ID: 1182253875

View in Genome Browser
Species Human (GRCh38)
Location 22:29023894-29023916
Sequence CAATTACCTGCTTATTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182253865_1182253875 30 Left 1182253865 22:29023841-29023863 CCCATGCCTGCCTGATAGCTGGG 0: 1
1: 0
2: 2
3: 98
4: 2023
Right 1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 189
1182253872_1182253875 -4 Left 1182253872 22:29023875-29023897 CCAATGTCGGCATATTCTACAAT 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 189
1182253871_1182253875 5 Left 1182253871 22:29023866-29023888 CCTCTTGAGCCAATGTCGGCATA 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 189
1182253868_1182253875 24 Left 1182253868 22:29023847-29023869 CCTGCCTGATAGCTGGGTGCCTC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 189
1182253867_1182253875 29 Left 1182253867 22:29023842-29023864 CCATGCCTGCCTGATAGCTGGGT 0: 1
1: 0
2: 2
3: 22
4: 254
Right 1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 189
1182253869_1182253875 20 Left 1182253869 22:29023851-29023873 CCTGATAGCTGGGTGCCTCTTGA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182253875 Original CRISPR CAATTACCTGCTTATTTGTG GGG Intronic
907353748 1:53855051-53855073 CAATTTCCTGTTTATTTTTCAGG - Intronic
908880458 1:68725763-68725785 CAATAATATGTTTATTTGTGGGG - Intergenic
912006612 1:104910899-104910921 CAATTACTTGCTTATTTTGGTGG + Intergenic
919863795 1:201763214-201763236 CAATTACCTGTTTATACTTGGGG + Intronic
920367696 1:205456705-205456727 CAAATGCCTGCATATGTGTGCGG - Intergenic
1064972320 10:21078617-21078639 CTATGACCTGCTCATTTGAGTGG + Intronic
1071223675 10:83500137-83500159 CAAATACCTGTTTTTTTGTATGG + Intergenic
1073010795 10:100357911-100357933 CAATGACCTGCCTAAATGTGTGG - Intronic
1074684425 10:115947274-115947296 AAAGTATCTGCATATTTGTGTGG - Exonic
1076132556 10:128023652-128023674 CAGTTCCCCGCTTATCTGTGCGG - Intronic
1078268834 11:9775744-9775766 CATTTACCAGCTTATTTCTAAGG - Intergenic
1081474425 11:43411912-43411934 CAATTACCTGCTTTTGACTGGGG - Intronic
1081825014 11:46041533-46041555 AAATAACCTGCTTCTTTCTGGGG + Intronic
1085227120 11:74931965-74931987 CATTTTCCTGATTATTTATGAGG + Intronic
1086377707 11:86217969-86217991 CACATAGCTGCATATTTGTGAGG - Intergenic
1086855323 11:91859060-91859082 CAATGTCCTGCCTATTGGTGTGG - Intergenic
1088633912 11:111800684-111800706 TAATTACCTATTGATTTGTGTGG + Intronic
1090677336 11:129011901-129011923 CATGTACATGCATATTTGTGTGG - Intronic
1093157701 12:15707508-15707530 CAAGTACTTGCTTATCTGTAAGG + Intronic
1093289595 12:17303741-17303763 CAATTCCCTGCCTATTGGTCAGG - Intergenic
1093712369 12:22341678-22341700 CCATTATCTGCTTACTTGTATGG - Intronic
1096399400 12:51292659-51292681 GAATTACCTACTTATTTATTTGG + Intronic
1096471271 12:51878039-51878061 CCTTTTCCTGCCTATTTGTGAGG + Intergenic
1098423573 12:70332416-70332438 CACTAACCTGCATATTTTTGAGG + Intronic
1101228599 12:102715479-102715501 CAATTAACTGATAATTAGTGAGG + Intergenic
1101690913 12:107080138-107080160 CAATTACTTGCTAATTTCTGTGG - Intronic
1103217265 12:119211620-119211642 CTATTCCCTGCTTTCTTGTGAGG - Intronic
1104099747 12:125595844-125595866 CAATTTCATGCTTATTTCTCAGG + Intronic
1105237377 13:18570813-18570835 CAAATAACTGCATATATGTGTGG + Intergenic
1107700262 13:43040376-43040398 GACTTACCTGTTTATCTGTGGGG + Intronic
1108539976 13:51432543-51432565 CCAGTACCTGCTTAGTGGTGTGG - Intronic
1108927177 13:55767339-55767361 TAATTATCTGCTTATCTCTGGGG - Intergenic
1110060285 13:71031618-71031640 AAATTGCTTTCTTATTTGTGTGG + Intergenic
1110109316 13:71723505-71723527 CAGGTACCTATTTATTTGTGCGG - Intronic
1110720838 13:78759620-78759642 GAAATACATGATTATTTGTGGGG + Intergenic
1110794761 13:79623354-79623376 CTATTACCTTCTTACTTATGAGG - Intergenic
1111486854 13:88913382-88913404 CATTTATCTGCTTATTAGTGAGG + Intergenic
1113578406 13:111411065-111411087 CAATAACCTGCTCTTTTGTGTGG + Intergenic
1114003162 14:18283223-18283245 CAATTACCATCTTTTTTGAGTGG + Intergenic
1115727709 14:36235181-36235203 CAGTTACCTATTTGTTTGTGTGG - Intergenic
1119117513 14:72039282-72039304 CAACTACCAGCTTATCTTTGCGG - Intronic
1119270646 14:73301434-73301456 CAATTATATGCTTGTTTGTTTGG + Intronic
1121222071 14:92293394-92293416 CAATGGCCTGCTTTTTGGTGAGG + Intergenic
1121938227 14:98041124-98041146 CAATTTCCTGGTTATCTTTGGGG - Intergenic
1122641794 14:103164319-103164341 AAATTTCCTGCTCATTTATGGGG + Intergenic
1123388273 15:19841508-19841530 CAATTACCATCTTTTTTGAGTGG + Intergenic
1126115740 15:45206008-45206030 CAATGACCTTTTTATTTTTGAGG + Intergenic
1126501011 15:49345110-49345132 CATTTCCATGATTATTTGTGAGG + Intronic
1127292781 15:57585192-57585214 GAATTCCCTGCCTATGTGTGAGG + Intergenic
1130817240 15:87449940-87449962 GAATTTCCTGCTAATTTGGGGGG + Intergenic
1137413249 16:48247307-48247329 CAGTTACCTGCTTTTCTGTATGG + Intronic
1138068744 16:53969436-53969458 AAATTACTTGCTTATTTTTTGGG + Intronic
1139917072 16:70435135-70435157 AAATTTCCTGCTTGGTTGTGGGG + Intronic
1143734837 17:8904374-8904396 CAATTACCTACTTGTTCCTGGGG + Intronic
1144154335 17:12484261-12484283 CAATTACATGTTTATTTCTAGGG - Intergenic
1146138906 17:30347714-30347736 TGATTGCCTGCTTATTAGTGGGG + Intergenic
1148908823 17:50928903-50928925 TAATTATCTGCTTATGTGTCTGG + Intergenic
1151627809 17:75288546-75288568 CAACTACCTGTTGATGTGTGTGG - Intronic
1152981896 18:285945-285967 CATTTCCCTGATTACTTGTGAGG - Intergenic
1153138400 18:1943541-1943563 CATTTTCCTGATGATTTGTGAGG + Intergenic
1154533969 18:15378623-15378645 CAATTACCATCTTTTTTGAGTGG - Intergenic
1156862919 18:41859121-41859143 CAAATATATACTTATTTGTGGGG + Intergenic
1158531030 18:58261795-58261817 TAATTACCTGCATATTACTGTGG + Intronic
1159039292 18:63308245-63308267 CAATTGGCTGCTTATTTTTATGG + Intronic
1160382803 18:78473730-78473752 GAACTTCCTGCTCATTTGTGTGG + Intergenic
1162661680 19:12174204-12174226 CAATTACTTGCTTTTTGATGTGG + Intronic
1163068582 19:14818500-14818522 CAATTACTTCCTTACTTGTGAGG + Intronic
1165561667 19:36685790-36685812 CAATTAGCTTATTATTTGGGGGG + Intergenic
1166034639 19:40158969-40158991 CAGTCACCTGTTTATGTGTGTGG - Intergenic
1167029362 19:46947138-46947160 CACTTACCATCTTTTTTGTGGGG + Intronic
925344899 2:3164704-3164726 CAATTAACTATATATTTGTGTGG - Intergenic
929657401 2:43747913-43747935 CACTTATCTGCATATTTCTGTGG - Intronic
931527305 2:63170755-63170777 CTTTTTCCTGCTTATTTTTGTGG + Intronic
931578036 2:63740842-63740864 CAATTAACTGCTCATGTGTTGGG - Intronic
931578802 2:63750983-63751005 CACTTTCCTGCTTGTTCGTGAGG - Intronic
932808231 2:74801155-74801177 GAATTACATGCTCATTTGTGTGG - Intergenic
933140716 2:78789666-78789688 CAAATAACTGCATATTTGTGTGG - Intergenic
935015535 2:99178629-99178651 CAAATACCACCTTCTTTGTGAGG - Intronic
935044233 2:99465903-99465925 AAATTATCTGCTAATGTGTGTGG - Intronic
935946285 2:108289489-108289511 CAATTACTTGCTTATAAGTCTGG - Intronic
938532716 2:132205828-132205850 CAATTACCATCTTTTTTGAGTGG - Intronic
939450659 2:142369554-142369576 CAAATAACTGCATATTTCTGAGG + Intergenic
942508956 2:176675104-176675126 CAATAACCAGAATATTTGTGTGG - Intergenic
944306986 2:198189675-198189697 TAATTACCTGTTTATTTGGAAGG + Intronic
944726355 2:202474907-202474929 CAATAACCTGCTTGTTTATTTGG + Intronic
944888685 2:204093041-204093063 CAATTACATTCTTTTTTATGTGG + Intergenic
945207881 2:207351512-207351534 CAGTGACCTTCTTATTTCTGAGG + Intergenic
946570306 2:221017333-221017355 CAATTCCCTGCTGGGTTGTGGGG + Intergenic
946985964 2:225273701-225273723 CAAGGACCTTCTTATTTGTGTGG - Intergenic
947900637 2:233718707-233718729 CAATTACATGCTGATTTGCTAGG + Intronic
948538447 2:238666401-238666423 CAACTACATGCTTACCTGTGTGG + Intergenic
1170330141 20:15200375-15200397 CAATTACCTCATTTTTGGTGGGG + Intronic
1170676742 20:18489030-18489052 CAATTTTCTGATTTTTTGTGTGG - Exonic
1171848932 20:30294523-30294545 CATTTATCTCCTTCTTTGTGAGG + Intergenic
1171857494 20:30360784-30360806 CAATGGCCCGCTTATTCGTGGGG + Intergenic
1173207216 20:41004534-41004556 CAATTACTTGCTGATTGGTTGGG + Intergenic
1177692027 21:24522984-24523006 CAATTACCTGCTTTGTGGTCAGG - Intergenic
1177850069 21:26335123-26335145 CAATGACCGGCTAATTTTTGTGG + Intergenic
1178709611 21:34903794-34903816 CAATATCCTGCTTTCTTGTGGGG + Intronic
1178833350 21:36074866-36074888 CAAGTACCTGCTTACCTCTGAGG + Intronic
1180427677 22:15214024-15214046 CAATTACCATCTTTTTTGAGTGG + Intergenic
1180510930 22:16088423-16088445 CAATTACCATCTTTTTTGAGTGG + Intergenic
1180662112 22:17476822-17476844 AAAATACCTGCTTATTTTGGGGG + Intronic
1182004924 22:26951993-26952015 CAATTAAGTGCCTAATTGTGTGG - Intergenic
1182253875 22:29023894-29023916 CAATTACCTGCTTATTTGTGGGG + Intronic
1182815946 22:33163864-33163886 AAATTCCATGCTTAATTGTGTGG + Intronic
1184748426 22:46470264-46470286 CAAGTACCTGCTTATTTTCCTGG - Intronic
949834569 3:8254071-8254093 CAGTTTGCTTCTTATTTGTGGGG + Intergenic
951168754 3:19513212-19513234 CAATTTCCTGCTTGGTTTTGGGG - Exonic
951605361 3:24427544-24427566 CAATTTTCTGCTTATTTGTATGG - Intronic
951674669 3:25224197-25224219 AAATTAACTGCTTGTTTGTTGGG - Intronic
951722308 3:25713230-25713252 CATTTCCCTGTTTACTTGTGAGG - Intergenic
952623616 3:35376751-35376773 CAATTATTTGTGTATTTGTGTGG - Intergenic
952624198 3:35383996-35384018 CAACTACCTCCGCATTTGTGAGG - Intergenic
953094839 3:39765322-39765344 CTATTACCTTCTTATTTATCAGG - Intergenic
955134491 3:56202885-56202907 CAGTTACCTGCCTTTTTTTGTGG - Intronic
955168732 3:56541831-56541853 TAATTTCCTGCTTCTTTGTAGGG + Intergenic
958751591 3:98198078-98198100 CTATTACTTGCTTATTTCTCAGG - Intronic
959829157 3:110839724-110839746 CAAATATATGCTTATTTCTGAGG - Intergenic
959847878 3:111055407-111055429 CAATTACCTTCTAATGTGTTGGG - Intergenic
960254240 3:115494600-115494622 CAAATACCAGATTATTTGAGTGG - Intergenic
966244501 3:177791490-177791512 TAATTAAGTGCTAATTTGTGTGG - Intergenic
967869024 3:194214410-194214432 GGTTTACCTTCTTATTTGTGAGG - Intergenic
968415847 4:433024-433046 CAAATACCTTCTGATTTTTGGGG + Intronic
969473277 4:7402681-7402703 CTATTGCCAGCTTATCTGTGAGG + Intronic
970319824 4:14864026-14864048 CAATTCCCTGATTCCTTGTGAGG + Intergenic
974369147 4:60991670-60991692 CAATTACCTTCTTGTTTCAGAGG + Intergenic
976860345 4:89658162-89658184 CAATTAATTGCTTATTTCTATGG - Intergenic
976985197 4:91286268-91286290 CAAATAAATGCATATTTGTGTGG - Intronic
979630283 4:122893728-122893750 CAATTAAATGCAAATTTGTGTGG + Exonic
981220665 4:142229821-142229843 CATTTACCTGTATATTTTTGGGG + Intronic
981280458 4:142952621-142952643 GATTAACCTGCTTATTTGTATGG - Intergenic
982089761 4:151870266-151870288 CAGTTACTTGCTTTTTTGGGGGG + Intergenic
985440541 4:189980380-189980402 CAATTACCTGGTTCCATGTGGGG - Intergenic
992283257 5:75204313-75204335 AGATTACCTGCTTTTTTGTTGGG + Intronic
994924119 5:106091769-106091791 CATTTACTTGGTTATTTGTTTGG - Intergenic
995547722 5:113249614-113249636 GATTTACCTGCTTATTTTTGGGG - Intronic
998537168 5:142944464-142944486 CAATTTGGTGCTTTTTTGTGGGG - Intronic
999134879 5:149311959-149311981 CAGCTACCTGCATATGTGTGGGG - Intronic
999860759 5:155643219-155643241 CAAGTACCTGCTTCTTCCTGAGG + Intergenic
1000403274 5:160855890-160855912 AAATTAGTTGCATATTTGTGTGG + Intergenic
1001664007 5:173417423-173417445 CAATGACCTGCTTACATGTTTGG + Intergenic
1002630608 5:180573346-180573368 TAATTATCTACTCATTTGTGTGG - Intronic
1002774458 6:317164-317186 TATTTACCTGCTTATTGATGAGG + Intronic
1003626137 6:7743226-7743248 CAATAAACTACTTATTTGGGAGG - Intronic
1004846102 6:19644172-19644194 CAATTACATGCAAATTTGTCGGG + Intergenic
1008115028 6:47539421-47539443 CATATACTTGCTTATTTCTGTGG - Intronic
1008494835 6:52122555-52122577 CAATTTAGTACTTATTTGTGAGG + Intergenic
1009491257 6:64294975-64294997 CAACTAGCTGCTAATTTTTGTGG + Intronic
1010534253 6:77007477-77007499 CAATTACATTCTTTTGTGTGGGG - Intergenic
1010817115 6:80371223-80371245 CATTTACCTGATCATTAGTGAGG + Intergenic
1013786761 6:113789829-113789851 CAACTACTTGCTTGTTGGTGGGG - Intergenic
1014381394 6:120747357-120747379 CAATTAGCTGCTTTTTTAAGAGG - Intergenic
1015976261 6:138794518-138794540 CAATTAGGTGCTTATTTCTGTGG - Intergenic
1016053133 6:139551028-139551050 CAATTACTTGATTTTTTGGGGGG + Intergenic
1017665396 6:156715518-156715540 CACTTTCCTGATTATTTATGAGG - Intergenic
1018462831 6:164015400-164015422 CAATTAGGTGCTTTTTTGTTTGG + Intergenic
1020967272 7:14887098-14887120 TGATTTCCTGTTTATTTGTGTGG + Intronic
1021241398 7:18206603-18206625 CAATTACTTGATTATTCTTGTGG + Intronic
1023409451 7:39874865-39874887 CAATTTCCTTTTTATTTTTGTGG + Intergenic
1024747221 7:52421969-52421991 CAAACACCTGCTTCTTTATGAGG + Intergenic
1024882044 7:54098088-54098110 CATTCCCCTGCTGATTTGTGTGG - Intergenic
1025043479 7:55669157-55669179 CAATTTCCTTTTTATTTTTGTGG - Intergenic
1025136400 7:56417670-56417692 CAATTTCCTTTTTATTTTTGTGG - Intergenic
1025949130 7:66129573-66129595 CTACTACCTTCTTTTTTGTGGGG - Intronic
1031194525 7:118595722-118595744 CAAGTACCTGCTTGGCTGTGAGG + Intergenic
1032587950 7:133164905-133164927 TAATTATCTGCTTAATTGTAGGG - Intergenic
1036026886 8:4918744-4918766 CACATACCTGCATATATGTGTGG - Intronic
1037650000 8:20827554-20827576 CAATTACCTTTTCATTTGTCAGG - Intergenic
1039712837 8:40074281-40074303 CAATTTCTTGATTATTAGTGAGG - Intergenic
1047965672 8:130044785-130044807 CATTTACCAGCTTATCTGTGGGG + Intergenic
1048102486 8:131368801-131368823 TAATTACTTGCTTATTTCTATGG + Intergenic
1051035448 9:12739242-12739264 CAATTACTTGATTACTTGTGGGG + Intergenic
1052707709 9:32013141-32013163 CTATTTCCTACATATTTGTGAGG + Intergenic
1053685854 9:40521803-40521825 CAATTACCATCTTTTTTGAGTGG - Intergenic
1053786643 9:41657243-41657265 CATTTATCTCCTTCTTTGTGAGG + Intergenic
1053935805 9:43150097-43150119 CAATTACCATCTTTTTTGAGTGG - Intergenic
1054158417 9:61656952-61656974 CATTTATCTCCTTCTTTGTGAGG - Intergenic
1054277880 9:63103163-63103185 CAATTACCATCTTTTTTGAGTGG + Intergenic
1054298937 9:63357262-63357284 CAATTACCATCTTTTTTGAGTGG - Intergenic
1054396957 9:64661764-64661786 CAATTACCATCTTTTTTGAGTGG - Intergenic
1054431599 9:65166968-65166990 CAATTACCATCTTTTTTGAGTGG - Intergenic
1054450332 9:65400464-65400486 CATTTATCTCCTTCTTTGTGAGG + Intergenic
1054478190 9:65587957-65587979 CATTTATCTCCTTCTTTGTGAGG - Intergenic
1054498779 9:65854551-65854573 CAATTACCATCTTTTTTGAGTGG + Intergenic
1057129553 9:92643818-92643840 GAATTACATGCATATTTTTGTGG + Intronic
1058664677 9:107300744-107300766 CATTTTCCTGGTTATTAGTGAGG - Intronic
1061136857 9:128739653-128739675 CTAATACCTACTGATTTGTGGGG - Intronic
1062679919 9:137773849-137773871 CAATTATTTGCTTATTTTTGGGG + Intronic
1185639540 X:1579691-1579713 CAATTAATTGCTTGATTGTGAGG - Intergenic
1186371423 X:8951290-8951312 TAATTCCCTTCTTATTTGTGAGG - Intergenic
1186738177 X:12488553-12488575 CACATACCTGCATATTTATGGGG - Intronic
1188594639 X:31883904-31883926 CATTTCCCTGCTGATTAGTGAGG - Intronic
1190253010 X:48741786-48741808 CAATTTTGTGCTTACTTGTGAGG + Intergenic
1191639572 X:63415474-63415496 CAACTACCTGCCTACTTGTCAGG - Intergenic
1193032951 X:76919446-76919468 CAATTATCTGGTTATATGTCAGG - Intergenic
1194366686 X:93022116-93022138 CAATTTCCAAATTATTTGTGTGG - Intergenic
1194452553 X:94062390-94062412 CAATTACCTGATTATTAATAAGG - Intergenic
1196121443 X:112055150-112055172 AAACTACTTGCTCATTTGTGAGG - Intronic
1196211777 X:113003845-113003867 CAATTACCTACCTATTTCTTTGG + Intergenic
1197357631 X:125455914-125455936 CAGTTATCTGTTTATCTGTGTGG - Intergenic
1198687914 X:139247509-139247531 CAATTCCCTGCTCACTTGTGTGG - Intergenic
1200674910 Y:6138376-6138398 CAATTTCCAAATTATTTGTGTGG - Intergenic
1202218990 Y:22521945-22521967 AAATTCCCTGATTATTTATGAGG + Intergenic
1202324193 Y:23674107-23674129 AAATTCCCTGATTATTTATGAGG - Intergenic
1202546578 Y:25995947-25995969 AAATTCCCTGATTATTTATGAGG + Intergenic