTATTTCTAATGGCTTGG + Intronic
1039167834 8:34705741-34705763 CAATTTCATTTCAAATTGAAAGG + Intergenic
1040708159 8:50154132-50154154 CAGTCTGACATCAAAGTGCAAGG - Intronic
1041338283 8:56812306-56812328 CAGTCTGACATCAAACTGCAAGG - Intergenic
1043182713 8:77105911-77105933 CAGTCTGAGATCAAATTGCAAGG + Intergenic
1044615620 8:94137376-94137398 CAGTCTGAGATCAAATTGCAAGG - Intronic
1045582459 8:103496933-103496955 CAGTTTGACATAAAATTGCTGGG - Intergenic
1045880804 8:107037499-107037521 CAGTTTTGCTTAAAATGGAAAGG + Intergenic
1046106729 8:109674879-109674901 GTGTTTTACTTCCAATTACATGG - Intronic
1046916618 8:119684469-119684491 CAGTTTCACTGCAAATTTCAGGG + Intergenic
1047831604 8:128637494-128637516 GCCTTTTGCTTCAAATTGCATGG + Intergenic
1047982167 8:130194599-130194621 CAGTTTTTCTACAGATGGCAGGG + Intronic
1050141293 9:2518982-2519004 GTGTTTTACTTCCAATTACATGG + Intergenic
1050504723 9:6336246-6336268 CAGTCTGAGATCAAATTGCAAGG + Intergenic
1050857807 9:10383489-10383511 ATGTTTTACTTCAAATGGAAAGG + Intronic
1052189396 9:25640559-25640581 CTCTTTTAATTGAAATTGCATGG - Intergenic
1052546917 9:29891338-29891360 GTGTTTTACTTCCAATTACATGG - Intergenic
1052762086 9:32602961-32602983 CAGTTTTACTTTCAACTGTACGG - Intergenic
1053626566 9:39877201-39877223 CAATTTTAATCCAAATGGCATGG - Intergenic
1053878300 9:42566043-42566065 CAATTTTAATCCAAATGGCATGG + Intergenic
1053894361 9:42728324-42728346 CAATTTTAATCCAAATGGCATGG - Intergenic
1054217321 9:62373502-62373524 CAATTTTAATCCAAATGGCATGG + Intergenic
1054233393 9:62535651-62535673 CAATTTTAATCCAAATGGCATGG - Intergenic
1054996334 9:71394994-71395016 CAGTGGTACTTCCAGTTGCAGGG - Intronic
1055153942 9:73038149-73038171 CAGTTTTTCTACATAATGCAAGG - Intronic
1055856781 9:80697908-80697930 CAATTCTACTTCAAATACCAGGG + Intergenic
1055912851 9:81371808-81371830 CCCTTTAACTTCAAAATGCAGGG + Intergenic
1056006300 9:82275135-82275157 CAGTTTTTCATTAAATCGCAGGG + Intergenic
1058260078 9:102817108-102817130 CAGTTTTACTTCCAATTATGTGG - Intergenic
1058799591 9:108532146-108532168 TATTTTTGCTTCAAATAGCAGGG - Intergenic
1058976973 9:110133869-110133891 TAGGTTTACTTGAAATTGAATGG + Intronic
1059005101 9:110393769-110393791 CAGTCTGACATCAAACTGCAAGG + Intronic
1059314666 9:113413869-113413891 AAGTTTTACTCCAAATTTCATGG + Exonic
1186816724 X:13245421-13245443 CAGTTTTACTCCCCATTGCTTGG + Intergenic
1186905816 X:14109558-14109580 CAGTCTGACATCAAACTGCAAGG - Intergenic
1187710021 X:22043932-22043954 AACTGTGACTTCAAATTGCAAGG - Intronic
1188207559 X:27379198-27379220 CAGTGTCACTCTAAATTGCATGG - Intergenic
1188261521 X:28030462-28030484 CAGTTTTTCCTCAAAATGTAGGG - Intergenic
1188587051 X:31790242-31790264 CACTTTTACGTCAGATTGAATGG - Intronic
1188952357 X:36391725-36391747 CATTTTTACTTCAAAGTGGTTGG - Intergenic
1191032661 X:55991234-55991256 CAGTCTGACATCAAACTGCAAGG - Intergenic
1191038434 X:56052876-56052898 CAGTCTGACATCAAACTGCAAGG - Intergenic
1191120079 X:56894326-56894348 CAGTTTGAGATCAAACTGCAAGG + Intergenic
1191266195 X:58396817-58396839 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1192004506 X:67195478-67195500 GTGTTTTACTTCCAATTACATGG - Intergenic
1192395895 X:70780713-70780735 CAGTTTGAGTTCTAACTGCAAGG + Intronic
1192406421 X:70890611-70890633 CAGTTTGAGATCAAACTGCAAGG + Intronic
1192598917 X:72440941-72440963 CAGTCTGAGTTCAAACTGCAAGG + Intronic
1193050019 X:77089672-77089694 CAGTTTGAGATCAAACTGCAAGG + Intergenic
1194633405 X:96314673-96314695 CAGGTTTTCTGCAAATGGCAGGG - Intergenic
1196007098 X:110848771-110848793 CAGTTTTCCCTCAATTTACATGG + Intergenic
1196061546 X:111412857-111412879 CAGATTTACTTCACATAGAAAGG - Intergenic
1196561489 X:117154407-117154429 CTGTTTTACTTCCAATTATATGG - Intergenic
1196853564 X:119961865-119961887 CAGTCTGAGATCAAATTGCAAGG + Intergenic
1197432469 X:126383545-126383567 CAGTCTAAGTTCAAACTGCAAGG + Intergenic
1197497676 X:127205797-127205819 GAGTTTTGATTGAAATTGCATGG - Intergenic
1197988258 X:132290208-132290230 CAGTTTGAGATCAAACTGCAAGG - Intergenic
1198855758 X:141014263-141014285 TAGTTTTACTGCAAATAGTAGGG - Intergenic
1198876371 X:141231876-141231898 TAGTTTTACTGCAAATAGTAGGG + Intergenic
1198906935 X:141573105-141573127 TAGTTTTACTGCAAATAGTAGGG + Intergenic
1199099961 X:143788217-143788239 TAGTCTTTCTTCACATTGCATGG - Intergenic
1199657998 X:150016990-150017012 AAGATTTACTTAAAATTGAAGGG + Intergenic
1200820273 Y:7575655-7575677 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1201230612 Y:11860676-11860698 CAGTCTGAGATCAAATTGCAAGG - Intergenic
1201626836 Y:16024162-16024184 CAGTCTGAGATCAAATTGCAAGG - Intergenic