ID: 1182253865

View in Genome Browser
Species Human (GRCh38)
Location 22:29023841-29023863
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2124
Summary {0: 1, 1: 0, 2: 2, 3: 98, 4: 2023}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182253865_1182253873 28 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181
1182253865_1182253875 30 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 189
1182253865_1182253870 -2 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253865_1182253874 29 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182253865 Original CRISPR CCCAGCTATCAGGCAGGCAT GGG (reversed) Intronic