ID: 1182253874

View in Genome Browser
Species Human (GRCh38)
Location 22:29023893-29023915
Sequence ACAATTACCTGCTTATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182253871_1182253874 4 Left 1182253871 22:29023866-29023888 CCTCTTGAGCCAATGTCGGCATA 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1182253867_1182253874 28 Left 1182253867 22:29023842-29023864 CCATGCCTGCCTGATAGCTGGGT 0: 1
1: 0
2: 2
3: 22
4: 254
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1182253863_1182253874 30 Left 1182253863 22:29023840-29023862 CCCCATGCCTGCCTGATAGCTGG 0: 1
1: 0
2: 0
3: 72
4: 251
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1182253868_1182253874 23 Left 1182253868 22:29023847-29023869 CCTGCCTGATAGCTGGGTGCCTC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1182253869_1182253874 19 Left 1182253869 22:29023851-29023873 CCTGATAGCTGGGTGCCTCTTGA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1182253872_1182253874 -5 Left 1182253872 22:29023875-29023897 CCAATGTCGGCATATTCTACAAT 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1182253865_1182253874 29 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182253874 Original CRISPR ACAATTACCTGCTTATTTGT GGG Intronic
900878526 1:5363867-5363889 ACCAATTCCTGCTTATTTGGGGG + Intergenic
901411770 1:9089210-9089232 ACAATTACCTGTCTCCTTGTGGG + Intergenic
903618159 1:24677478-24677500 ACCATGACCTGCTAATTTTTAGG - Intergenic
904505562 1:30950125-30950147 ACAATTACCTGCTGGTCTGAAGG + Exonic
905072786 1:35242164-35242186 TCAAATAGCTGCTTATTTGAAGG + Intergenic
906804730 1:48769646-48769668 ACAGTGACTTGCTTAGTTGTGGG - Intronic
907085632 1:51670809-51670831 GGAATTACCTGCTGATTTATAGG - Intronic
907606608 1:55824170-55824192 ACACTTACTTGCTTATTTTTTGG + Intergenic
907716089 1:56927531-56927553 ATAATTATATTCTTATTTGTGGG - Intergenic
908880459 1:68725764-68725786 ACAATAATATGTTTATTTGTGGG - Intergenic
909408687 1:75322840-75322862 ACAATTACCTGGTGACTTGGTGG - Intronic
914391427 1:147226404-147226426 AAAATTACCTGTTTATGTTTTGG - Intronic
914439805 1:147694829-147694851 ACAATTACCTTCTATCTTGTTGG + Intergenic
915909822 1:159907710-159907732 AGAATCAACTGCTTGTTTGTTGG + Intergenic
917659337 1:177162800-177162822 ACAATTACTGGGTTATTTGGAGG - Intronic
920755396 1:208725966-208725988 AAAATTATCTGCTGATTTGGTGG + Intergenic
922122879 1:222690993-222691015 ACAGTTACATTCTTACTTGTTGG - Intronic
922690449 1:227684986-227685008 ACAACTACCTGCCTACTGGTCGG - Intergenic
924769845 1:247069758-247069780 ACAAGTTCTTACTTATTTGTGGG + Intronic
1063240427 10:4163759-4163781 ATCATTACCTGCTTTTTTGGTGG + Intergenic
1063784310 10:9363311-9363333 ACAATTAGCTTCCTAATTGTAGG + Intergenic
1068815043 10:61300113-61300135 ACAAGTAACTGTTTCTTTGTTGG + Intergenic
1072510932 10:96124084-96124106 ACAATAACTTGGTTTTTTGTTGG - Intergenic
1077659901 11:4058494-4058516 AGAATTAAGTGCTTACTTGTGGG + Intronic
1078477296 11:11641898-11641920 ACAAATAGGTGCTTAATTGTTGG + Intergenic
1078960754 11:16266179-16266201 ACAATAACCTGCCTTTTTGGGGG - Intronic
1078970569 11:16405988-16406010 TCAATTACTTGCCTACTTGTAGG + Intronic
1080669272 11:34361342-34361364 AGCATTACCTGCTTGTTTGTTGG + Intergenic
1080758096 11:35221499-35221521 AGAATTACCTGCCTATTGGCTGG + Intronic
1081825013 11:46041532-46041554 AAAATAACCTGCTTCTTTCTGGG + Intronic
1083129743 11:60614073-60614095 AAATTTACCTATTTATTTGTGGG + Intergenic
1083707943 11:64529649-64529671 GCAAATACCTGCGTATTTGGGGG - Intergenic
1084343965 11:68530918-68530940 ACAGTTGACTGCTTGTTTGTGGG + Intronic
1087025609 11:93646506-93646528 AAAATTACCTTGTAATTTGTTGG + Intergenic
1087443406 11:98215215-98215237 ACAATTTCCTTCTTCTTTATGGG + Intergenic
1088075235 11:105840341-105840363 AATATTACCTGCTTTATTGTGGG - Intronic
1089628014 11:119763684-119763706 ACAATTAACTGCTTATGGTTTGG + Intergenic
1089856716 11:121551860-121551882 AATATTATCTGCTCATTTGTTGG - Intronic
1090163668 11:124522978-124523000 ACATTTTCCTGCTTCTTGGTTGG - Intergenic
1091570585 12:1682083-1682105 ACAATTACCTACATATCTATTGG - Intergenic
1093551939 12:20422879-20422901 ACACTTACATGTTTATTTGGAGG + Intronic
1096559662 12:52426500-52426522 AGAATTCCCTGCCTTTTTGTTGG - Intronic
1098600248 12:72323158-72323180 ATTATTACCTTCTTAATTGTAGG - Intronic
1098721637 12:73907053-73907075 TCATTTACCTGCTTATGTCTTGG + Intergenic
1098968618 12:76823478-76823500 GCAATTAACTTCTTTTTTGTGGG - Intronic
1099419306 12:82435192-82435214 ACAATTACATGGATATTTGGGGG - Intronic
1099638953 12:85259149-85259171 ACAATCTGCTGCTTATTTGCAGG - Intronic
1102658551 12:114504524-114504546 ACAATTCTCTACATATTTGTGGG - Intergenic
1106524135 13:30524965-30524987 ACAAATACATTCTTATTTGTAGG + Intronic
1108240986 13:48464080-48464102 ACAAATACCTGCTTATTACAGGG - Intronic
1108927178 13:55767340-55767362 ATAATTATCTGCTTATCTCTGGG - Intergenic
1108986025 13:56589013-56589035 ACAATTATGTGCATATATGTTGG - Intergenic
1109204019 13:59461904-59461926 ACAATTACCTGATATTTTTTTGG - Intergenic
1109785534 13:67170034-67170056 ACAGATACCTGCTTATTTGCAGG + Intronic
1110927979 13:81179937-81179959 GTAAATACATGCTTATTTGTAGG - Intergenic
1111853980 13:93612861-93612883 ACATTTAACAGCTTATTTTTAGG + Intronic
1114268581 14:21087802-21087824 ACAATTTCCTGCCTCTTGGTAGG + Intronic
1115132352 14:30068698-30068720 CTAATTACCTGTTTATTTATAGG - Intronic
1117683469 14:58228941-58228963 ACAACTGCCTGTTTATCTGTAGG - Intronic
1119113125 14:71994357-71994379 ATCATAACCTTCTTATTTGTAGG + Intronic
1120558469 14:85959771-85959793 TTAATTACCTACTTATTTGAAGG + Intergenic
1120797123 14:88646562-88646584 AAAATTACCTGTTTATTGTTTGG - Intronic
1121068941 14:90998752-90998774 ACAATAACATGCTTAGTTGATGG + Intronic
1121131013 14:91447492-91447514 ACATATTCTTGCTTATTTGTGGG + Intergenic
1124913289 15:33944390-33944412 TTAATTACCTGCTAAATTGTAGG + Intronic
1127698744 15:61476403-61476425 ACAATTACATGATGATTTCTGGG + Intergenic
1130242168 15:82204504-82204526 ACAATCACTTGCTTTTCTGTTGG + Intronic
1130458207 15:84136319-84136341 ACAATCACTTGCTTTTCTGTTGG - Intergenic
1133546093 16:6808742-6808764 ACAAATACCTGGTTATCTCTGGG + Intronic
1137418290 16:48306373-48306395 ACAATTCCTTGAGTATTTGTGGG - Intronic
1138068743 16:53969435-53969457 AAAATTACTTGCTTATTTTTTGG + Intronic
1140018907 16:71217677-71217699 GCAAATAACTGCTTACTTGTGGG + Intronic
1141010642 16:80395171-80395193 ACAATTACCTATTAATTTGGAGG - Intergenic
1142431540 16:90031168-90031190 ACATTTAGCTGTTTATTTTTAGG + Intronic
1143734836 17:8904373-8904395 ACAATTACCTACTTGTTCCTGGG + Intronic
1144154336 17:12484262-12484284 ACAATTACATGTTTATTTCTAGG - Intergenic
1147386923 17:40088497-40088519 ACAGGTACCTGCTGATTAGTCGG + Exonic
1153169553 18:2300242-2300264 ACTCTTATCTGCTTATTTGTGGG - Intergenic
1154481241 18:14827529-14827551 AGAATTCATTGCTTATTTGTTGG + Intronic
1154939773 18:21100058-21100080 ACATTTACATGCTTTTTGGTTGG - Intronic
1156845683 18:41663075-41663097 GCAATTACCTGATTATTAGGGGG - Intergenic
1157439047 18:47696387-47696409 ACAATCACCTCCTGATCTGTTGG + Intergenic
1158537235 18:58319225-58319247 CCAATGACCTGCTTATTGCTGGG - Intronic
1165561666 19:36685789-36685811 ACAATTAGCTTATTATTTGGGGG + Intergenic
926987916 2:18644286-18644308 ACAATTACCTGTTTACTCCTGGG - Intergenic
929831390 2:45349600-45349622 AAAAACACCTGCTTATTTATGGG + Intergenic
930094111 2:47553544-47553566 ACAATTATCTGGTTGTTTGAAGG + Intronic
931578037 2:63740843-63740865 ACAATTAACTGCTCATGTGTTGG - Intronic
931612398 2:64116193-64116215 AGAATTAAGTGATTATTTGTGGG - Intronic
932171108 2:69557246-69557268 CCATTTATCTGTTTATTTGTAGG - Intronic
933267937 2:80202330-80202352 ACAATTTTCTGTTTATGTGTCGG - Intronic
933400126 2:81785462-81785484 ACACTTAACTACTTATTTATGGG - Intergenic
935957574 2:108393115-108393137 ACATCTTCTTGCTTATTTGTAGG - Intergenic
936277216 2:111110098-111110120 ACATTTTCCTGCTTCTTTGCAGG + Intronic
937472101 2:122183000-122183022 ACAATTACCAGCTTGTTTAGGGG + Intergenic
937472240 2:122184063-122184085 ACAATTGCCAGCTTGTTTGGGGG + Intergenic
938687344 2:133752345-133752367 ACAGTTCCCTGCATGTTTGTTGG - Intergenic
939453995 2:142409779-142409801 ACAATTATCTCCTGATCTGTTGG - Intergenic
940884076 2:158973651-158973673 ACAATAACCCTCTTCTTTGTGGG - Intronic
941341689 2:164313622-164313644 GCAATTTCCTGTTTACTTGTGGG + Intergenic
942605305 2:177684244-177684266 GGAATTACCTATTTATTTGTTGG - Intronic
942917959 2:181335266-181335288 ACAATTACCTGATGATTTCCGGG - Intergenic
942975227 2:182008861-182008883 ACATGTTCCCGCTTATTTGTGGG - Intronic
944559703 2:200923750-200923772 ACATTTTTCTGCTTTTTTGTTGG - Intronic
945322627 2:208443023-208443045 ACATTTACATACTTATTTTTTGG + Intronic
948773550 2:240266887-240266909 AAAATTCCATGCTTATGTGTAGG - Intergenic
1170924503 20:20711398-20711420 ACACTTACCTGTGTATTTGGTGG - Intronic
1171394243 20:24821157-24821179 ACACTTCCCTGCTCATTTGTTGG - Intergenic
1173207215 20:41004533-41004555 GCAATTACTTGCTGATTGGTTGG + Intergenic
1173540127 20:43844736-43844758 AAAATTATCTGCTAATTTATGGG + Intergenic
1177193780 21:17880961-17880983 ACAATTATCTGCTGATCTGAAGG - Intergenic
1177512852 21:22112760-22112782 ACATTTTCCTGCTTATAAGTCGG - Intergenic
1178205716 21:30462632-30462654 GCAATCACCTGCGTATTTGGGGG - Intergenic
1180221522 21:46361940-46361962 ACGTTTTCCTGCTTATTTATGGG + Intronic
1182253874 22:29023893-29023915 ACAATTACCTGCTTATTTGTGGG + Intronic
1183006341 22:34905772-34905794 AGAATTGATTGCTTATTTGTTGG + Intergenic
949576656 3:5345203-5345225 ACAGTTACCTCCTGATCTGTTGG - Intergenic
949950427 3:9224556-9224578 ACAAATACCTTCATATCTGTGGG + Intronic
951110614 3:18799367-18799389 ACTATCACCAGCTTCTTTGTGGG + Intergenic
951266673 3:20576007-20576029 TCACTTACCTGATTATTTGCTGG - Intergenic
951674670 3:25224198-25224220 TAAATTAACTGCTTGTTTGTTGG - Intronic
954909781 3:54094529-54094551 ACAATTACCTCCTAAATGGTGGG - Intergenic
955168731 3:56541830-56541852 ATAATTTCCTGCTTCTTTGTAGG + Intergenic
956863030 3:73342927-73342949 ACACTTACCTGGCTATTTCTTGG + Intergenic
958178149 3:90023056-90023078 TCAATTACATGGTTATTTATTGG - Intergenic
959057207 3:101579481-101579503 ACAATAATCTGGTTATTTGTGGG - Intronic
959847879 3:111055408-111055430 TCAATTACCTTCTAATGTGTTGG - Intergenic
961216510 3:125164468-125164490 GCAAACACCTGCTTAGTTGTGGG - Intronic
962200513 3:133397489-133397511 ACATTTAGTTGCTTCTTTGTGGG - Exonic
963204871 3:142622880-142622902 ACAATTTCCTAATTATTTCTGGG + Intronic
963364527 3:144318089-144318111 ACTACTGCCTGGTTATTTGTAGG - Intergenic
963988904 3:151630313-151630335 ACAATTAGATGCTCATTTGTTGG - Intergenic
964086079 3:152820148-152820170 ACACTTACCTGTCTATTTATGGG + Intergenic
965552475 3:169981940-169981962 AAAAGGACCTGCTTATTTGGGGG + Intronic
968415846 4:433023-433045 ACAAATACCTTCTGATTTTTGGG + Intronic
970143785 4:13011692-13011714 ACAAATACCATTTTATTTGTTGG + Intergenic
970418251 4:15880587-15880609 AGAATTAACTGCATGTTTGTAGG - Intergenic
971071631 4:23100312-23100334 TCAATTAACTGCGTATTTGTAGG + Intergenic
971724019 4:30284810-30284832 ACAATCAACTGATGATTTGTAGG + Intergenic
975630263 4:76394394-76394416 ACATGTTCTTGCTTATTTGTGGG + Intronic
976377333 4:84360602-84360624 ACAAATACATTCTTATTTGTAGG + Intergenic
977971077 4:103215192-103215214 ACAAGTTCTTACTTATTTGTGGG + Intergenic
980754572 4:137140847-137140869 CCAATTTCATGCATATTTGTTGG + Intergenic
981230399 4:142347366-142347388 CCAATTACCTGATTATTATTTGG + Intronic
981612527 4:146610198-146610220 ACAAATACCTATATATTTGTAGG - Intergenic
986618498 5:9645080-9645102 GGAATTATCTGTTTATTTGTTGG + Intronic
989434455 5:41394812-41394834 AATATTACCTGCTTATATCTAGG - Intronic
992234763 5:74697968-74697990 ACCATCACCTGCCAATTTGTAGG + Intronic
992283256 5:75204312-75204334 CAGATTACCTGCTTTTTTGTTGG + Intronic
994479295 5:100312817-100312839 ACAATTAAGTGCTTAATTTTTGG - Intergenic
994934061 5:106229482-106229504 ATAAATATCTCCTTATTTGTGGG - Intergenic
995233815 5:109801949-109801971 AACATTTCCTGTTTATTTGTAGG + Intronic
995547723 5:113249615-113249637 AGATTTACCTGCTTATTTTTGGG - Intronic
995885223 5:116887029-116887051 AAAATTACATGCTTATTATTGGG + Intergenic
995932920 5:117471703-117471725 ACAATTAACTGGTTAATTGGAGG + Intergenic
997050158 5:130370929-130370951 ACAACCGCCTGCTTTTTTGTGGG - Intergenic
998537169 5:142944465-142944487 ACAATTTGGTGCTTTTTTGTGGG - Intronic
999134880 5:149311960-149311982 ACAGCTACCTGCATATGTGTGGG - Intronic
999629709 5:153558182-153558204 ACAATGACCTGCTTATATGACGG - Intronic
999629857 5:153559753-153559775 ACAATGACCTGCTTATATGATGG - Intronic
1000237161 5:159372616-159372638 ACAACTACCTGCCTACTGGTTGG - Intergenic
1000714307 5:164621865-164621887 ACAATTGTCTCCTTATCTGTTGG + Intergenic
1000807446 5:165813462-165813484 TCAATTACCAGATAATTTGTAGG - Intergenic
1001759575 5:174196086-174196108 ACTATTACCAGTTTATTTGTGGG + Intronic
1002692204 5:181058364-181058386 TCAGTTACCTGCATATTTTTGGG - Exonic
1004846101 6:19644171-19644193 GCAATTACATGCAAATTTGTCGG + Intergenic
1005789109 6:29277955-29277977 AACATTACCTGCTCATGTGTAGG + Intergenic
1007151916 6:39702018-39702040 ACAATTACCTTCCTTCTTGTTGG - Intronic
1007975944 6:46101322-46101344 TTAATTACCTGCTTAGTTATAGG - Intergenic
1008641502 6:53467272-53467294 ACATGTTCTTGCTTATTTGTGGG - Intergenic
1010662260 6:78584900-78584922 ACAATTCCCTACTTGTTTGGAGG + Intergenic
1010762097 6:79735075-79735097 ACCATTACATACGTATTTGTGGG + Intergenic
1012056084 6:94412350-94412372 ACAATTACTTGGTAATTTTTTGG + Intergenic
1013786762 6:113789830-113789852 ACAACTACTTGCTTGTTGGTGGG - Intergenic
1014172741 6:118296764-118296786 ACAACTAGCTGCTTTTTTCTTGG - Intronic
1015174468 6:130291717-130291739 AGAATTACCTGATTAACTGTGGG + Intronic
1015439021 6:133225827-133225849 ACAATTAAATGCTTATTCATTGG + Intergenic
1016065143 6:139674426-139674448 ACATGTTCCCGCTTATTTGTGGG + Intergenic
1017624999 6:156339106-156339128 ACAAGTATCTGCCTATTAGTTGG + Intergenic
1020606853 7:10349305-10349327 ATAATTCTCTGCTTATTTCTTGG + Intergenic
1022791515 7:33693743-33693765 AGAATTACTTTCTTATTTGATGG - Intergenic
1023070028 7:36420640-36420662 ACAATCACCTGCTTTATTGATGG - Exonic
1024063882 7:45717391-45717413 ACAACTTCCTTTTTATTTGTGGG + Exonic
1024352501 7:48381197-48381219 ACAGTTATCTCCTGATTTGTTGG + Intronic
1024853854 7:53754148-53754170 ACTATTACTTGATAATTTGTAGG + Intergenic
1027843180 7:83340125-83340147 ATAATTACCTGCTTAGTAGACGG + Intergenic
1029001729 7:97161364-97161386 ACAATTAGCTGCTGTTTGGTTGG + Intronic
1031409866 7:121428666-121428688 ACAAATAACTGTTTACTTGTTGG - Intergenic
1031653968 7:124328419-124328441 ACATTCACCTGCTTTATTGTTGG - Intergenic
1031878914 7:127174008-127174030 TCAGTTATCTGCTTAATTGTCGG - Intronic
1032587951 7:133164906-133164928 TTAATTATCTGCTTAATTGTAGG - Intergenic
1033056019 7:138055257-138055279 ACAATTGCATGGTTATTTATTGG - Intronic
1033418256 7:141183451-141183473 ATAAGTAACTGCTTTTTTGTAGG - Intronic
1034867237 7:154652133-154652155 ATAATTACCAGCTGATGTGTTGG - Intronic
1038075926 8:24073935-24073957 ACAATGACCTGCTTTTTCCTTGG + Intergenic
1038090020 8:24242073-24242095 ACAATTACCTGCCCACTGGTTGG - Intergenic
1039100170 8:33932757-33932779 ACATGTTCTTGCTTATTTGTGGG - Intergenic
1046256647 8:111706870-111706892 AATATTACCTGCTTAAATGTTGG - Intergenic
1047569037 8:126077612-126077634 TCAATTAACTTCTAATTTGTTGG + Intergenic
1047965671 8:130044784-130044806 ACATTTACCAGCTTATCTGTGGG + Intergenic
1048183091 8:132214270-132214292 ACATTTACCTGCTTGTTTTCAGG - Intronic
1048236240 8:132693602-132693624 GAAATTACCTGTTTATTAGTTGG - Intronic
1051035447 9:12739241-12739263 ACAATTACTTGATTACTTGTGGG + Intergenic
1051802404 9:20950974-20950996 ACTGTTACCTTTTTATTTGTAGG + Exonic
1055098206 9:72436277-72436299 ACTATTTCTTGATTATTTGTGGG + Intergenic
1055882752 9:81021370-81021392 AATATTAATTGCTTATTTGTTGG - Intergenic
1059042026 9:110825445-110825467 ACATATTCTTGCTTATTTGTGGG + Intergenic
1059718031 9:116931719-116931741 ACATTTACTTGCTTACTCGTTGG - Intronic
1060473112 9:123965136-123965158 ACACTTGCCTGCTTCTTTGTTGG + Intergenic
1061136858 9:128739654-128739676 ACTAATACCTACTGATTTGTGGG - Intronic
1062679918 9:137773848-137773870 TCAATTATTTGCTTATTTTTGGG + Intronic
1187928247 X:24270175-24270197 ACAATTACATTCTTAGGTGTGGG + Intergenic
1189947469 X:46194023-46194045 GCAATTACCAGTTTATTTCTTGG + Intergenic
1198367203 X:135953410-135953432 ATAATTATCTGCCTATTGGTTGG - Intergenic
1199845458 X:151689760-151689782 ATAAGTACGTGCTTATGTGTAGG + Intergenic