ID: 1182255032

View in Genome Browser
Species Human (GRCh38)
Location 22:29031797-29031819
Sequence CTGTGGTCAGGGAGGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 677}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182255032_1182255046 9 Left 1182255032 22:29031797-29031819 CCTTTTCCCCTCCCTGACCACAG 0: 1
1: 0
2: 3
3: 60
4: 677
Right 1182255046 22:29031829-29031851 TGGTGGCGGCAACAGAAACAGGG 0: 1
1: 0
2: 3
3: 18
4: 178
1182255032_1182255041 -8 Left 1182255032 22:29031797-29031819 CCTTTTCCCCTCCCTGACCACAG 0: 1
1: 0
2: 3
3: 60
4: 677
Right 1182255041 22:29031812-29031834 GACCACAGGAGCAGGCCTGGTGG 0: 1
1: 0
2: 6
3: 49
4: 389
1182255032_1182255045 8 Left 1182255032 22:29031797-29031819 CCTTTTCCCCTCCCTGACCACAG 0: 1
1: 0
2: 3
3: 60
4: 677
Right 1182255045 22:29031828-29031850 CTGGTGGCGGCAACAGAAACAGG 0: 1
1: 0
2: 0
3: 9
4: 151
1182255032_1182255047 13 Left 1182255032 22:29031797-29031819 CCTTTTCCCCTCCCTGACCACAG 0: 1
1: 0
2: 3
3: 60
4: 677
Right 1182255047 22:29031833-29031855 GGCGGCAACAGAAACAGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 231
1182255032_1182255043 -5 Left 1182255032 22:29031797-29031819 CCTTTTCCCCTCCCTGACCACAG 0: 1
1: 0
2: 3
3: 60
4: 677
Right 1182255043 22:29031815-29031837 CACAGGAGCAGGCCTGGTGGCGG 0: 1
1: 1
2: 9
3: 63
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182255032 Original CRISPR CTGTGGTCAGGGAGGGGAAA AGG (reversed) Intronic
900380123 1:2379784-2379806 CTGTGGGCAGGAAGGTAAAAGGG + Intronic
900417852 1:2543268-2543290 CCGTGGTGAGGGAGGAGGAACGG + Intergenic
900736153 1:4300712-4300734 CTGTGGTCATGGAGCTGAAGTGG + Intergenic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900761554 1:4475291-4475313 CTCTGGTCTGGGAGGGGACTTGG - Intergenic
900954132 1:5876324-5876346 CAGTGGTCAGGGAGGAGGGAGGG - Intronic
901533531 1:9868075-9868097 CTGTGGACTGGGAGTGGAGAGGG - Intronic
901822472 1:11838825-11838847 CTGCTGGCAGGCAGGGGAAAGGG - Intronic
902169254 1:14597840-14597862 CTGTGGTCTGGGAGAGAAAGAGG + Intergenic
902361298 1:15943896-15943918 CTGTGCCCAGGGAGGGGTCAGGG + Intronic
903026861 1:20435584-20435606 CAGTGGTCAGGGAAGACAAAGGG - Intergenic
903639703 1:24849804-24849826 GAGGGGTCAGGGAGGGCAAAAGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904354076 1:29927088-29927110 CTGGGGGCAGGGAGGTGAAGAGG + Intergenic
905244331 1:36602315-36602337 CTGTGGTGGGGGTGGGGACAGGG - Intergenic
905282687 1:36859320-36859342 CTGTGGCAAGGGAGGAGAAGGGG - Intronic
905331144 1:37198894-37198916 CAGGGGTTAGGGAGGGGAAGAGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906012766 1:42544427-42544449 CAGTGGTCTGGGGGCGGAAATGG - Intronic
906109914 1:43315754-43315776 CTGTGGTGGGGGAGGGTAATGGG + Intronic
906153065 1:43598995-43599017 CTGAGGGCAGGCAGGGGAAGAGG - Intronic
906484209 1:46221976-46221998 CTGGGGACAGGGTGGGGGAAGGG - Intergenic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
907194990 1:52679276-52679298 CTGTGCTCAGGCAGTGGAGAAGG + Intergenic
907317729 1:53583241-53583263 CTGTGCTCAGGGAAGGCACAGGG - Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
910884303 1:91949599-91949621 ATGGGGTCGGGGAGGGGAGAGGG - Exonic
912860760 1:113211768-113211790 CAGAGGACAGGGAGGGGAGATGG + Intergenic
912876713 1:113367047-113367069 ACGTTTTCAGGGAGGGGAAAAGG + Intergenic
913196715 1:116462856-116462878 CTGTGGCCAGGGATGGGTCATGG - Intergenic
915464696 1:156089992-156090014 CTGCGGTGAGGGAGGGGGAGGGG + Intronic
915590225 1:156866471-156866493 TTGTGGTCAGGTAGGGGCAAGGG + Intronic
915712763 1:157917114-157917136 CTGCTGCCAGGGAGGGTAAATGG - Intergenic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916229083 1:162521458-162521480 GTGGGGTCAGGGAGGGGACAGGG + Intronic
916311018 1:163399037-163399059 CTGTGCTCTGGGAGGGGAAATGG - Intergenic
917249219 1:173038971-173038993 ATGTGGGCAGGGTGGAGAAAAGG + Intergenic
917734481 1:177907889-177907911 CTTAGAGCAGGGAGGGGAAATGG - Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918733082 1:188022889-188022911 CTGGGGTCAGGGAGGGAGAGTGG + Intergenic
918787459 1:188781026-188781048 CTGCTGACAGGGAGGGGAATGGG - Intergenic
920070091 1:203296531-203296553 GTGTGGTCAGGGAAGGGTGAAGG - Intergenic
920406833 1:205721104-205721126 CTGTGGCGAGGGAGGGGGCAGGG + Intronic
921056047 1:211543153-211543175 CTGTGGGCAGTGAGGGTGAATGG + Intergenic
921098851 1:211911149-211911171 AGGTGGTCAGGGAGGGGAGGAGG - Intergenic
921161055 1:212472410-212472432 CTGGGGCCAGGGTGTGGAAACGG - Intergenic
921260895 1:213384367-213384389 CTGTGGTCTGGGAGGTCAAGGGG + Intergenic
922738977 1:228005273-228005295 GTGGGGTCAGGGAGGGGGAGGGG - Intergenic
922748671 1:228060759-228060781 CTGTGGACAGGCGGAGGAAAGGG - Exonic
922807150 1:228396232-228396254 CTGACCTCAGGAAGGGGAAAGGG + Intronic
922869148 1:228886068-228886090 CTGCGGTCTGGGTGGTGAAAAGG + Intergenic
923259876 1:232258359-232258381 CTGTGGTGAGGGGAGGGAGAAGG + Intergenic
923279641 1:232430843-232430865 CTGTGGTATGGAAGGGCAAATGG - Intronic
924329747 1:242929599-242929621 GTGTGGGCAGGGTAGGGAAAGGG - Intergenic
924625735 1:245695328-245695350 ATGTGGTCAGGCTGAGGAAATGG - Intronic
1062768856 10:84330-84352 CTGTGGGCAGGAAGGGCCAAGGG + Intergenic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1065149381 10:22806583-22806605 CTTGGGCCAGGGCGGGGAAAGGG - Intergenic
1065504781 10:26418952-26418974 CTGTCGTGGGGGAGGGGGAAGGG - Intergenic
1066449053 10:35511465-35511487 GTGGAGTCAGGGAGGGGAAAAGG + Intronic
1066594835 10:37038898-37038920 CTGTTGTGGGGTAGGGGAAAGGG - Intergenic
1067077315 10:43195599-43195621 GTGGGGTCAGGGAGGGGCAGGGG - Exonic
1067563523 10:47320901-47320923 ATGTGCTCAGGGAGGAGCAAGGG - Intergenic
1067802627 10:49369585-49369607 CTGGGGCCGGGGAGGGGAAGTGG + Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069244613 10:66188371-66188393 CAGGGGTGAGGGTGGGGAAATGG - Intronic
1069620176 10:69832626-69832648 CTGTGGACAGGGCAGGGGAAGGG + Intronic
1070640658 10:78166540-78166562 CTGCCTTCAGGGATGGGAAATGG - Intergenic
1071164632 10:82791133-82791155 GTGGGGGCAGGAAGGGGAAAAGG - Intronic
1073047168 10:100646310-100646332 CTGAGTCCGGGGAGGGGAAAGGG - Intergenic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073442232 10:103559021-103559043 CTGTGGCCAGGAAAGGGAAATGG + Intronic
1073479443 10:103777315-103777337 CTGAGGTCAGGGAGGCGGCAGGG + Intronic
1074061224 10:109967615-109967637 GTGTGGCGGGGGAGGGGAAATGG + Intergenic
1074334835 10:112560953-112560975 AAGTGGTCTGGGATGGGAAATGG - Intronic
1074495423 10:113976103-113976125 CTGTGATCAGGCAGAAGAAAAGG + Intergenic
1075745194 10:124722529-124722551 CTGTCTTCAGGGAGCGGAAATGG + Intronic
1075787742 10:125061441-125061463 CTGTGGACAGGAAGGGGTACAGG + Intronic
1076309169 10:129491629-129491651 CTGTGGTCAAGAAAGGGGAAAGG - Intronic
1076726413 10:132416202-132416224 CTGTGGTCAGGCAGGGCCCATGG + Intronic
1076833242 10:133007405-133007427 CTGGGGGCTGGGAGGGGAACAGG - Intergenic
1077106551 11:844779-844801 CTGTGGTCAGGGCAGGGCACAGG + Intronic
1077133474 11:986762-986784 CTGTGTGGAGGGAGGGGAAGTGG - Intronic
1077287267 11:1773121-1773143 CACAGGTCAGGGAGGGGAAAGGG + Intergenic
1077484245 11:2831652-2831674 CAGTGGTGGGGAAGGGGAAAGGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077588488 11:3473046-3473068 GTGTGGTCAGGGTGAGGAACAGG + Intergenic
1078637314 11:13064230-13064252 CAGTGGTAGGGGAGTGGAAAGGG - Intergenic
1079306399 11:19327286-19327308 ATGTAGTCAGTGAGGGGAGAGGG - Intergenic
1080384047 11:31800019-31800041 CTCTGGTCTGGGAGGAGAGATGG - Intronic
1081338664 11:41900639-41900661 GTGTGGTGAGGAAGGAGAAATGG + Intergenic
1081861223 11:46334264-46334286 CTGTGGTTTGGGAGAGGAAGAGG - Intronic
1082257466 11:50047576-50047598 GTGTGGCCAGAGATGGGAAATGG - Intergenic
1082565813 11:54676804-54676826 GTGGGGGAAGGGAGGGGAAAGGG - Intergenic
1083006490 11:59351466-59351488 TGGTGGTCAGGTAGGGGAAAAGG + Intergenic
1083186786 11:61022278-61022300 CTGGGGGCAGGGCGGGGCAAGGG + Intergenic
1083257114 11:61503303-61503325 CTGGGGCCTGGGATGGGAAAGGG + Intergenic
1083714509 11:64567885-64567907 CTGGGGCCAGGGAGGGGATGTGG - Intronic
1083789916 11:64977812-64977834 CTGTGCTCAGGGAGGGTTGAAGG - Intergenic
1083904367 11:65660454-65660476 CTGTGTTTAGAGAGTGGAAAAGG - Intronic
1084266733 11:68008863-68008885 GTGTGGACAGGCAGGGGACAGGG - Intronic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085151077 11:74253351-74253373 CTCTGGTCAGGGCTGTGAAATGG + Intronic
1085261588 11:75208590-75208612 CTGTGGCCAGGGTAGGGCAAAGG - Intergenic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1085535563 11:77215251-77215273 CTTTGCTCAGGGAGGGGAAGTGG + Intergenic
1085668581 11:78439747-78439769 CTGTGCTCAGGAAGAGGAAGGGG - Intronic
1086124282 11:83333860-83333882 CTGTGTCCAGGGATGAGAAAGGG - Intergenic
1086668243 11:89512421-89512443 CTAGAGTGAGGGAGGGGAAATGG - Intergenic
1087795719 11:102453056-102453078 TTGCGGGCAGGGAGGGGACAGGG + Intronic
1088853295 11:113723333-113723355 CTGAGGGCAGGGAGGCTAAATGG + Intergenic
1088929868 11:114340792-114340814 CTCTGGTCTTGGAGCGGAAACGG + Intergenic
1089461459 11:118656584-118656606 CTAGGGGCTGGGAGGGGAAAGGG + Intronic
1090977466 11:131689714-131689736 CTGCGGTATGGGAGGGGAGATGG - Intronic
1091146204 11:133282552-133282574 CAGTGCAGAGGGAGGGGAAATGG + Intronic
1091229893 11:133981473-133981495 CTGTCCTCAGGGAGGGGACTGGG - Intergenic
1091403703 12:196262-196284 CTGTGGGCCAGGAGGGGAACTGG + Intronic
1091758317 12:3070705-3070727 ATGTGGTCAAGGAGGTGAAGTGG + Intergenic
1091822864 12:3489749-3489771 CTGTGTTCTGAGAAGGGAAAAGG + Intronic
1091847890 12:3671318-3671340 CTGGGGTCAGAGAGGAGAAAGGG + Intronic
1092218764 12:6699548-6699570 AAAAGGTCAGGGAGGGGAAACGG + Intronic
1092501539 12:9052332-9052354 CTATGCTGAGGGAGGAGAAAAGG - Intergenic
1092789064 12:12056172-12056194 TTGTGGTCAGGGAGAGAAACTGG - Intronic
1093356355 12:18173014-18173036 CTTGGGCAAGGGAGGGGAAAGGG - Intronic
1093377465 12:18448545-18448567 ATGTGGACAGGGAGAGGAAATGG - Intronic
1093827938 12:23717731-23717753 CTGTGGTCAAGGTGGAGAGAAGG + Intronic
1093846067 12:23972955-23972977 GAGTGGTAAGGGATGGGAAAAGG - Intergenic
1094315758 12:29136536-29136558 CTGTGATCAGGGTGAGGAACAGG + Intergenic
1094766117 12:33596553-33596575 CTGCGGTTGGGGAGGAGAAAGGG + Intergenic
1095778480 12:46034303-46034325 GTGTGATCAGGGTGAGGAAAAGG - Intergenic
1095948374 12:47766779-47766801 CAGTGGGCAGGCAGAGGAAATGG + Intronic
1096225911 12:49866952-49866974 GTGAGGTCAGGGAAGGGAACAGG + Exonic
1096520980 12:52184359-52184381 CTGTGGTCAGGTAGTGGGCAGGG - Intronic
1096650306 12:53059183-53059205 CTGTGGTCAGCGTGGAGGAATGG - Exonic
1096716221 12:53493072-53493094 GGGTGGTCCGGGTGGGGAAAGGG + Intronic
1097106638 12:56629933-56629955 CTGGGGTCTGGGAGGAGAACAGG - Intronic
1097275151 12:57808072-57808094 CTGAGGTGCCGGAGGGGAAAGGG + Intronic
1097737136 12:63194772-63194794 AAGTGGCCAGGGAGGGGAGATGG - Intergenic
1098839005 12:75456194-75456216 CTAGGGTGAGGGAGAGGAAAAGG + Intergenic
1098886977 12:75970134-75970156 CTGTGGTCTGGAAGGAGAGAAGG - Intergenic
1099288858 12:80749880-80749902 TTGAGGACAGGGTGGGGAAACGG + Intergenic
1099895889 12:88645923-88645945 CTGTGGTCATGGGGAGGCAATGG + Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1102003967 12:109576977-109576999 CTGGGGTCAGGGAAAGGAGAAGG - Intronic
1102191681 12:110993470-110993492 CTGGGGTGAGGGAGGGGTGAGGG - Intergenic
1102303147 12:111785369-111785391 CTTTGTTCTGGCAGGGGAAAAGG + Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102734305 12:115144563-115144585 CTGGGGTTAGGGAAGGGAATGGG + Intergenic
1102743644 12:115230703-115230725 CTCTGCTCAGGCAGGGCAAAAGG + Intergenic
1102889796 12:116549511-116549533 CATTGGTGAGGGAAGGGAAAGGG + Intergenic
1103507538 12:121452138-121452160 CCGGGCTGAGGGAGGGGAAAGGG + Intronic
1103560189 12:121789548-121789570 CGTTGGTCAGGGAGGGGTACTGG + Intronic
1103938611 12:124489806-124489828 CTGGGGGCAGAGAGGAGAAAGGG + Intronic
1104415717 12:128595473-128595495 CTGGGCCCAGGGAGGGGCAAGGG + Intronic
1104484673 12:129140412-129140434 CTGTGGTCAGGGATTGGGGAGGG - Intronic
1104611922 12:130235728-130235750 CTGAACTCAGGGAGAGGAAAAGG + Intergenic
1104624504 12:130340090-130340112 CCGTGGTCACGCCGGGGAAACGG + Intronic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105426539 13:20299497-20299519 CCGTAGTCAGGTAGGGGAACGGG + Intergenic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1106588185 13:31075198-31075220 ATGTGTCCAGGAAGGGGAAAGGG - Intergenic
1106782137 13:33069986-33070008 GCGTGGGCTGGGAGGGGAAAAGG - Intergenic
1107792773 13:44018678-44018700 CTGGGGCCCAGGAGGGGAAAGGG + Intergenic
1108166563 13:47699423-47699445 CTGTGGAAAGGGAGAGGAAGAGG - Intergenic
1108519201 13:51230745-51230767 CTGTGATCGGGAAAGGGAAAAGG - Intronic
1108631047 13:52282501-52282523 CTGTGGTGGGGTAGGGGAAGGGG + Intergenic
1108722348 13:53145289-53145311 TGGTGCTCAGGGAGAGGAAACGG - Intergenic
1109335931 13:60993736-60993758 CTGTGCACAGGAAGGGAAAAAGG - Intergenic
1109560888 13:64048842-64048864 CTGTGATCACAAAGGGGAAAGGG - Intergenic
1110037264 13:70703823-70703845 ACGTGGTCAGGGAGGGGGTACGG + Intergenic
1111682801 13:91464665-91464687 CTGGGGTTAGGGACGGGAAGAGG + Intronic
1111885042 13:94009742-94009764 CTGTGGGCAGAGAATGGAAATGG + Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1113074650 13:106455519-106455541 CTGTGGTCAGGGAAGGGTCCTGG - Intergenic
1113102069 13:106731981-106732003 CTGTAGTTTGGGAGAGGAAAGGG - Intergenic
1113375613 13:109762699-109762721 CTGGGGACAGGGAGGTGAGAAGG - Intronic
1113445326 13:110361837-110361859 CTCTGCCCAGGGAGGGGAAGTGG - Intronic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113999538 14:16400254-16400276 AGGGGCTCAGGGAGGGGAAATGG + Intergenic
1114454248 14:22845134-22845156 CTGTGGACAGGGTGGGGACAGGG - Intronic
1115126267 14:29998066-29998088 CAGTGGTCAGGGAGCGGGAATGG + Intronic
1115738251 14:36358674-36358696 GTGGGGTCAGGGAGGTGAGAGGG - Intergenic
1116153098 14:41167164-41167186 CAGGGGAAAGGGAGGGGAAAGGG - Intergenic
1116273818 14:42805396-42805418 CAGTGCCCAGGGAGAGGAAAGGG + Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116590498 14:46765314-46765336 CTGTTGTCGGGTGGGGGAAAGGG + Intergenic
1117487941 14:56217318-56217340 CTGTCTTCTGGGAGGGGAATGGG + Intronic
1117841812 14:59869406-59869428 CTGTTTCCAGGGAGAGGAAAGGG - Intronic
1119615492 14:76096195-76096217 CTCTGGCCAGGCAGAGGAAAGGG - Intergenic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121108165 14:91294129-91294151 CTGTGGTGAGGGTGCGGAGAGGG + Intronic
1121598002 14:95180557-95180579 CCTTGGACAGGGAGAGGAAAAGG + Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1121901981 14:97701599-97701621 CTGGGGTGAGGGTGGAGAAATGG + Intergenic
1121942058 14:98080408-98080430 CTGTGGTCAGGGATGGTGAGTGG + Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122422851 14:101588378-101588400 TTGTGGGGAGGGAGGGGGAAGGG - Intergenic
1122643736 14:103177647-103177669 CAGTAGGCAGGGTGGGGAAAGGG + Intergenic
1122882201 14:104695206-104695228 CTGTGGTTAGGGACTGGGAAGGG - Intronic
1122987110 14:105217543-105217565 CTGTGACCAGTGTGGGGAAAAGG - Exonic
1123869011 15:24552678-24552700 CTGTAGTCATAGATGGGAAATGG + Intergenic
1124474984 15:30025558-30025580 TTGTGGGTAGGTAGGGGAAAGGG - Intergenic
1126257461 15:46644437-46644459 AAGTGGAAAGGGAGGGGAAATGG + Intergenic
1126426885 15:48537386-48537408 CTGGGGTCAGAAAGGGGGAATGG + Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126730303 15:51675469-51675491 CTGAGGTCAGGTAGAGGACAAGG - Intergenic
1128565955 15:68700493-68700515 TCCTGCTCAGGGAGGGGAAACGG - Intronic
1128804779 15:70522464-70522486 CTGCGGGCAGGGAGAGGATAAGG + Intergenic
1128968653 15:72086662-72086684 CTGTGGGCAGGGAGGGGTTGGGG + Intronic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129233248 15:74208482-74208504 CTGTGGTCAGCAAGGGAACAAGG - Intronic
1129309606 15:74696785-74696807 CTCTGGTGATGGAGGGGGAAGGG - Intergenic
1129423786 15:75451018-75451040 CTGGGGTCGGGGAGGGGTAGGGG - Intronic
1129465838 15:75723803-75723825 CCTGGGTCAGGGAAGGGAAATGG - Intergenic
1130022333 15:80241907-80241929 GTGAAGTCAGGCAGGGGAAAGGG - Intergenic
1130985562 15:88842515-88842537 CTGTGCTCAGGTAGGGGGGAGGG - Intronic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131386488 15:92012524-92012546 ATGTGGTCAGCGATGGGAAGGGG - Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132256802 15:100383381-100383403 CTGTTCTGAGGCAGGGGAAATGG - Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132891629 16:2207656-2207678 GGGAGGTCAGGGAGGGGGAAAGG - Intronic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1134071839 16:11265115-11265137 CTGTCTGCAGGGAAGGGAAATGG - Intronic
1134544240 16:15095278-15095300 CTACTCTCAGGGAGGGGAAAAGG + Intronic
1134780612 16:16891828-16891850 ACCTGGTCAGGGTGGGGAAAGGG + Intergenic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135303723 16:21351760-21351782 TTGGGGTCAGGGTGGGGGAATGG + Intergenic
1135315167 16:21438832-21438854 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135368093 16:21871100-21871122 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135443724 16:22500049-22500071 GTGTGGTGGGGGAGGGGGAAGGG - Intronic
1135698473 16:24610786-24610808 CTGAGGGCAGGGGGTGGAAAGGG - Intergenic
1135938370 16:26799963-26799985 CCATTGTCAGGGAGAGGAAATGG + Intergenic
1136037201 16:27549585-27549607 CTGGGGGCAGGGCGGGGGAATGG - Intronic
1136300466 16:29330955-29330977 TTGGGGTCAGGGTGGGGGAATGG + Intergenic
1136311832 16:29417493-29417515 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136325274 16:29519289-29519311 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136356062 16:29745479-29745501 CTGGGGTCTGGGAGGGAAATGGG - Intronic
1136439961 16:30259271-30259293 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136654669 16:31702773-31702795 CATTGGTCAGGGAGGAGGAAAGG + Intergenic
1137473672 16:48787369-48787391 CTGTGGTGGGGTAGGGGGAACGG - Intergenic
1137643710 16:50056432-50056454 CTTTAGTCAGGGAGGAGGAATGG - Intergenic
1137679699 16:50329670-50329692 CTGTGGTCAGGAAGGGCAGCCGG + Intronic
1138168312 16:54824295-54824317 CTGTTGTCAGAGAAGGGAGAAGG - Intergenic
1139521741 16:67486704-67486726 CTCTGTGCAGGGAGGAGAAAGGG + Intergenic
1139886465 16:70211558-70211580 TTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1140152097 16:72377992-72378014 ATGAGGTCAGGGAAGGGAAAGGG + Intergenic
1140344563 16:74200292-74200314 TTGGGGTCAGGAAGGGGGAAGGG + Intergenic
1140357399 16:74318238-74318260 CTGGGGTCTGGGAGGGGAGGTGG + Intergenic
1141475124 16:84267756-84267778 CTGAGGTCAGGGAGGGAACCTGG + Intergenic
1141501780 16:84449662-84449684 CTGGTGTCAGCGAGGTGAAAAGG - Intronic
1141996372 16:87638818-87638840 CTGGGGTCAGGAAGGGGGACTGG - Intronic
1142687725 17:1587375-1587397 CTGTGCTCAGAGAGAGGGAAAGG + Intronic
1143016598 17:3893864-3893886 CTGAGCTAAGGGAGGGGAAGTGG - Intronic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143476637 17:7207060-7207082 CTGTGAGCAGAGAGGAGAAAGGG + Intronic
1143478849 17:7217463-7217485 CTGGGGTGGGGGAGGGGAACTGG + Intronic
1143510145 17:7390796-7390818 CTGTCATCAGGGAGGGAGAAAGG + Intronic
1143612290 17:8025692-8025714 CAGGGGCCAGGGAGGGGAATAGG + Intergenic
1143955328 17:10663617-10663639 CTTTCCTCTGGGAGGGGAAATGG + Intergenic
1144370801 17:14589743-14589765 CTGTGTTCAGGGAGAGAAATAGG + Intergenic
1144490399 17:15704125-15704147 CTGGGGTCGGGGAGGGTACAGGG - Intronic
1144592566 17:16536795-16536817 CTGAAGTTAGGGAGAGGAAAGGG + Intergenic
1144741444 17:17584831-17584853 CGGTGCTCAGCGAGGGGAGATGG - Intronic
1144910568 17:18677844-18677866 CTGGGGTCGGGGAGGGTACAGGG + Intronic
1145278763 17:21453623-21453645 ATGTGGGCTGGGAGGGGACACGG - Intergenic
1145279528 17:21457650-21457672 CTGTGGTCAGGCAGGCGAATGGG - Intergenic
1146634067 17:34491186-34491208 CTGGGGTCTGGGAGGAGGAAGGG + Intergenic
1147163189 17:38579437-38579459 CTCTGGGGAGGGAAGGGAAAAGG - Intronic
1147594085 17:41705585-41705607 CTGTGTTCACGGTGGGGAAAAGG + Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147667372 17:42157039-42157061 CTGGGGTCAGGGAAAGGATAGGG + Exonic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148739779 17:49886228-49886250 CTCTGCCCAGAGAGGGGAAAAGG + Intergenic
1148905709 17:50910531-50910553 CTGTGGTCTGGGTGGGGGCAGGG + Intergenic
1149402315 17:56310917-56310939 CTGGGGGCAGGGGGAGGAAATGG - Intronic
1149781252 17:59398181-59398203 GTGTGGTGAGGGAGGGGACTGGG + Exonic
1151177636 17:72301807-72301829 CTGGGGTCAGGGTGGGGGCAGGG + Intergenic
1151304677 17:73255606-73255628 CAGGGCTCAGAGAGGGGAAAAGG + Intronic
1151349617 17:73524119-73524141 CTGGGGCCAGGGAGGGCAAATGG - Intronic
1152469373 17:80482315-80482337 CTGGGGTCAAGGATGGGGAATGG + Intergenic
1152581067 17:81165818-81165840 CTGGGCTCGGGGCGGGGAAAGGG + Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1152988774 18:343357-343379 CTGTTGTCAGGGCAAGGAAAGGG + Intronic
1153571045 18:6473894-6473916 CTGTGGTCAGGAAGTGGCATTGG - Intergenic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1156104829 18:33647505-33647527 TTGTGATTAGAGAGGGGAAAAGG + Intronic
1156295367 18:35784527-35784549 CTCTTGGCAGGAAGGGGAAAGGG + Intergenic
1156521059 18:37722673-37722695 CTGTGGTCACTGAGGGCCAAGGG + Intergenic
1157012555 18:43668834-43668856 CTGTGGTGAGGCAGGGGAAGAGG - Intergenic
1157280101 18:46341307-46341329 CTGAGGTCAGGGAGGGGGGTGGG + Intronic
1157552076 18:48588932-48588954 ATGTAGAGAGGGAGGGGAAAGGG - Intronic
1157636135 18:49156853-49156875 GTGTAATCAGGGAGAGGAAATGG + Intronic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1159743812 18:72207662-72207684 CTGTGGCCAGCTAGTGGAAATGG + Intergenic
1159750598 18:72296414-72296436 CTGGGGTTAGGGATGGGAAGAGG - Intergenic
1160657937 19:282860-282882 CTGTGGGCGGGGCGGGGACAAGG - Intronic
1160749234 19:726215-726237 GTGTGGTCAGGGTGGGGAAGTGG + Intronic
1160830848 19:1104342-1104364 CTGGGGTCGGGGAAGGGGAAGGG + Intronic
1160876773 19:1300116-1300138 CAGCCCTCAGGGAGGGGAAACGG + Exonic
1161039305 19:2101564-2101586 CTGTGGGCAGGGCGGGGCCAGGG - Exonic
1161498316 19:4599035-4599057 CTGTTCTCTGGGAGGGGACAGGG + Intergenic
1161583952 19:5095106-5095128 CTGTGGACAGGGATGGGGACGGG - Intronic
1161664092 19:5564509-5564531 GTGTGGTCAGGGATGGGCAAGGG + Intergenic
1162262542 19:9544565-9544587 GTGTGGTCTGGGTGGGGAACAGG - Intergenic
1162564975 19:11441014-11441036 CTGGGGTCAGGGAAGGGACTAGG - Intronic
1162934667 19:13975803-13975825 CTTTGGCCAGGGTGGGGATAGGG + Intronic
1163121153 19:15218862-15218884 CTGGGGTCAGGGAGCAGTAAGGG - Intergenic
1163124184 19:15235752-15235774 CTGTGGGAAGGGTTGGGAAATGG + Exonic
1163276635 19:16288636-16288658 CTGGGGTGGGGGAAGGGAAATGG - Intergenic
1163319260 19:16563464-16563486 CCATGGTCAGGGAGGGGACAGGG + Intronic
1163807288 19:19406578-19406600 CGGAGATCAGAGAGGGGAAAGGG - Intronic
1163817567 19:19476062-19476084 CTCTGGTCATGGAGGGGACTCGG + Intronic
1164259049 19:23553371-23553393 GTGTGGTCTGGGTGGGGAACAGG - Intronic
1164879028 19:31715238-31715260 CAGTGGTCAGAGGAGGGAAAGGG - Intergenic
1164905553 19:31964629-31964651 CTTGGGTCAGGGAAGGAAAATGG - Intergenic
1165051065 19:33142030-33142052 CTGGGGGCAGGGACTGGAAACGG + Intronic
1165363559 19:35350986-35351008 GTGTGGCCAGGGACAGGAAAAGG - Intergenic
1165781066 19:38434606-38434628 CTGGGGGCAGGGATGGGAATTGG + Intronic
1165819130 19:38663493-38663515 CTGTGTCCCGGGAGAGGAAAGGG + Intronic
1165949549 19:39466426-39466448 CTGGGGTCAGGGAGGAGAGTGGG + Intronic
1165959182 19:39520221-39520243 GTGAGCTCAGGGAGGGGAAGAGG + Exonic
1166043584 19:40217134-40217156 CTGGGCCCAGGGCGGGGAAAGGG - Intronic
1166214317 19:41325589-41325611 CTGGGGACACGGAGTGGAAAAGG - Intronic
1166293240 19:41876896-41876918 ATGGGGTCAGGGAAGGGACAAGG + Intergenic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167429920 19:49448284-49448306 CTGTGAGCAGGGAAGGGATAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168092821 19:54096831-54096853 CTGGGGTCGGGGAGGAGAAGTGG - Intronic
1168300315 19:55401329-55401351 CTGGGGTCGGGGAGGGTACAGGG - Exonic
1168311855 19:55464613-55464635 CTGTGAGCAGGGAGGGGCAGGGG + Intergenic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
1168722968 19:58564567-58564589 CTGCAGTCAGGGTGTGGAAATGG - Intronic
925285811 2:2715174-2715196 CTGTGGTGAGGGAGGGTCACAGG - Intergenic
925337605 2:3109339-3109361 GAGTGTTCAGGCAGGGGAAAGGG - Intergenic
926231878 2:11010470-11010492 TGGTGGGCAGGGTGGGGAAAAGG + Intergenic
926287723 2:11503192-11503214 CTGGGATGAGGGAGGAGAAAAGG - Intergenic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927966560 2:27273661-27273683 CTGTGGTCAGTGCAGGGAGAGGG - Intronic
929044062 2:37773550-37773572 CTCTGGGCAGGGAGGGGCCAAGG - Intergenic
929510275 2:42561036-42561058 ATGGGGTCAGGGAGGTGAATAGG - Intronic
930033122 2:47070199-47070221 CTGTGGCCTGGGAGGGGATGAGG - Intronic
930863436 2:56098547-56098569 CTGTTGTGAGGTGGGGGAAAGGG + Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931642679 2:64395714-64395736 CTGAGCTCAGGGATGTGAAAAGG - Intergenic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
932707819 2:74040255-74040277 GTGTGGTCAGGGAGGGGGCTTGG + Intronic
932878384 2:75476373-75476395 CTGCAGTCAGGGAGGGGTAAAGG - Intronic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934029029 2:88024975-88024997 CTGTGGCCTAGAAGGGGAAAAGG - Intergenic
934135070 2:88987814-88987836 TTGAGATGAGGGAGGGGAAATGG + Intergenic
934849938 2:97691681-97691703 CGGAGGTCAGGGTGGGGAATGGG + Intergenic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
937413685 2:121697699-121697721 CTGTGGACAGGGAGAGGGCAGGG + Intergenic
937693701 2:124784334-124784356 TTGTGCTCAAGGAGGGTAAAAGG + Intronic
937842133 2:126534639-126534661 CAGTGGTTAAGGAGAGGAAAAGG + Intergenic
938344357 2:130556725-130556747 CTGTCTTCAGGGAGGTGAAAGGG + Intergenic
938345476 2:130563997-130564019 CTGTCTTCAGGGAGGTGAAAGGG - Intergenic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
939941112 2:148352513-148352535 AGGTGGTGAGGGAAGGGAAATGG - Intronic
940140065 2:150484491-150484513 ATCTGGACAGGGAGGGGGAATGG - Intronic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
941328443 2:164145630-164145652 CAGTGGTCAGGGATTGGCAATGG + Intergenic
941433258 2:165436724-165436746 ATGTAGTCAGTGTGGGGAAAGGG - Intergenic
942026045 2:171911997-171912019 CTTTGGTCAAGGAGGGGCCAAGG + Intronic
942194975 2:173508327-173508349 CTGTGGACAGGCAAGGGATATGG + Intergenic
942887098 2:180939031-180939053 CTTTGGTCAGGGAGCAGACATGG - Intergenic
942945474 2:181667534-181667556 CAATGTTGAGGGAGGGGAAAGGG + Intronic
943117624 2:183692504-183692526 CACTGGTGAGGGAGGAGAAAGGG + Intergenic
944187657 2:196967299-196967321 CTGCGGTTGGGGAAGGGAAAGGG - Intronic
944215457 2:197250283-197250305 CTGGGGCCAGGGAGAGGTAATGG + Intronic
944621172 2:201517311-201517333 CAGGGGTTGGGGAGGGGAAATGG - Intronic
945215855 2:207433445-207433467 CCTTGGTCATGGTGGGGAAAAGG + Intergenic
945554957 2:211265392-211265414 GTGTGATCAGGGTGAGGAAAAGG - Intergenic
945665007 2:212730123-212730145 CTGTGGTCAGGGAGAGTGACAGG + Intergenic
946146395 2:217734416-217734438 CTGTGGTCAGGGTTGAGAGAGGG - Intronic
946519973 2:220453821-220453843 CTGTGCTGATGTAGGGGAAAGGG + Intergenic
947216536 2:227755075-227755097 CAATGGTAAGGGAGGGGAATTGG + Intergenic
947232562 2:227902745-227902767 CTGTGGTCTGGAAGTGGCAAAGG + Intronic
947639163 2:231696642-231696664 CTGTGGTGCGTGAGGGGACAGGG + Intergenic
947718026 2:232351591-232351613 ATGTGTGCAGGGAGGGGACAGGG - Intergenic
947741491 2:232486937-232486959 GTGTGTGCAGGGAGGGGACAGGG - Intronic
948088524 2:235270707-235270729 CTCTAGTGAGGTAGGGGAAACGG - Intergenic
948864030 2:240766402-240766424 CACTGGGCAGGCAGGGGAAACGG + Intronic
948942048 2:241201565-241201587 CTGGGGTCCCGGAGGGGAACTGG - Intronic
1169230921 20:3888689-3888711 CTGTGGCGAAGGAGGGGAAGTGG - Intergenic
1169405689 20:5319075-5319097 AAGTGCTGAGGGAGGGGAAAAGG + Intergenic
1170425257 20:16228936-16228958 GTGGGGTTGGGGAGGGGAAATGG - Intergenic
1170567077 20:17613461-17613483 CTGAGGTCTGGGAGGTGACAAGG + Intergenic
1170914619 20:20610647-20610669 CTGTGGAAAGGAAGAGGAAAAGG - Intronic
1171042447 20:21778189-21778211 CTTTGGTAAGGGAGAGGAAGAGG - Intergenic
1171726952 20:28632408-28632430 AGGGGCTCAGGGAGGGGAAATGG + Intergenic
1171751306 20:29052207-29052229 AGGGGCTCAGGGAGGGGAAATGG - Intergenic
1171791025 20:29525673-29525695 AGGGGCTCAGGGAGGGGAAATGG + Intergenic
1171856678 20:30351162-30351184 AGGAGCTCAGGGAGGGGAAATGG - Intergenic
1172014490 20:31864885-31864907 CTGTGGTGGGGGAGGGGGAGGGG - Intronic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172904472 20:38358650-38358672 CTGGGGGCTGGGAGGGCAAAGGG - Intronic
1173164568 20:40677945-40677967 CAGTGCCCAGGGAGGGGGAAGGG + Intergenic
1173742757 20:45413004-45413026 CTGTGGTTCGGCAGGAGAAAAGG - Intergenic
1173865308 20:46308896-46308918 CAGTAGTCAGGGGGCGGAAATGG - Intergenic
1174412557 20:50345473-50345495 CTGTGGTCAGGTGGGGAAACCGG - Intergenic
1174465355 20:50712967-50712989 CTATGCTAAGGGAGGGGGAAGGG + Intergenic
1175778663 20:61668634-61668656 CTGGGGTCAGAGAGGTGAAATGG + Intronic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1176259769 20:64173449-64173471 GAGAAGTCAGGGAGGGGAAATGG - Intronic
1176259780 20:64173502-64173524 GAGAAGTCAGGGAGGGGAAATGG - Intronic
1176259791 20:64173555-64173577 GAGAAGTCAGGGAGGGGAAATGG - Intronic
1176259800 20:64173605-64173627 GAGAAGTCAGGGAGGGGAAATGG - Intronic
1176259819 20:64173711-64173733 GAGAAGTCAGGGAGGGGAAATGG - Intronic
1176313470 21:5218721-5218743 AGGGGCTCAGGGAGGGGAAATGG + Intergenic
1176362173 21:6006732-6006754 CTGTGGCCAGGGAAGATAAAAGG - Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179308861 21:40179350-40179372 CTGAGTTCAGGGAGGGGTGATGG + Intronic
1179761345 21:43531813-43531835 CTGTGGCCAGGGAAGATAAAAGG + Intronic
1180117042 21:45714968-45714990 CTGTTCTCAGGAAGGGGAACTGG + Intronic
1180138783 21:45878262-45878284 CGGAGGGCAGGGATGGGAAATGG - Intronic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181947484 22:26529458-26529480 AGGAGGTCAGGGAGGGGAGAAGG - Intronic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182334023 22:29571099-29571121 GTGGGGTCAGGGTGGGGACATGG - Intronic
1182551999 22:31105627-31105649 CTGTTCTGGGGGAGGGGAAATGG - Intronic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1183829451 22:40410019-40410041 CTGTGCTCAGGAAGAGGGAAGGG + Exonic
1184073743 22:42163084-42163106 CTCTGCTCAAGGAGGGGACAGGG + Intronic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
1185192348 22:49446904-49446926 CTCTGGGCGGAGAGGGGAAAGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
949980611 3:9499959-9499981 TTGGGGTGGGGGAGGGGAAATGG - Exonic
950032399 3:9861681-9861703 CTGTGGCCAGGCAGGGGGCAGGG - Intergenic
950033061 3:9864486-9864508 CTGTGGTCAGTGAACAGAAAAGG - Intergenic
950039284 3:9909431-9909453 CTGGAGTCAGTGGGGGGAAAAGG + Intronic
950486989 3:13279759-13279781 CTGTGTGCAGGTAGGGGGAAAGG + Intergenic
950656206 3:14438461-14438483 CTGTGGAAAGGGCGGGGCAAGGG + Intronic
950689143 3:14641811-14641833 CAGTGGTCAGGGCAGGGACATGG - Intergenic
950706914 3:14788555-14788577 ATGTGGCCAGGGAGGTGAGATGG + Intergenic
950751907 3:15135841-15135863 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
950753708 3:15154443-15154465 CTGTGGCAAGGGAAAGGAAATGG - Intergenic
950989446 3:17417019-17417041 CTGTGGTAAGGTGGGGGGAAGGG + Intronic
951332076 3:21380325-21380347 GTGTGTTCAGGGAGAGGAACAGG + Intergenic
952945083 3:38473577-38473599 CTGTGGTGAGGGAGGGGCATGGG + Intronic
954536552 3:51363633-51363655 CTGTTGTCAGGTGGGGGAAGTGG - Intronic
954575062 3:51671376-51671398 CGGGGGTCACGGAGGGGACACGG - Exonic
954619137 3:51985829-51985851 CTGGGGGCAGGGATGGGAAGAGG - Intronic
954776263 3:53021293-53021315 CTGATGTCAAGGAGTGGAAAAGG + Intronic
956877670 3:73479708-73479730 CTGGGGTCAGGCAGGGGAGATGG - Intronic
957721974 3:84013600-84013622 CTGGGGTCGGGGATGGGGAAGGG + Intergenic
957904541 3:86539764-86539786 GTGTGGTCAGGGTGAGGAACAGG + Intergenic
958700128 3:97578423-97578445 ATGTGATCAGTGAGTGGAAATGG - Intronic
958780020 3:98530040-98530062 CTGAGGTCAGGGAAGGATAAAGG - Intronic
961083027 3:124042699-124042721 CTGTGGGGAGGCAGGGGAAGAGG + Intergenic
961284707 3:125791857-125791879 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
961751919 3:129101603-129101625 CGGTGTTCAGGCAGGGGAACAGG + Intronic
961754442 3:129119792-129119814 CGGTGGTCAGGGAGGGGGCAGGG - Intronic
961928014 3:130503637-130503659 GTCTTGTCAGGAAGGGGAAATGG + Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962126280 3:132622490-132622512 CTGTGGTCAGAGATGAGAAAAGG - Intronic
962201330 3:133403353-133403375 CTGTGGACAAGGGGGGGAAGAGG - Intronic
963516080 3:146309866-146309888 CTGGGTGCAGGGAGAGGAAATGG - Intergenic
964570932 3:158106541-158106563 CGGGGGTTGGGGAGGGGAAAAGG + Intronic
965078712 3:164010304-164010326 CTGTCGGCAGGTAGGGGACAAGG + Intergenic
965721888 3:171671064-171671086 CTGGGCTCAGGGAGGGGTAATGG + Intronic
966672316 3:182540928-182540950 CTGTCTTCATGGGGGGGAAAAGG - Intergenic
967032911 3:185624961-185624983 CTGTGTTCTGGTATGGGAAATGG + Intronic
967080263 3:186043287-186043309 ATGGGATCAGGGAAGGGAAATGG - Intergenic
967203938 3:187102107-187102129 GTGTGGTGGGGGAGGAGAAATGG + Intergenic
967672441 3:192253629-192253651 TTGTGGTTTGGAAGGGGAAATGG + Intronic
968503036 4:960028-960050 TTGTGTTCAGGGAAGGGAGAAGG - Exonic
968512076 4:1000208-1000230 TTGGGGTGTGGGAGGGGAAATGG + Intronic
968717972 4:2175852-2175874 CAGAGGCCAGGGAGGGCAAAGGG - Intronic
968815352 4:2818755-2818777 CTCTGGGCAGGGAGGGGTCAGGG - Intronic
968841964 4:3014167-3014189 CTGTGATAAGGGAAAGGAAAGGG - Intronic
969013034 4:4083004-4083026 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
969686721 4:8679601-8679623 CTGTGGTGAGTGAGGGGTGAGGG - Intergenic
969696691 4:8738890-8738912 CGGTGGTCAGGGAGGGCATCAGG - Intergenic
969720629 4:8891539-8891561 CTGAGGTCAGGGAAGGGGACTGG - Intergenic
969740810 4:9024790-9024812 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
970863077 4:20726092-20726114 CTGTGGGCCGGTATGGGAAATGG + Intronic
971473248 4:27049637-27049659 ATGCAGTCAGGGAGGGGAACAGG + Intergenic
972511066 4:39769602-39769624 CTGGGGTGAGGGAGTGGTAAGGG - Intronic
975801029 4:78058955-78058977 CAGTGCTTAGGGAGGGGGAAGGG + Intronic
976053825 4:81039455-81039477 CTGTGTCCAGGGAGTGGTAAGGG - Intronic
976794542 4:88917667-88917689 CTGAGGTCAAGGATGGAAAATGG - Intronic
976930302 4:90559321-90559343 CTGTGGTGTAGAAGGGGAAAAGG + Intronic
977464660 4:97368826-97368848 GTGGGGTTGGGGAGGGGAAATGG - Intronic
977583173 4:98746914-98746936 CAGTGGATAGGGAGGTGAAAAGG - Intergenic
978730997 4:112026116-112026138 CTGTCAGCAGGGAGGGGAAAGGG + Intergenic
978839277 4:113190649-113190671 CGGAGGCCAGGGAGGTGAAAAGG + Intronic
978858741 4:113424360-113424382 GTATGGTGAGAGAGGGGAAATGG + Intergenic
979210974 4:118102359-118102381 CTGTGGTCATGGAGGAGGTAAGG - Intronic
979270103 4:118749536-118749558 CTGTGCACAGGGAGTAGAAATGG - Intronic
979442988 4:120774508-120774530 CTGTAGCCTGGGAGGGCAAATGG + Intronic
980762460 4:137253759-137253781 CTGGGGTAAGGGAGGGGCCAAGG - Intergenic
981219639 4:142216398-142216420 TTGTAGTCAGGAAAGGGAAATGG - Intronic
981257046 4:142674069-142674091 CTGGGATCAGAGAAGGGAAAGGG - Intronic
981785283 4:148471103-148471125 GTGGGGTCAGGGAGGGGAGTTGG - Intergenic
981968811 4:150639197-150639219 CTGTGGTGGGGTAGGGGAAGGGG + Intronic
982216024 4:153083117-153083139 CTGTGGTCAGGGAGCCCAAGGGG + Intergenic
982371318 4:154636885-154636907 CTGTTGTGGGGTAGGGGAAAAGG + Intronic
982403531 4:154995495-154995517 GTGAGGTCAGGGAGGTGAAAGGG - Intergenic
982521451 4:156421750-156421772 CTGTTTTCAGGGAGCAGAAATGG + Intergenic
982708589 4:158737261-158737283 CTGTCGTAAGGGAGGGGAAAGGG + Intergenic
983263473 4:165482810-165482832 GTGGTGTCAGGGAGGGGAAGTGG + Intronic
983649060 4:170020634-170020656 ATGCAGTCAGGGAGGGGAATGGG - Intronic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
984861081 4:184239379-184239401 GGGTGGTAAGGGAGAGGAAATGG + Intergenic
985420213 4:189777851-189777873 CTGGTGTCACGGTGGGGAAAGGG - Intergenic
985420225 4:189777901-189777923 CTGGTGTCATGGCGGGGAAAGGG - Intergenic
985433673 4:189906567-189906589 AGGGGCTCAGGGAGGGGAAACGG - Intergenic
985570805 5:643742-643764 CTGGGGCCAGGGAGGGGCAGAGG + Intronic
985570810 5:643788-643810 CTGTCATCGAGGAGGGGAAAGGG - Intronic
985765335 5:1776288-1776310 ATGTGGGCAGTGATGGGAAAAGG + Intergenic
986249137 5:6040359-6040381 CTGTGCTCATGGATGGGAAAAGG + Intergenic
987366871 5:17156649-17156671 GTGAGATCAGGGAGGGGATATGG - Intronic
988714472 5:33811488-33811510 AAGTGGTCAGGAAGAGGAAATGG + Intronic
988889451 5:35599016-35599038 CTGTGGCCACTGAGGGGGAAGGG - Intergenic
989197012 5:38725789-38725811 CTTTGGACAGGGACAGGAAAGGG + Intergenic
989612800 5:43311815-43311837 CTGTGGGGAGGGAGTGTAAAAGG - Intronic
990327202 5:54690247-54690269 TTCTGGTCAGGGAAGGGGAAAGG - Intergenic
990509272 5:56475524-56475546 CTGTTGTCGGGTAGGGGAAGTGG + Intronic
991638891 5:68733873-68733895 CTCAGGTCATGGAGGAGAAATGG - Intergenic
992868525 5:80982375-80982397 TTGTGGTCAGGGAGGGTTACAGG + Intronic
993521830 5:88912197-88912219 CAGGGGTTAGGGAGGGGAAGGGG + Intergenic
993803218 5:92371389-92371411 CTGTGTTCAGTGACGGGATAGGG - Intergenic
994325194 5:98438877-98438899 GTGTGGTCTGGGTGGGGAACAGG - Intergenic
995741770 5:115363522-115363544 CTGAGGCAAGGGAGAGGAAAGGG - Intergenic
995952796 5:117736964-117736986 ATGTAGTCAGGGAGATGAAATGG - Intergenic
996052344 5:118948504-118948526 CTGTGATCAGGGTGGGGAACAGG + Intronic
996551882 5:124739467-124739489 CTGGAGGCAAGGAGGGGAAAAGG - Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997425535 5:133800256-133800278 CAGTACTCAGGGAGGGGACAGGG + Intergenic
997846542 5:137291539-137291561 CTGAGGTCAGGTATGGGCAAAGG + Intronic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
998257097 5:140596417-140596439 CTGACTTCAGGGAGGGGAATGGG - Intergenic
998375694 5:141689138-141689160 CTGAGCTGAGGGAGAGGAAATGG + Intergenic
998519976 5:142791400-142791422 CTTTTATCAGGTAGGGGAAAGGG + Intronic
998552224 5:143088723-143088745 CTTTGGCAAGGGAGGGGAAGGGG + Intronic
998579002 5:143350394-143350416 ATGTGCACAGAGAGGGGAAAAGG + Intronic
999275160 5:150325354-150325376 CTATGGTCAGTGAGGGGAGGAGG + Intronic
999323116 5:150626760-150626782 CTGGGGCCAAGGAGGGGAAGAGG + Intronic
999517188 5:152313460-152313482 CTTTGGTCAGGGAGGAGAAGGGG - Intergenic
999916417 5:156267543-156267565 CTGTGCTCAGGGAGGGAAATTGG - Intronic
1000195610 5:158954679-158954701 CTGAGGTCAGGGAGGCCACAGGG - Intronic
1000607187 5:163337799-163337821 GTGTGGTCTGGGTGGGGAACAGG - Intergenic
1001256131 5:170184780-170184802 CTGTGGTCAGTGAGGGACAGGGG - Intergenic
1001551158 5:172603068-172603090 CAGGGGTCAGGGAGGGGACAGGG + Intergenic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1001951451 5:175819562-175819584 CTCTGGACAGGGAGGGTCAAGGG + Intronic
1002000388 5:176193660-176193682 CAGGGGTCAGGGTGGGGGAATGG - Intergenic
1002062870 5:176636667-176636689 CTGAGAACAGGGAGGGGAACCGG + Intronic
1002253949 5:177945324-177945346 CAGGGGTCAGGGTGGGGGAATGG + Intergenic
1002634137 5:180598773-180598795 CTGGGCCCAGGAAGGGGAAACGG + Intergenic
1003528251 6:6916494-6916516 CTGTGCTCATGGAGAGAAAATGG + Intergenic
1004071719 6:12304515-12304537 CTGGGGACAGGGAAGGGAAGTGG + Intergenic
1005089660 6:22043311-22043333 CAGTGGCCAGGGTGGGGACAAGG - Intergenic
1005197734 6:23308949-23308971 TTGTGGTCAGGGCAGGGAAAAGG + Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005909328 6:30294399-30294421 ATGTGGTCAGGAGTGGGAAAAGG - Intergenic
1005961963 6:30700431-30700453 TCGTGGTCTGGGAGGGAAAAGGG + Exonic
1006012980 6:31057752-31057774 CTGCCGACAGGGAGGGAAAAGGG + Intergenic
1006136508 6:31899458-31899480 CTGGGGTGAGGGAGTGGTAAGGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006840635 6:37026068-37026090 CTGTGGGCAGAGAGAGGAAGAGG - Intronic
1007702847 6:43774473-43774495 CTGTGGGGAGGAAGGGGAAGGGG + Intronic
1007718888 6:43873679-43873701 CTGAGGTCAGGGAGGTAACAGGG + Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009464634 6:63954205-63954227 ATGTGATCAGGGTGAGGAAAAGG - Intronic
1010463287 6:76138046-76138068 CTGTTGTGAGGTAGGGGAAGGGG - Intergenic
1010538727 6:77064003-77064025 CTGTGGTGAGGGAGCGTCAATGG + Intergenic
1011651743 6:89512562-89512584 CTGTGGCCAGGGTGGGCACAAGG + Intronic
1011868852 6:91866958-91866980 CTTTGGTCAGTGAGGGAAATGGG + Intergenic
1011959558 6:93070243-93070265 CAGTGGTGGGGAAGGGGAAAGGG + Intergenic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013259097 6:108421019-108421041 GAGTTTTCAGGGAGGGGAAAGGG - Intronic
1013272985 6:108560093-108560115 CGCGGCTCAGGGAGGGGAAAGGG - Intronic
1015461463 6:133496476-133496498 GGGTGGTCATGTAGGGGAAATGG - Intronic
1015600067 6:134903172-134903194 CTGATTTCAGGGAGGGGAAGTGG - Intergenic
1015673795 6:135722575-135722597 TTGGAGTCAGGGAGGGGAAAAGG - Intergenic
1015807587 6:137126999-137127021 CAGGGGTCAGGGAGTGGGAATGG - Intergenic
1016029628 6:139323930-139323952 CTGTGGTCAGGGTTTGGAAAGGG + Intergenic
1016376594 6:143427447-143427469 CTGTAGTCATGGAGGTGAACTGG + Exonic
1017094821 6:150795496-150795518 ATGTAGACAGGGAGGGGAAGTGG - Intronic
1017637811 6:156460168-156460190 GTGTGGTCAGGGAAGAGACAGGG - Intergenic
1017767847 6:157621609-157621631 CTGTGGCCAGGCATGGGTAATGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1017937893 6:159023126-159023148 GTGTGGCCGGGGAGGGTAAATGG + Intergenic
1018025279 6:159800632-159800654 GTGAGGTCAGGAAGGGAAAATGG - Intronic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018274247 6:162113501-162113523 CTGTGGTCAATGAAGGGAGAGGG + Intronic
1018954412 6:168398561-168398583 CAGGGGTCAGGGAGGGGCAATGG + Intergenic
1019281874 7:204697-204719 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019281890 7:204768-204790 CTGTGCTCAGGGAGGGAATGTGG + Intronic
1019281902 7:204839-204861 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1020914146 7:14170917-14170939 CTAGTGTCAGGGAGGGGAACTGG + Intronic
1021876718 7:25056363-25056385 CTCTGGTCAGGTGGGGGAATGGG - Intergenic
1022106510 7:27200804-27200826 GTGTGGACAGGGAAGGGATAGGG - Intergenic
1022324610 7:29319898-29319920 GTGAGGTCGGGGAGGGGAAGGGG - Intronic
1023968515 7:44975923-44975945 CTGAGGCCTGGGAGGGGAAGAGG - Intronic
1024236501 7:47402780-47402802 AAGTGGTTAGGGAAGGGAAAAGG + Intronic
1024437787 7:49379768-49379790 TTGTGGTGGGGGAGGGGGAAGGG - Intergenic
1024612570 7:51080132-51080154 CAGAGGTCAGGGAGGAGACAGGG + Intronic
1024825640 7:53386591-53386613 ATGTGGTCCCGGAGAGGAAAGGG + Intergenic
1025234685 7:57226686-57226708 CTGTGCTCAGGGCGGGGATTTGG + Intergenic
1026094064 7:67327489-67327511 CAGGGGTTAGGGAGGGGAAGGGG - Intergenic
1027240241 7:76322726-76322748 CTGTGGTCAGTGAGGAGTTAGGG - Intergenic
1027313515 7:76970263-76970285 CTGTTGTCAGGGAGGTGCCATGG + Intergenic
1027789173 7:82617321-82617343 CTGAGGACAGGAAGGGGAAAAGG - Intergenic
1027944160 7:84723675-84723697 CTGTGATCATGGAGGAGAAGAGG - Intergenic
1028328150 7:89552712-89552734 TTTTGGTCTAGGAGGGGAAATGG - Intergenic
1029071691 7:97904638-97904660 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1029374223 7:100168307-100168329 CTGTGATCAGGGAGGGAATTGGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030262590 7:107580604-107580626 CCCCGGTCAGGAAGGGGAAAAGG - Intronic
1031390473 7:121207801-121207823 CTTTGGTCAGGAAGGGGAATGGG + Intronic
1032498098 7:132377936-132377958 CTGTGGTATGGGAGAGGCAATGG + Intronic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035151450 7:156876612-156876634 CTGTGGTCAGGGAGAGTACTTGG - Intronic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035463496 7:159061174-159061196 CGGTACTCAGGGAGGAGAAATGG + Intronic
1036246015 8:7117358-7117380 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
1036492073 8:9237039-9237061 CTGTGGTCAGGCAATGGAAGTGG + Intergenic
1036537619 8:9665903-9665925 ATGAGGTTAGGGAGGGGAAAAGG - Intronic
1036611152 8:10350870-10350892 CAGCTGTCAGGGAGGGGAAGTGG + Intronic
1036631347 8:10518089-10518111 CTGGGCTCAGGGAGGGGCAGGGG + Intergenic
1036642114 8:10591266-10591288 CGGTGCTCAGGGTGGGGGAAAGG - Intergenic
1036888255 8:12576670-12576692 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037575925 8:20202821-20202843 CTGGGGTGAGGGAGGGGATATGG - Intronic
1037986337 8:23292919-23292941 CTGTGGTGGGGGAGGGGTATAGG - Intronic
1038483066 8:27914916-27914938 CTGGGATCAGGGAAGGGAGAAGG - Intronic
1039469187 8:37803015-37803037 CTGTGATTAGGGAGGGGGAGTGG + Intronic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1039609003 8:38904201-38904223 CTGGGGTCAGGGCAGGGAAGGGG - Intronic
1039662932 8:39486982-39487004 CTTAGGCCAGGCAGGGGAAAAGG - Intergenic
1039895004 8:41710803-41710825 CACTGGTCAGGAAGAGGAAAGGG + Intronic
1040425745 8:47284285-47284307 CTGTAGGCAGGCAGGAGAAATGG - Intronic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040551908 8:48444255-48444277 CTTTGGGCAGGGAGGGGCTATGG + Intergenic
1041195682 8:55399537-55399559 ATGTGGTTAGGGATGGGAATAGG - Intronic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1041698675 8:60763894-60763916 CTGTGGTCAGAGAGGAAAAGAGG + Intronic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1046501234 8:115080115-115080137 CAGTGGACAGGGTGGAGAAAAGG + Intergenic
1046785678 8:118263811-118263833 CTGTGGTCAGGCAGTGGAGATGG + Intronic
1046800631 8:118422884-118422906 CTGTGGTGTGGGAGGAGCAAGGG + Intronic
1047600739 8:126423717-126423739 CAGTGGTCAGGGTGGGGGATGGG - Intergenic
1047712982 8:127570352-127570374 GTGTGATCAGGGAGATGAAAAGG - Intergenic
1047802634 8:128325821-128325843 CTGTGGTCAGGGAAGATGAATGG + Intergenic
1048321454 8:133403707-133403729 CAGTGCTCAGGGATGTGAAATGG + Intergenic
1048340028 8:133531555-133531577 CTGGGGTCAGGGAGGTGGCAGGG - Intronic
1048755900 8:137737920-137737942 CTTTTGTCAGAGAGGAGAAACGG - Intergenic
1048798407 8:138172865-138172887 GAGTGGGCAGGGAGGGGAATGGG - Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049161144 8:141098736-141098758 CTGAGGTCAGGGAGGTAACACGG - Intergenic
1049569578 8:143362859-143362881 GAGTGGCCAGGGAGGGGAAGCGG - Intergenic
1050151364 9:2622077-2622099 GTGGGGGCGGGGAGGGGAAAGGG - Exonic
1051146213 9:14030226-14030248 GCGGGGCCAGGGAGGGGAAATGG + Intergenic
1051394987 9:16610115-16610137 CAGTGATGAGGGAAGGGAAAAGG + Intronic
1051547266 9:18290717-18290739 CTGTGATCAAGTAGGGTAAAGGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052762536 9:32607350-32607372 CAGTGCTCAGGGATGGGAACAGG + Intergenic
1053178029 9:35943432-35943454 CTCAGATCAAGGAGGGGAAATGG - Intergenic
1053396278 9:37777322-37777344 CTGTGGCCTGGGATGGGGAAGGG - Intronic
1053414631 9:37939334-37939356 GTGTTGTCAGGGAGGGGCAGAGG - Intronic
1053722791 9:40964693-40964715 AGGGGCTCAGGGAGGGGAAACGG - Intergenic
1054343176 9:63887307-63887329 AGGGGCTCAGGGAGGGGAAACGG + Intergenic
1055259186 9:74412547-74412569 CTGTGTTGAGGGAGGGGGCAGGG + Intergenic
1055658570 9:78477360-78477382 CTAGGCTCAGGGAGGAGAAACGG - Intergenic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1056334431 9:85552563-85552585 CTGTGCTCAGAGAGAGGAAATGG - Intronic
1056591377 9:87968445-87968467 CTGAGTGCAGGGAGGGGACAGGG + Intronic
1056853367 9:90103443-90103465 CTGGGGTGGGGGCGGGGAAAGGG - Intergenic
1057314893 9:93961641-93961663 CTGGGGTCTAGGTGGGGAAAAGG + Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1058169861 9:101667326-101667348 GTGTGTCCAGGGAGGAGAAATGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059334477 9:113560248-113560270 CTGAGATCAGGAAGGGGAACGGG + Intronic
1059356020 9:113700076-113700098 CTGAGGCCTGGCAGGGGAAAGGG - Intergenic
1059389264 9:113988596-113988618 CTGTGGTCAGGGTGGAGACCAGG + Intronic
1060299788 9:122368557-122368579 CTGTGGCCAGGGAAGGCACAGGG + Intergenic
1060455759 9:123794253-123794275 CAGTGTACAGTGAGGGGAAAGGG + Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062437550 9:136553303-136553325 CTGAGGTCAGGGCTGGGAAGGGG + Intergenic
1062562204 9:137146621-137146643 GAGTGGTAAGGAAGGGGAAAGGG - Intronic
1203737499 Un_GL000216v2:150634-150656 CTGTAGGCAGAGAGTGGAAAAGG + Intergenic
1203452370 Un_GL000219v1:131287-131309 AGGGGCTCAGGGAGGGGAAATGG + Intergenic
1185907786 X:3952409-3952431 GTGTGGACAGGGAGGGGCTATGG + Intergenic
1186444559 X:9615728-9615750 CTCTGGCCAAGGATGGGAAAGGG - Intronic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1189335372 X:40168007-40168029 CTCTGGTGGGGGAGGGGAAAGGG - Intronic
1189833072 X:44994713-44994735 CTTGGGCAAGGGAGGGGAAAGGG + Intronic
1190107037 X:47568435-47568457 CTGTAGGCAGGGAGGGGGAGGGG + Intronic
1190276771 X:48904241-48904263 CGGTGGTAAGGGAGGAGAGAAGG + Exonic
1190896052 X:54619008-54619030 CTAGGGTTAGTGAGGGGAAATGG + Intergenic
1191044681 X:56122990-56123012 GGGTGGGCAGGGAGTGGAAAAGG - Intergenic
1192184653 X:68938865-68938887 CTGAGAAGAGGGAGGGGAAAGGG - Intergenic
1196575902 X:117318726-117318748 CTGTGGTCATGTAGATGAAATGG - Intergenic
1196742138 X:119034321-119034343 CAATGGACAGGGAGAGGAAATGG - Intergenic
1196918777 X:120565100-120565122 CTGTGATCAAAAAGGGGAAATGG - Intronic
1197409950 X:126104272-126104294 CTGTTGTGAGGTGGGGGAAAGGG - Intergenic
1197722239 X:129753133-129753155 TTGGGGGCAGGGAGGAGAAAAGG - Intronic
1199940122 X:152617915-152617937 CTGTCGAGAGGGCGGGGAAAGGG + Intergenic
1200036571 X:153334939-153334961 CTGTGGAGAGGCAGGGGAAAGGG + Intronic
1200077248 X:153557259-153557281 CTGTGGAGAGGAAGGGGAATGGG + Intronic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1201227105 Y:11828725-11828747 GTGTGGGCAGGGTAGGGAAAGGG - Intergenic
1201504981 Y:14688332-14688354 CTGTGGACAGAGAAGGCAAAGGG + Intronic
1201514135 Y:14799018-14799040 CTGGGGGCATGGAGGGGAAGGGG + Intronic