ID: 1182253870

View in Genome Browser
Species Human (GRCh38)
Location 22:29023862-29023884
Sequence GGTGCCTCTTGAGCCAATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182253857_1182253870 19 Left 1182253857 22:29023820-29023842 CCCCCAAATGCCAGCCAGTTCCC 0: 1
1: 0
2: 2
3: 34
4: 451
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253867_1182253870 -3 Left 1182253867 22:29023842-29023864 CCATGCCTGCCTGATAGCTGGGT 0: 1
1: 0
2: 2
3: 22
4: 254
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253858_1182253870 18 Left 1182253858 22:29023821-29023843 CCCCAAATGCCAGCCAGTTCCCC 0: 1
1: 0
2: 4
3: 23
4: 210
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253862_1182253870 5 Left 1182253862 22:29023834-29023856 CCAGTTCCCCATGCCTGCCTGAT 0: 1
1: 1
2: 1
3: 21
4: 257
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253860_1182253870 16 Left 1182253860 22:29023823-29023845 CCAAATGCCAGCCAGTTCCCCAT 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253863_1182253870 -1 Left 1182253863 22:29023840-29023862 CCCCATGCCTGCCTGATAGCTGG 0: 1
1: 0
2: 0
3: 72
4: 251
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253868_1182253870 -8 Left 1182253868 22:29023847-29023869 CCTGCCTGATAGCTGGGTGCCTC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253865_1182253870 -2 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253859_1182253870 17 Left 1182253859 22:29023822-29023844 CCCAAATGCCAGCCAGTTCCCCA 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98
1182253861_1182253870 9 Left 1182253861 22:29023830-29023852 CCAGCCAGTTCCCCATGCCTGCC 0: 1
1: 0
2: 6
3: 47
4: 488
Right 1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182253870 Original CRISPR GGTGCCTCTTGAGCCAATGT CGG Intronic
900320205 1:2079822-2079844 GGTGCCCCACGAGTCAATGTGGG - Intronic
904498063 1:30898615-30898637 GGTTCCTCTTGGGCCAGGGTAGG - Intronic
907242587 1:53088975-53088997 GGTCCCTGGTGAGCCAAGGTTGG + Exonic
911202692 1:95061611-95061633 AGGGCCTCTTGAGCCACTGAAGG + Intronic
915519734 1:156435115-156435137 GGTGACTCTTAGGCCAGTGTCGG - Intergenic
915672034 1:157497748-157497770 GCTGACTTTTGAGCCAATCTGGG - Intergenic
920762318 1:208797021-208797043 GCAGCCTCTTGAGCCACAGTAGG + Intergenic
921397657 1:214685854-214685876 TGTGCTTCTTCAGCCAATGAAGG - Intergenic
922267630 1:223999431-223999453 GCTACCTCTTGAGCAAGTGTAGG + Intergenic
923162355 1:231326097-231326119 GAAGCCTCCTGAGCCAAAGTAGG - Intergenic
924767359 1:247046424-247046446 GGTGCCTTTTTAGCCAAAGCTGG - Intronic
1063149544 10:3323676-3323698 GGTGGCTCTTAATCCAATGCTGG + Intergenic
1064935708 10:20677045-20677067 GGAGCCTCCTGAGCCAGAGTAGG + Intergenic
1065976473 10:30846808-30846830 GGTGCTTCTTGAGCCCGTGGGGG - Intronic
1066726078 10:38396181-38396203 GCTACCTCTTGAGCAAGTGTAGG - Intergenic
1069047693 10:63760556-63760578 GTTGCCACTTGAACCAGTGTGGG + Intergenic
1071176321 10:82930757-82930779 GGTGACACTTGATCCAATGGAGG + Intronic
1077071217 11:674431-674453 GGGGCCTTGTGAGCCAAGGTGGG + Intronic
1078854828 11:15198458-15198480 AGTGCCTCCTGAGCCAAAGGAGG + Intronic
1082898013 11:58213733-58213755 GGTGTCTCTTGAGACCATTTTGG + Intergenic
1083011141 11:59400813-59400835 GCAGCCTCTTGAGCCAGGGTAGG - Intergenic
1084914632 11:72419357-72419379 CCTGCCTCTTGAGGCAGTGTAGG - Intronic
1091026931 11:132149755-132149777 GGTGACCCTGGAGCCAGTGTGGG + Intronic
1091822003 12:3482396-3482418 AGTGCATCCTGAGCAAATGTGGG - Intronic
1094017208 12:25878062-25878084 GGTGCCTCTTGAGTTAAGGCTGG + Intergenic
1099040591 12:77648821-77648843 GGTGCCTATTGAGTAAATATGGG + Intergenic
1100298147 12:93281767-93281789 GCAGCCTCTTGAGCCAGAGTAGG - Intergenic
1102601706 12:114036505-114036527 AGTGGTTTTTGAGCCAATGTAGG - Intergenic
1103344494 12:120240415-120240437 GGTGACTCTGGAGCCACTGTGGG - Intronic
1103931493 12:124453219-124453241 GGTGCCTCATGGCCCCATGTGGG - Intronic
1104347915 12:128019385-128019407 GCAGCCTCCTGAGCCAAAGTAGG + Intergenic
1107229701 13:38093619-38093641 GCAGCCTCCTGAGCCAAAGTAGG + Intergenic
1119762687 14:77163099-77163121 GTTGCCTCTTGAGGGAAGGTAGG - Intronic
1120837476 14:89054468-89054490 GGTGACTCCTGTTCCAATGTAGG + Intergenic
1138428758 16:56954108-56954130 GCAGCCTCTTGAGCCTAAGTAGG + Intergenic
1140019274 16:71222087-71222109 GCAGCCTCTTGAGCCAGAGTAGG - Intronic
1140250816 16:73292774-73292796 GTGGCCTCTTGAGCCCAGGTAGG + Intergenic
1140814970 16:78613040-78613062 GGTGCCTCTTGAGAGTTTGTAGG + Intronic
1142177495 16:88651765-88651787 GGTCCCACCTGAGCCAATGTGGG + Intergenic
1142888896 17:2930221-2930243 GGGGCCTGGTGAGCCACTGTAGG - Intronic
1146823646 17:36004710-36004732 GAAGCCTCTTGAGCCAGAGTAGG + Intergenic
1147327445 17:39676281-39676303 AGTGGCCCTGGAGCCAATGTGGG + Intronic
1147388885 17:40097369-40097391 GGAGCCACTGGAGCCAATGTAGG + Exonic
1147463492 17:40591443-40591465 GAAGCCTCTTGAGCCAGAGTAGG - Intergenic
1150069240 17:62138130-62138152 GGTGGATCTTGAGCCAATCCAGG + Intergenic
1151460288 17:74250161-74250183 GGGGCCTCTAGAGCCAAGGGAGG - Intronic
1152691609 17:81720657-81720679 GGTGGTTCTGGAGCCATTGTGGG + Exonic
1160566589 18:79789950-79789972 GGTGCCTCCTGTGCCAAGGAAGG + Intergenic
1160726850 19:621165-621187 GGTGGATCTTGAGCCAATCCAGG + Exonic
1161155381 19:2729964-2729986 GATGTCTCTTGAGCCACTTTTGG - Intronic
1162429550 19:10619473-10619495 GCAGCCTCCTGAGCCAAAGTAGG - Intronic
1163028243 19:14526608-14526630 GGTGCCTGTTGAGTAAGTGTGGG + Intronic
1163070345 19:14835292-14835314 TGTGCCTATTGAGCAGATGTGGG - Intronic
1163326649 19:16607886-16607908 GGCTCCTCGTGAGCCAATGAGGG + Intronic
1166524105 19:43500298-43500320 AGTGCTTCCTGAGCCAGTGTTGG - Intronic
1166874888 19:45891110-45891132 GGTGCCACTTGGGCCAGTGGCGG + Exonic
926335635 2:11860599-11860621 GGTGGCTTGTGAACCAATGTTGG - Intergenic
927652825 2:24922622-24922644 GGTGTCTCTTGTGCCAAAGCAGG - Intergenic
935148535 2:100413244-100413266 AGTGCCTCTAGAGCTAATGGTGG + Intronic
935829656 2:106987757-106987779 GGAGCCTCCTGAGCCAGAGTAGG - Intergenic
937021632 2:118662319-118662341 GGTTCCTGTGGAGCCAATGAAGG - Intergenic
1174736527 20:52971185-52971207 GGTGGCTCTAGATTCAATGTAGG - Intergenic
1176272838 20:64245400-64245422 GCAGCCTCGTGAGCCAGTGTAGG + Intergenic
1176389620 21:6156868-6156890 CGGGCCTCCTGAGCCAATGCAGG - Intergenic
1179733848 21:43381370-43381392 CGGGCCTCCTGAGCCAATGCAGG + Intergenic
1181358450 22:22316677-22316699 GGAGCCTCTTGAGCCAAGGCTGG + Intergenic
1181695609 22:24591434-24591456 GGGGCCTCTAGACCCCATGTGGG + Intronic
1182253870 22:29023862-29023884 GGTGCCTCTTGAGCCAATGTCGG + Intronic
949686620 3:6580372-6580394 ATTGCCTCTTGAGTCAATCTAGG - Intergenic
954564105 3:51583869-51583891 GTAGCCTCTTGAGCCATGGTGGG + Intronic
957458604 3:80487502-80487524 AGTGCCTCTTTAGAAAATGTAGG + Intergenic
960135340 3:114098598-114098620 GCAGCCTCTTGAGCCAGAGTAGG - Intergenic
970248307 4:14087524-14087546 GTAGCCTCTTGAGCCAGAGTAGG + Intergenic
975952049 4:79785781-79785803 GGTGACTTTTGAGGCAAAGTTGG + Intergenic
980934576 4:139214107-139214129 GCTGCCTCATGGGCCACTGTTGG + Intergenic
984116042 4:175682664-175682686 GGTGCCTTTTGAGCCATGGTTGG - Intronic
989654797 5:43734726-43734748 GGTGCCTCATAAGCCAAGGGAGG + Intergenic
990984261 5:61626604-61626626 GGGGCAACTTGAGGCAATGTCGG + Intergenic
998433696 5:142088743-142088765 GGTGCTTCTTCCACCAATGTTGG + Intergenic
999617361 5:153438371-153438393 TGTGCCCCTTGAGACAATTTAGG - Intergenic
1002004832 5:176223764-176223786 GGTTCTTCTTGAACCAATTTTGG - Intergenic
1002160269 5:177310762-177310784 AGTGGCTCTTGAGCCACTGGGGG - Intronic
1002221541 5:177686860-177686882 GGTTCTTCTTGAACCAATTTTGG + Intergenic
1004687516 6:17961405-17961427 GGTGCTTGTTGGGCCAATTTTGG - Intronic
1005104084 6:22204372-22204394 TGTGCCTCTTGTGCCAACTTTGG + Intergenic
1014009075 6:116456362-116456384 GTAGCCTCTTGAGCCAGAGTAGG - Intergenic
1017349224 6:153419863-153419885 GCAGCCTCCTGAGCCAGTGTAGG + Intergenic
1021118480 7:16770727-16770749 GGTCCCTCCTGAGCAAATTTTGG + Intronic
1022746153 7:33174417-33174439 GCAGCCTCTTGAGCCAGAGTAGG + Intronic
1022903234 7:34831028-34831050 GGTGCCTCTTGGTCCAGGGTTGG - Intronic
1023993042 7:45141330-45141352 GGTGACTCTTTAGCCATTTTAGG + Intergenic
1024068191 7:45762243-45762265 GCTACCTCTTGAGCAAGTGTAGG - Intergenic
1032478620 7:132228927-132228949 GGTGCATCTTGAGCCATGGCTGG - Intronic
1038149759 8:24931892-24931914 GCAGCCTCTTAAGCCAAAGTAGG - Intergenic
1038853149 8:31300087-31300109 AGTGCCTCTTAAGCCAAGATGGG + Intergenic
1044278114 8:90325478-90325500 GCTGCCACTTGAGCCAGTGTAGG - Intergenic
1055141690 9:72883606-72883628 GGTTACTCTTGAGGGAATGTAGG - Intergenic
1058539361 9:105995501-105995523 GGTGCCCCATGAGCCAGTGCTGG - Intergenic
1060672808 9:125485200-125485222 GGTGCCCCCTGAGCCAGTGGGGG - Intronic
1060936356 9:127518347-127518369 GGTGCCTCTAGGGCCATTCTGGG - Intronic
1061848346 9:133400587-133400609 TGTGCCTCCTGGGCCAAGGTGGG + Intronic
1062610154 9:137369913-137369935 GGGGCCTCTTGAGGCCAGGTGGG + Intronic
1189226616 X:39418848-39418870 GGTGCCCCTTCAGCAAATGAGGG + Intergenic
1192686093 X:73306483-73306505 GGTGCCTGTTGACCCATTTTGGG - Intergenic
1194599204 X:95899753-95899775 GCAGCCTCTTGAGCCAGAGTAGG + Intergenic
1197163328 X:123347932-123347954 TGTGACTCTTGAGCCAATGAAGG + Intronic