ID: 1182253873

View in Genome Browser
Species Human (GRCh38)
Location 22:29023892-29023914
Sequence TACAATTACCTGCTTATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 181}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182253865_1182253873 28 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181
1182253868_1182253873 22 Left 1182253868 22:29023847-29023869 CCTGCCTGATAGCTGGGTGCCTC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181
1182253869_1182253873 18 Left 1182253869 22:29023851-29023873 CCTGATAGCTGGGTGCCTCTTGA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181
1182253867_1182253873 27 Left 1182253867 22:29023842-29023864 CCATGCCTGCCTGATAGCTGGGT 0: 1
1: 0
2: 2
3: 22
4: 254
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181
1182253863_1182253873 29 Left 1182253863 22:29023840-29023862 CCCCATGCCTGCCTGATAGCTGG 0: 1
1: 0
2: 0
3: 72
4: 251
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181
1182253871_1182253873 3 Left 1182253871 22:29023866-29023888 CCTCTTGAGCCAATGTCGGCATA 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181
1182253872_1182253873 -6 Left 1182253872 22:29023875-29023897 CCAATGTCGGCATATTCTACAAT 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182253873 Original CRISPR TACAATTACCTGCTTATTTG TGG Intronic
900878525 1:5363866-5363888 TACCAATTCCTGCTTATTTGGGG + Intergenic
903964900 1:27081708-27081730 TGCATTTCCCTGCTTATTTATGG + Intergenic
905150753 1:35925356-35925378 TACAATTATCTCCTAATTGGTGG - Exonic
908306077 1:62818089-62818111 TAAAATTACATGCATGTTTGGGG + Intronic
908681866 1:66670842-66670864 TACAATTTCCTACTTAAATGCGG + Intronic
909161262 1:72152654-72152676 TATAAGTACATGCTTATTTTTGG - Intronic
910418091 1:87023018-87023040 TACATTTATCTGCTTTCTTGAGG + Intronic
911123608 1:94319925-94319947 TTCAATGCCCTGCTTATTTTGGG + Intergenic
912783785 1:112579086-112579108 TACAATAACCTGCTTATGGACGG + Intronic
916283102 1:163074374-163074396 TACAATAACCTGCTTTGATGAGG + Exonic
916532932 1:165675453-165675475 TACAAGTACCTATTCATTTGTGG + Intronic
916763445 1:167837565-167837587 TAGAATTACTTGCTTTCTTGTGG - Intronic
916946352 1:169732201-169732223 TTTAATTACTTGTTTATTTGTGG - Intronic
920281121 1:204844439-204844461 TACAATTAAGCACTTATTTGAGG - Intronic
921344847 1:214172731-214172753 TACAATCTCCTTTTTATTTGAGG + Intergenic
923005583 1:230046894-230046916 TGCCATTACCTGCTTATTAAAGG - Intergenic
1063698446 10:8360637-8360659 TACAAGTATCAGCTCATTTGTGG - Intergenic
1072363240 10:94681542-94681564 TATAATTAACTTCTTTTTTGTGG - Intergenic
1072490873 10:95905090-95905112 TACAATTACCTTTCTATATGAGG + Intronic
1073651450 10:105363831-105363853 TACAATTTCCTTATTATTTATGG + Intergenic
1076922732 10:133463624-133463646 CATAATTTCCTTCTTATTTGAGG + Intergenic
1077659900 11:4058493-4058515 TAGAATTAAGTGCTTACTTGTGG + Intronic
1078960755 11:16266180-16266202 TACAATAACCTGCCTTTTTGGGG - Intronic
1079567621 11:21902102-21902124 TACCACTACCTGCTGATTGGAGG - Intergenic
1081254997 11:40881595-40881617 TATAATTACTTTCATATTTGAGG + Intronic
1081529886 11:43950879-43950901 TACTAATTTCTGCTTATTTGTGG - Intergenic
1081603418 11:44511302-44511324 TACGATTACCTGCTTATTATTGG - Intergenic
1083707944 11:64529650-64529672 GGCAAATACCTGCGTATTTGGGG - Intergenic
1083884985 11:65568810-65568832 TTCAGTTTCCTGCTTATGTGGGG + Intergenic
1085163874 11:74377908-74377930 TACAATTCACTGATTACTTGGGG + Intronic
1088643317 11:111895169-111895191 CACATGTTCCTGCTTATTTGTGG + Intergenic
1088946648 11:114520101-114520123 CACAATTACCTTTTTAATTGAGG + Intergenic
1090490994 11:127160668-127160690 TCCAAGTACCTGCTAATTTGGGG + Intergenic
1090708253 11:129359879-129359901 TACAACGACATGCTTAGTTGTGG + Intergenic
1093535228 12:20215384-20215406 TAAAATTATGTGGTTATTTGTGG - Intergenic
1093547257 12:20363236-20363258 TACAATTCTCTTTTTATTTGTGG - Intergenic
1098010946 12:66050927-66050949 TACTAGTACCTCCTTACTTGTGG - Intergenic
1098260855 12:68669308-68669330 TACATTAACATGCTAATTTGGGG - Exonic
1098809242 12:75063981-75064003 GAAAATTACCTGATTTTTTGTGG - Intronic
1099419307 12:82435193-82435215 GACAATTACATGGATATTTGGGG - Intronic
1100121899 12:91378084-91378106 TACAATTATTTTCTCATTTGGGG + Intergenic
1102264502 12:111471604-111471626 TATAATTAACTGCAAATTTGTGG + Intronic
1106030772 13:26000252-26000274 TAAAATTACCTACTTGTTTTTGG + Intronic
1107618577 13:42199663-42199685 TAAAATTACCTGCATTTTTCAGG - Exonic
1108240987 13:48464081-48464103 TACAAATACCTGCTTATTACAGG - Intronic
1108927179 13:55767341-55767363 TATAATTATCTGCTTATCTCTGG - Intergenic
1112146318 13:96704442-96704464 TACAATTACCTTCCTACTTGAGG - Intronic
1113287815 13:108872836-108872858 TAAAATTACCTGCTTTTTATAGG + Intronic
1115109057 14:29799222-29799244 AACAATTACTTGTTTAATTGAGG - Intronic
1115856959 14:37640433-37640455 TACAATTACTTGGATATTTAGGG + Intronic
1116046386 14:39748580-39748602 TTCAATTACATTATTATTTGGGG + Intergenic
1116330034 14:43584133-43584155 TACAATTAGCAGCATATTTTAGG + Intergenic
1116908078 14:50425386-50425408 TACAAATATTTGCTTATTTCAGG - Intronic
1118856047 14:69623571-69623593 TACAGTTAACTGTTTTTTTGGGG - Intronic
1120258975 14:82158442-82158464 AACAATCACCTGCATATTTGTGG - Intergenic
1122163827 14:99806190-99806212 GATAATTACCTGCACATTTGAGG + Intronic
1126338695 15:47615724-47615746 TAGAATTTCCTTCTTATGTGTGG - Intronic
1127698743 15:61476402-61476424 TACAATTACATGATGATTTCTGG + Intergenic
1127792747 15:62412846-62412868 GACAATTAGAAGCTTATTTGAGG + Intronic
1128924720 15:71644774-71644796 CACCATTACCAACTTATTTGAGG + Intronic
1138002909 16:53300488-53300510 TATGATTACATGCTTATTTAGGG - Intronic
1138819070 16:60236455-60236477 TAAATTTACCAGTTTATTTGAGG - Intergenic
1144375363 17:14634737-14634759 TTTAATTAACTGCTTATTTTTGG + Intergenic
1149171399 17:53815585-53815607 TACATTTATTTGCTTATTTTGGG - Intergenic
1152226690 17:79096086-79096108 TTCAGTTACCTGCCCATTTGAGG - Intronic
1153169554 18:2300243-2300265 TACTCTTATCTGCTTATTTGTGG - Intergenic
1154326234 18:13392771-13392793 TTCACTTACCTAGTTATTTGAGG - Intronic
1156845684 18:41663076-41663098 AGCAATTACCTGATTATTAGGGG - Intergenic
1156960074 18:43016976-43016998 TACAATTACCTTTTAATTTTTGG - Intronic
1157318307 18:46612447-46612469 TGCATTCCCCTGCTTATTTGGGG + Intronic
1158824678 18:61203238-61203260 TACAAATCCCTGCCTATTTAAGG + Intergenic
1165561665 19:36685788-36685810 AACAATTAGCTTATTATTTGGGG + Intergenic
1166585227 19:43940568-43940590 AAAAATCACATGCTTATTTGAGG - Intergenic
929823827 2:45294826-45294848 TACAATTAGTTGCCTCTTTGAGG + Intergenic
937472100 2:122182999-122183021 CACAATTACCAGCTTGTTTAGGG + Intergenic
937472239 2:122184062-122184084 CACAATTGCCAGCTTGTTTGGGG + Intergenic
941116081 2:161473929-161473951 TATAATTACCTGCATTTTTGTGG + Intronic
941341688 2:164313621-164313643 TGCAATTTCCTGTTTACTTGTGG + Intergenic
942917960 2:181335267-181335289 AACAATTACCTGATGATTTCCGG - Intergenic
943939672 2:193976653-193976675 TAAAAATATATGCTTATTTGTGG + Intergenic
944183630 2:196925004-196925026 TATAATTCCCTCCTTATTTTTGG - Intronic
944975318 2:205043293-205043315 TGCTATTACCTACTTTTTTGGGG + Intronic
946028585 2:216687681-216687703 CACCATTACCTTCTCATTTGGGG - Intronic
1168775567 20:444514-444536 TAAAATTACCTCTTTATTTCAGG - Intronic
1169810081 20:9600992-9601014 CACACTTACCTGCCTGTTTGGGG - Intronic
1171961101 20:31495012-31495034 TACATTTCCCTTGTTATTTGGGG + Intergenic
1174200421 20:48803132-48803154 TGCTATTACCTACTTATCTGGGG - Intronic
1175398178 20:58682045-58682067 TACAATTATCTGGTCAGTTGAGG + Intronic
1176892514 21:14335312-14335334 TTCAATAACCTGATTCTTTGTGG - Intergenic
1177104646 21:16939880-16939902 TGCAATTTCATGCTTCTTTGTGG + Intergenic
1177925282 21:27206717-27206739 TACATTTACCAGCTTCTGTGTGG - Intergenic
1178205717 21:30462633-30462655 GGCAATCACCTGCGTATTTGGGG - Intergenic
1178572843 21:33756651-33756673 CATAAATACATGCTTATTTGGGG - Intronic
1182253873 22:29023892-29023914 TACAATTACCTGCTTATTTGTGG + Intronic
1183278794 22:36920800-36920822 TATAATTAACTTGTTATTTGGGG + Intronic
1183858177 22:40650574-40650596 TACAATGCCCTGCTTAGTTGTGG + Intergenic
1183974854 22:41505878-41505900 TACAATAAACTGCATATTTAAGG - Intronic
1184682109 22:46078035-46078057 AATATTTACCTGCTGATTTGGGG + Intronic
1184974310 22:48050236-48050258 TAGAATTTCCTTCTTGTTTGAGG - Intergenic
949796780 3:7860106-7860128 CATAATTACCTGTTTTTTTGTGG - Intergenic
951056968 3:18158593-18158615 TCCATTCATCTGCTTATTTGTGG + Intronic
955440874 3:58953709-58953731 TACACTTATGTGCTTTTTTGGGG + Intronic
956879533 3:73496795-73496817 TACAATTGTTTGCTAATTTGAGG - Intronic
957599172 3:82310204-82310226 CACAATTACATGCTTTTATGGGG - Intergenic
959057208 3:101579482-101579504 TACAATAATCTGGTTATTTGTGG - Intronic
960228791 3:115199685-115199707 TAGAATTATCTGGCTATTTGAGG - Intergenic
960439931 3:117674516-117674538 GACAATGTCCAGCTTATTTGTGG + Intergenic
962509971 3:136088556-136088578 TACAAGTACCTGTATCTTTGTGG + Intronic
963204870 3:142622879-142622901 TACAATTTCCTAATTATTTCTGG + Intronic
964728433 3:159839438-159839460 TTAAATTCCCTGCTTATTTTTGG - Intronic
965121003 3:164556914-164556936 TACAATTATCTTATTATTGGAGG + Intergenic
965172543 3:165285301-165285323 GACAATTTCCCGCATATTTGGGG - Intergenic
965552474 3:169981939-169981961 CAAAAGGACCTGCTTATTTGGGG + Intronic
965665166 3:171085829-171085851 TACATTTACATCCTTATTTAGGG + Intronic
965746160 3:171928469-171928491 TACAATCTCCTTCTTATTTCAGG - Intronic
965798211 3:172463754-172463776 TAGAATTTCCTTCTTTTTTGAGG + Intergenic
966262085 3:177991111-177991133 TATAATCACCTACTTATTTTAGG - Intergenic
967383857 3:188890664-188890686 TACATTTACTTGCCTATGTGTGG + Exonic
967909433 3:194529007-194529029 TAGAATGACCTCGTTATTTGAGG - Intergenic
968415845 4:433022-433044 TACAAATACCTTCTGATTTTTGG + Intronic
973285429 4:48410742-48410764 AAGAATGACCTGCTTATCTGTGG + Intronic
975459749 4:74637090-74637112 TACTCTTACCAGCTTATTTGGGG - Intergenic
975842136 4:78486379-78486401 TACAATTATCTTTTTATTTATGG - Intronic
975957761 4:79862425-79862447 CACAATGACTTCCTTATTTGTGG + Intergenic
976765555 4:88593700-88593722 TAGAAATAGCTTCTTATTTGTGG - Intronic
977412426 4:96684959-96684981 TACAATTAAATGATTTTTTGAGG + Intergenic
977689227 4:99885970-99885992 TACATTTAACTGGTTATCTGAGG + Intronic
982089759 4:151870264-151870286 TTCAGTTACTTGCTTTTTTGGGG + Intergenic
982570468 4:157044420-157044442 CACAATTGCCTTCTGATTTGGGG - Intergenic
983587086 4:169367446-169367468 TACAATTACGTATTTATATGTGG - Intergenic
983838206 4:172420047-172420069 TACCATTATGTGCTTATTTATGG + Intronic
984850700 4:184150078-184150100 TACAATTTCTGGCTGATTTGGGG + Intronic
987056073 5:14193352-14193374 TAAATTTAAATGCTTATTTGAGG + Intronic
989079681 5:37604698-37604720 TACAAATACCTGCCTATATAGGG + Intronic
990637132 5:57741416-57741438 CACAATTATCTACTTTTTTGAGG + Intergenic
995547724 5:113249616-113249638 CAGATTTACCTGCTTATTTTTGG - Intronic
997050159 5:130370930-130370952 TACAACCGCCTGCTTTTTTGTGG - Intergenic
998896087 5:146801703-146801725 TACAATTACCTACTTAATAAGGG + Intronic
999464160 5:151785941-151785963 TACAAGCACATTCTTATTTGAGG - Intronic
1000802793 5:165749581-165749603 TACAATTATATACATATTTGTGG + Intergenic
1000858082 5:166424797-166424819 TCCAGTTACCTGCTAATTAGTGG - Intergenic
1001759574 5:174196085-174196107 GACTATTACCAGTTTATTTGTGG + Intronic
1002584766 5:180237451-180237473 TACAACTACCTGGTCATTAGAGG + Intronic
1002692205 5:181058365-181058387 TTCAGTTACCTGCATATTTTTGG - Exonic
1002956206 6:1867690-1867712 TACAATTACCTAATTAATAGAGG - Intronic
1003485588 6:6574829-6574851 TAAAATTGCCTGTTTATTTTTGG - Intergenic
1005192775 6:23244700-23244722 AGGAACTACCTGCTTATTTGAGG + Intergenic
1009973719 6:70651672-70651694 TAAAATCACCTGTTTACTTGGGG + Intergenic
1010622774 6:78097704-78097726 TAGTATTACCTTTTTATTTGAGG + Intergenic
1010762096 6:79735074-79735096 TACCATTACATACGTATTTGTGG + Intergenic
1012698052 6:102415003-102415025 TGCATTTATCTACTTATTTGGGG + Intergenic
1014571657 6:123016320-123016342 TAAAATTACGTGCTTTTTTTGGG + Intronic
1015773829 6:136793609-136793631 AAAAAGTACCTGCTTATTTGGGG + Intergenic
1016053131 6:139551026-139551048 TTCAATTACTTGATTTTTTGGGG + Intergenic
1021183980 7:17541503-17541525 TACATTCACCTGGTCATTTGGGG + Intergenic
1021199757 7:17715381-17715403 TACAAATACCTACTGATCTGTGG + Intergenic
1021702579 7:23334404-23334426 TTAAATTATCTGCCTATTTGGGG - Intronic
1021715612 7:23459424-23459446 TACCTTTACCTGGTTATTTTAGG - Intronic
1022523408 7:31022314-31022336 TACAATCACCTGCCTATTTGAGG + Intergenic
1023503855 7:40879666-40879688 TACATTTACCTGTTTTATTGTGG + Intergenic
1027769014 7:82382859-82382881 TACATTTACGTTCTTGTTTGTGG - Intronic
1028554762 7:92110365-92110387 TTGAATTACCTGTATATTTGTGG + Exonic
1032970077 7:137151006-137151028 TACAATTATCTGCCCTTTTGGGG + Intergenic
1033627642 7:143126446-143126468 TACAATGATCTGATTAGTTGAGG - Intergenic
1035981546 8:4378025-4378047 TACACTTACCTGTATATTAGAGG - Intronic
1037448352 8:18990640-18990662 TACAATTACCAGGATATTTCTGG + Intronic
1039630047 8:39100892-39100914 TACTTTTACTTTCTTATTTGAGG + Intronic
1040783917 8:51142669-51142691 TACAATTAACTGCTTAATTGGGG - Intergenic
1041446308 8:57954468-57954490 CAGAAATACCTGCTTGTTTGTGG + Intergenic
1042633706 8:70849845-70849867 TAGATTTTCCAGCTTATTTGTGG - Intergenic
1043534908 8:81192206-81192228 CACAAGTCCCTGCTTATTAGAGG + Intergenic
1043724110 8:83587827-83587849 TACAATCAGTTGTTTATTTGAGG + Intergenic
1045623273 8:104008366-104008388 TAAATATTCCTGCTTATTTGTGG + Intronic
1047647865 8:126887640-126887662 TACAATAACCTCCTTATTAATGG + Intergenic
1047787488 8:128167989-128168011 TGCAATTCCCTGCTTAATTAAGG + Intergenic
1047965670 8:130044783-130044805 AACATTTACCAGCTTATCTGTGG + Intergenic
1051035446 9:12739240-12739262 TACAATTACTTGATTACTTGTGG + Intergenic
1051691304 9:19715640-19715662 CACATTTGCCAGCTTATTTGTGG - Intronic
1055098205 9:72436276-72436298 TACTATTTCTTGATTATTTGTGG + Intergenic
1055123942 9:72696985-72697007 TTTAATTACCTTCATATTTGAGG + Intronic
1055139862 9:72864231-72864253 AACAATTACCTGTTAATTGGAGG - Intergenic
1058248092 9:102655683-102655705 CACAATTAGCTGTTTATTTAAGG - Intergenic
1058455818 9:105137349-105137371 AAACATAACCTGCTTATTTGAGG - Intergenic
1058505819 9:105665015-105665037 TACTATCACCTGGTAATTTGGGG - Intergenic
1059078146 9:111217275-111217297 TTCAAATACCTGGTAATTTGAGG + Intergenic
1060443564 9:123665870-123665892 CACAATTGCCTGCCTTTTTGAGG - Intronic
1060746254 9:126133794-126133816 TGTAATTATCTGCTTATTAGAGG - Intergenic
1185830665 X:3299810-3299832 TATAATTTCCTTCTTATCTGAGG + Intergenic
1187798138 X:23027197-23027219 TAAAATTACCTACTGATTTTAGG - Intergenic
1190952348 X:55158860-55158882 TACTATTCCCTGCTCATATGAGG + Intronic
1192466150 X:71357546-71357568 GAAAATTATCTGTTTATTTGAGG - Intergenic
1192616390 X:72627485-72627507 AACAATTACCTGATTTTATGTGG + Intronic
1195705595 X:107735927-107735949 TTCAATTCCCTGCTTTTTTGGGG + Intronic
1195919133 X:109965152-109965174 TACAAATAGCTGCTTAATTAGGG + Intergenic
1196558468 X:117119784-117119806 TACAATTACCTGGTAAATTCAGG + Intergenic
1196989705 X:121314726-121314748 TACAATTATCTACTTCTTTTGGG - Intergenic
1197863588 X:130995611-130995633 TACATGTACCTGTTTGTTTGGGG - Intergenic
1198007421 X:132510885-132510907 TACAAATAACTGCTTAATTAGGG - Intergenic
1198547465 X:137707911-137707933 TATACTTATCTGCTCATTTGTGG + Intergenic