ID: 1182256553

View in Genome Browser
Species Human (GRCh38)
Location 22:29043148-29043170
Sequence TTGCTCTTCTGGGAGCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182256545_1182256553 12 Left 1182256545 22:29043113-29043135 CCCAGTCCATCCCAAAACAAGCG 0: 1
1: 0
2: 0
3: 9
4: 306
Right 1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG 0: 1
1: 0
2: 4
3: 20
4: 283
1182256544_1182256553 23 Left 1182256544 22:29043102-29043124 CCTTCTGCTTGCCCAGTCCATCC 0: 1
1: 0
2: 0
3: 34
4: 335
Right 1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG 0: 1
1: 0
2: 4
3: 20
4: 283
1182256548_1182256553 2 Left 1182256548 22:29043123-29043145 CCCAAAACAAGCGTCATTCTCAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG 0: 1
1: 0
2: 4
3: 20
4: 283
1182256547_1182256553 6 Left 1182256547 22:29043119-29043141 CCATCCCAAAACAAGCGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG 0: 1
1: 0
2: 4
3: 20
4: 283
1182256549_1182256553 1 Left 1182256549 22:29043124-29043146 CCAAAACAAGCGTCATTCTCAGC 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG 0: 1
1: 0
2: 4
3: 20
4: 283
1182256546_1182256553 11 Left 1182256546 22:29043114-29043136 CCAGTCCATCCCAAAACAAGCGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG 0: 1
1: 0
2: 4
3: 20
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182256553 Original CRISPR TTGCTCTTCTGGGAGCTCCA AGG Intronic
902507122 1:16945829-16945851 CTGCTCTTCTGGATGCTCCTGGG + Intronic
903357751 1:22758514-22758536 TGGCTGTCCTGGGAGCCCCAGGG - Intronic
904094842 1:27968515-27968537 TTGCTGTTCTAGGAGGTCCATGG + Intergenic
904449488 1:30601802-30601824 TTCCTCTCCTGTGAGATCCAGGG + Intergenic
904606505 1:31700836-31700858 ATGCCCTTCCTGGAGCTCCAAGG - Intronic
904819893 1:33235143-33235165 TTACTCTTCTGGAACCTCCCAGG + Intergenic
905325141 1:37146489-37146511 TTCCTCCTCAGGCAGCTCCATGG - Intergenic
906102975 1:43274864-43274886 TGGCTCCCCTGGGTGCTCCAAGG + Intergenic
908249941 1:62257448-62257470 TTGCTCCTCTGTCACCTCCAGGG - Intronic
908518834 1:64920778-64920800 TTGGCCTTCAGGGAGCTTCATGG - Intronic
908946506 1:69504421-69504443 TTGCTCCTCTGTGAGTTCCCTGG - Intergenic
911715710 1:101130507-101130529 TTGCTCTCCTGGGAGTTCTCAGG - Intergenic
914915208 1:151815253-151815275 CTGCCCGTCTGGGAGCCCCAAGG + Exonic
915252917 1:154603330-154603352 TTGGTCTTCAGGGAGCTGGAGGG + Intronic
915928871 1:160045863-160045885 TTGTTCCTCTTGGAGCTCAAAGG - Intronic
915996133 1:160565814-160565836 CAGCTCCTCAGGGAGCTCCAAGG - Intronic
916018989 1:160776564-160776586 TTGCTCTGCTGGGACCTCCAGGG + Intergenic
916449040 1:164902159-164902181 TTGTTTTTCTAGGAGCTCAAAGG - Intergenic
917645746 1:177026933-177026955 TTGCTCTTTTGTCAGGTCCAAGG + Intronic
919849243 1:201661414-201661436 AGGCTCTTCTTGAAGCTCCAGGG - Intronic
919911726 1:202115260-202115282 TTCCTGATCTGGGAGCTCCAGGG + Intergenic
920502340 1:206493258-206493280 TAGCTCTTCCAGGAGCTGCAGGG - Exonic
922573540 1:226647369-226647391 TTGCTCTCCAGGGAGTTTCAAGG - Exonic
923508088 1:234624107-234624129 TTTCTCTTTAGGGGGCTCCAGGG + Intergenic
923634709 1:235683840-235683862 TTGCTATTCTGGCATCTCTAAGG - Intronic
1062925105 10:1310504-1310526 TTTCACTTCTGGGGCCTCCAGGG - Intronic
1063707061 10:8440791-8440813 GTGTTGTTCTGGGAACTCCAAGG + Intergenic
1065631788 10:27687725-27687747 TTGCTCCTCTGTGATCTCAAAGG + Intronic
1075098580 10:119490003-119490025 ATGCTTTTCTGGGAGGTCCCGGG - Intergenic
1075563343 10:123484404-123484426 CTGCTCATATGGGAGCCCCAGGG + Intergenic
1076221289 10:128734980-128735002 TGGCCCTGCTGGGTGCTCCATGG - Intergenic
1076647073 10:131961001-131961023 TTGCTGTGCTGGGATCGCCAAGG + Intergenic
1077256239 11:1584727-1584749 TGGTTCTTGTGGGGGCTCCAAGG - Exonic
1077256251 11:1584757-1584779 TGGCTCCTGTGGGTGCTCCAAGG - Exonic
1077256278 11:1584901-1584923 TGGCTCTTGTGGGGGATCCAAGG - Exonic
1077256290 11:1584931-1584953 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077256301 11:1584961-1584983 TGGCTCTTGTGGGGGATCCAAGG - Exonic
1077256321 11:1585021-1585043 TGGCTCTTCTGGGGGCTCCAAGG - Exonic
1077258041 11:1597965-1597987 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077258053 11:1597995-1598017 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077259471 11:1608163-1608185 TGGCTCTTGTGGGGGCTGCAAGG - Exonic
1077259482 11:1608193-1608215 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077261161 11:1621769-1621791 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077261183 11:1621829-1621851 TGGCTCTTGTGGGGGTTCCAAGG - Exonic
1077261195 11:1621859-1621881 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077274471 11:1697395-1697417 TGGCTCTTGTGGGGGCTCCAAGG + Exonic
1077274490 11:1697455-1697477 TGGCTCTTGTGGGGGCTCCAAGG + Exonic
1077415778 11:2423668-2423690 TTGCTGATGTGGGAGCGCCACGG - Intergenic
1077459056 11:2699737-2699759 GCGCTCTTCTGGGGGCTCCTCGG - Intronic
1078199500 11:9167441-9167463 ATGCTCTTCTTATAGCTCCAGGG + Intronic
1078473731 11:11612578-11612600 CTGCTCCTCTGGGATCTCAATGG + Intronic
1080008052 11:27430221-27430243 TTGTTCTTCTTGGATCTCGATGG - Intronic
1080141208 11:28922555-28922577 TTTCTCTGCTGGGATGTCCATGG - Intergenic
1080623701 11:34009158-34009180 CTGCTCCTCTGGGAGCTACCAGG - Intergenic
1080683193 11:34495015-34495037 TTCCTCTTCTGTGATCTCCTGGG - Intronic
1082916527 11:58444181-58444203 TTCCTTTTCTGGGGGCTCCACGG - Intergenic
1083197712 11:61099006-61099028 TTTCTCATCTGGGAGCACAAAGG + Intergenic
1083375900 11:62220887-62220909 TTGATGTACTGGGAACTCCAGGG - Intergenic
1083466458 11:62849921-62849943 TTGCTCTTCTGAGGGATGCAGGG + Intergenic
1084798790 11:71527471-71527493 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084798800 11:71527501-71527523 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084800121 11:71538205-71538227 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084800134 11:71538235-71538257 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084800145 11:71538265-71538287 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084801794 11:71548843-71548865 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084803894 11:71565779-71565801 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084803927 11:71565869-71565891 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084803939 11:71565899-71565921 TGGTTCTTGTGGGGGCTCCAAGG + Exonic
1084806463 11:71582615-71582637 TGGCTCTTGTGGGAGCTCCAAGG - Exonic
1086138677 11:83469730-83469752 TGGCCTTTCTGGGATCTCCATGG - Intronic
1089040738 11:115446909-115446931 TTGCTCATTTGGCAGCTCCCAGG - Intronic
1089046836 11:115508430-115508452 GTGCTCTTCTGGGGGCTGGAAGG - Intergenic
1089387626 11:118078606-118078628 CTCCTCTCCTGGGAGCCCCAGGG - Intronic
1089778044 11:120852798-120852820 TTGGACTTCTGGTGGCTCCAGGG + Intronic
1090310171 11:125729543-125729565 TTGCTCTTCTGTAAGAACCAGGG + Intergenic
1090610756 11:128468256-128468278 TTCCTTGTCTGGGAGCTGCAAGG + Intronic
1090754817 11:129780718-129780740 CCTCTCTTCTGGGTGCTCCAGGG + Intergenic
1090899062 11:131009552-131009574 TTATTCTTCTTGGAGCTCCTTGG + Intergenic
1091602799 12:1928225-1928247 TTGCTCTTCTGAGCTCCCCAAGG + Intergenic
1092309699 12:7339121-7339143 TTGCTCTTCTCTGGTCTCCAAGG + Intergenic
1096096081 12:48936638-48936660 TTGTTTTTTTGGGGGCTCCAGGG - Exonic
1097601430 12:61697595-61697617 TTTCTCTTCTGGATGCTCTAGGG - Intergenic
1100936175 12:99669587-99669609 TTGGCCTTGTGTGAGCTCCAGGG + Intronic
1100984259 12:100189578-100189600 TTGCAAGGCTGGGAGCTCCATGG - Intergenic
1104856926 12:131906648-131906670 TTGCTCTTATGGGGGGACCAGGG + Intronic
1105881726 13:24612030-24612052 TTTCTCTTTCTGGAGCTCCAGGG - Intergenic
1106366197 13:29083219-29083241 TTTCTCTTCTGTGAACTCCTTGG + Intronic
1106925698 13:34610662-34610684 GAGATCTTCTGGGAGCTCCAAGG - Intergenic
1107727735 13:43316938-43316960 TTTCTCTTCTGGGAACCCAAGGG - Intronic
1111997431 13:95178652-95178674 TTGCTCTTCTGTGAACACCTTGG - Intronic
1114201763 14:20527781-20527803 TTGCTCTGCTGGAAGCTGGAGGG - Intergenic
1115617068 14:35105701-35105723 TTGCTCTGCTGGAAGCTGGAAGG + Intronic
1115879527 14:37899503-37899525 CTGCTTTGCCGGGAGCTCCAGGG - Intronic
1116133344 14:40889430-40889452 TTGATCTTATGGGAGCTCAATGG + Intergenic
1119775257 14:77244232-77244254 TTGCTCTCCTGGAGGCTGCAAGG - Intronic
1121182519 14:91940164-91940186 GTGCTCTTCTGGAGGCTCTAAGG - Intronic
1121639556 14:95475941-95475963 TTGCCCAACTGGGAGCACCAGGG - Intergenic
1122083773 14:99285385-99285407 CTGCTTGTCTGGGAGCTCCTTGG + Intergenic
1122410225 14:101521941-101521963 ATTCTCTTCTGGGATCTCCCAGG - Intergenic
1123045003 14:105507694-105507716 TTCCTCTTCTGTGAGCTGCCTGG + Intergenic
1123768573 15:23506240-23506262 CCTCTCTTCTGGGTGCTCCAGGG + Intergenic
1123781674 15:23634410-23634432 TTGCTCGCCTGTGAACTCCAAGG - Intergenic
1124910581 15:33916114-33916136 ATAATCTCCTGGGAGCTCCAGGG + Intronic
1126342444 15:47656300-47656322 TTGTTCTTAGGGGAGCTACAGGG - Intronic
1127598812 15:60514462-60514484 ATGCTCCTCTGGCAGCTACATGG - Intronic
1127657451 15:61069687-61069709 TTGCTGTTTTTTGAGCTCCAAGG - Intronic
1127908086 15:63392072-63392094 GATCTCTTTTGGGAGCTCCAAGG - Intergenic
1129153418 15:73703168-73703190 TTGCTGTTCTGGGAGATTGAAGG - Intronic
1129747980 15:78038236-78038258 TTGCAAGGCTGGGAGCTCCATGG - Intronic
1131389829 15:92038052-92038074 CTGCTCTTCTGTGACCTTCATGG - Intronic
1132305985 15:100812810-100812832 TTTCACTTCTGGGAACGCCATGG + Intergenic
1132353392 15:101154510-101154532 AGGCCCTTCTGGGAGCTGCAAGG + Intergenic
1132404434 15:101533655-101533677 TGGCTCTTCCGGTACCTCCACGG + Intergenic
1132541867 16:513930-513952 TTTCTCGTCTGTGAGCGCCAGGG + Intronic
1138497040 16:57415255-57415277 TGGCCGTCCTGGGAGCTCCAGGG - Intronic
1139017180 16:62704253-62704275 ATTCTTTTCTGGAAGCTCCAAGG - Intergenic
1139958295 16:70703741-70703763 TTGCTCTTTTGAGAGCGCCTGGG - Intronic
1141843978 16:86594313-86594335 TTGCTCTTAATGGAGCTCGAAGG - Intergenic
1142995230 17:3756096-3756118 TTCCTCGTCTGTGAGCTCCTGGG + Intronic
1143862088 17:9898398-9898420 CTGGTCTGCAGGGAGCTCCAAGG - Intronic
1143891678 17:10107081-10107103 TGGTCCTTCTGGAAGCTCCAAGG - Intronic
1143914183 17:10276638-10276660 TTGCTCATTTGGGCTCTCCAGGG + Intergenic
1144686244 17:17228094-17228116 TGCCACTTCTGCGAGCTCCACGG - Exonic
1146286064 17:31574885-31574907 TTGCTCTTCTGGGCACTTCCTGG + Intronic
1146541569 17:33700397-33700419 TTGCTTTGCTGGAAGCTCTAGGG - Intronic
1149070551 17:52536816-52536838 TTTCTCTTCTACTAGCTCCAGGG + Intergenic
1150125219 17:62630675-62630697 AGGGGCTTCTGGGAGCTCCAGGG + Intronic
1150655289 17:67035150-67035172 TGTTTCTTCTGGAAGCTCCAGGG - Intergenic
1151223271 17:72629732-72629754 GTGCTTTTCTGGAGGCTCCAGGG + Intergenic
1151557798 17:74855308-74855330 TTGCTCTTCTGGGATGCCCTTGG - Intronic
1151668651 17:75559502-75559524 TTTCTCTGCTGGGAATTCCATGG + Intronic
1151817107 17:76476796-76476818 AGGCTCTCCTGGGGGCTCCAGGG + Intronic
1152375087 17:79914802-79914824 TGGCTGCTCTGGGAGCTCCCTGG - Intergenic
1152564808 17:81095599-81095621 ATGCTCATGTGGGGGCTCCAAGG + Intronic
1154032798 18:10767873-10767895 TTGCCCTCCTGGAGGCTCCACGG - Intronic
1155089794 18:22495489-22495511 TAGCTCTACTGGGGGCTTCAAGG + Intergenic
1156297705 18:35807985-35808007 TTGCTGTGCTGGGACCTCCAGGG - Intergenic
1157517374 18:48320594-48320616 CTGCTCTCCTGGGGGCTCCCAGG + Intronic
1160612847 18:80101992-80102014 TTGCTCGTCTGGGTGCAGCAGGG - Intergenic
1161095568 19:2388513-2388535 GGGCCCTTCTGGGGGCTCCAGGG - Intergenic
1163393612 19:17045883-17045905 TTGCACTTATGGGAGCCACAGGG - Intergenic
1163420714 19:17212204-17212226 ATCCTCTTCTAGGGGCTCCAGGG - Exonic
1163498851 19:17663492-17663514 TTGATGTTCTGGGAGTTACATGG - Intronic
1164106615 19:22112421-22112443 TCTCTCTTCTGGATGCTCCAGGG + Intergenic
1165002652 19:32778077-32778099 TTGTCACTCTGGGAGCTCCAGGG - Intronic
1167270024 19:48501325-48501347 GAGCTCCTCGGGGAGCTCCACGG - Exonic
926311064 2:11676706-11676728 ATTCCCTTCTGGGAGCTCTAGGG + Intergenic
926634419 2:15164907-15164929 ATTCTCTCCTGGAAGCTCCATGG - Intergenic
927081778 2:19637595-19637617 TTGATCTTCTGTGAGCTCCCTGG + Intergenic
928103769 2:28454317-28454339 TAGCTCTTCTGTCTGCTCCACGG + Intergenic
929675620 2:43924977-43924999 TTGGTTTTGAGGGAGCTCCAGGG - Intronic
930306077 2:49676215-49676237 TTGCTCAGTTGTGAGCTCCATGG - Intergenic
932124044 2:69127377-69127399 CTGCTCTTCTGTGAACACCAAGG - Intronic
933389536 2:81652600-81652622 TTGATGTACTGGGAACTCCAAGG + Intergenic
934026197 2:88003324-88003346 TGCCTCTTCTGGGAGCCCCGCGG - Intergenic
935081020 2:99794507-99794529 TTGTTCATCTAGTAGCTCCATGG + Intronic
935929240 2:108105563-108105585 TTGCTGTTCAGGGAACTGCAAGG - Intergenic
937146227 2:119647266-119647288 TAGCTCTTCCAGGAGCTCAAGGG + Intronic
937500368 2:122471915-122471937 CTGCTCTTCAGGGAAATCCAGGG + Intergenic
940352750 2:152707217-152707239 TTGATGTACTGGGAACTCCAGGG - Intronic
942097225 2:172545087-172545109 TTTCTCTTTTGGGTGCTTCAGGG - Intergenic
946962304 2:224997910-224997932 TTGGTCTTCTGGTAGCCCCCTGG - Intronic
1169269901 20:4191154-4191176 CTGCACTTCAGGGAGCTTCATGG + Intergenic
1169285837 20:4306391-4306413 TTTCTCTTCTGGGAGTACCTTGG - Intergenic
1169884818 20:10387468-10387490 TTCCTCTTCTGGGATTTCCCAGG - Intergenic
1172790159 20:37498314-37498336 TTTATCTTCTGTAAGCTCCATGG - Intronic
1172888678 20:38248371-38248393 TTTCTCTTCTGGAGGCTCTAGGG - Intronic
1174302488 20:49592657-49592679 TTCCTCTCCTGGGAGATCCAAGG + Intergenic
1174888695 20:54365508-54365530 TTACTCTTCTGGGGGTTTCATGG - Intergenic
1175418556 20:58817227-58817249 CTGCTAGACTGGGAGCTCCAGGG - Intergenic
1179310747 21:40193892-40193914 GTCCTATTCTAGGAGCTCCAAGG + Intronic
1179956553 21:44743119-44743141 CCTCTCTTCTGGGTGCTCCAGGG - Intergenic
1180842450 22:18965681-18965703 TTGCTCTTGTAGGAGCTCCCTGG - Intergenic
1181059036 22:20273175-20273197 TTGCTCTTGTAGGAGCTCCCTGG + Intronic
1181375748 22:22456688-22456710 CTGATGTGCTGGGAGCTCCAAGG - Intergenic
1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG + Intronic
1183026901 22:35072027-35072049 CTGCTCTGATGGGAGCTCCTGGG - Intronic
1184197194 22:42937773-42937795 TTGCTGTTCTCGGAGCTGCATGG - Intronic
1184647933 22:45906211-45906233 CTGCCCTCCTGGGAGCTCCGTGG - Intergenic
1184857290 22:47153423-47153445 TTCCTCTGCTTGGAGCACCATGG - Intronic
1184875688 22:47274027-47274049 TTGCTTTTCTGGAGCCTCCAGGG + Intergenic
1203293178 22_KI270736v1_random:15253-15275 TTTATCTTCTGGGAGTTCCGGGG - Intergenic
949413897 3:3796740-3796762 TTGCTCTCCTGGGAACTCTTGGG + Intronic
949523894 3:4884214-4884236 TTTGTCTTCTGGTAGCTTCAAGG + Intronic
949796024 3:7851859-7851881 TTGCTCTTCAGGTAACACCATGG + Intergenic
950015143 3:9749970-9749992 GTGTTCTTCTGGGTTCTCCAGGG - Exonic
950171787 3:10843908-10843930 ATGATCTCCTGGGAACTCCAAGG + Intronic
950853361 3:16083398-16083420 TTTCTCTTCTAGGAGATCCCTGG + Intergenic
951489225 3:23250075-23250097 ATGCTGTTCTGGGAGCTTTATGG + Intronic
952121165 3:30246066-30246088 TTCCTGAGCTGGGAGCTCCATGG - Intergenic
952463829 3:33559124-33559146 TCACTCTTTTTGGAGCTCCAAGG - Intronic
953351115 3:42216913-42216935 CTGCTCATTTGGGAGCTCAAAGG - Intronic
954223974 3:49171217-49171239 TTGGGCTCCTGGGAGCTCCGCGG + Intergenic
955910864 3:63859031-63859053 TGGCTCTTATGTAAGCTCCATGG + Intronic
957198150 3:77097720-77097742 TTGTTCTTCTGGGATCAGCATGG - Intronic
958067718 3:88565639-88565661 TTTCTCTTTTGGAGGCTCCAAGG + Intergenic
958433439 3:94069243-94069265 TTGCCCTTCTGTGAGATACAAGG + Intronic
963764044 3:149315450-149315472 GTGTTCTTCTGGCAGCTCTAGGG + Intergenic
964512438 3:157467589-157467611 CTGCATTTCTGGGACCTCCAGGG + Intronic
965561056 3:170062751-170062773 TTGCCCTTCCTGGAGCTCCTTGG - Intronic
966110646 3:176397145-176397167 TTGCTCTTATGGAATCTCCAGGG - Intergenic
966227023 3:177608773-177608795 GTACTCTTCTGGGAGCTAAAAGG + Intergenic
966775157 3:183537155-183537177 CTGCTCCTCTGGGAGATCCATGG + Intronic
968042756 3:195601519-195601541 TTGCTCCTTTGGGCCCTCCATGG + Intergenic
968271184 3:197404940-197404962 TGGCTCCTCTGGGATCTCCCTGG - Intergenic
968517031 4:1019702-1019724 TTCCTCTCCGGGGAGCTGCAGGG + Intronic
969315507 4:6379255-6379277 TGACTATGCTGGGAGCTCCACGG - Intronic
971263331 4:25076579-25076601 ATCCCCTTCTGGGAGCTCCCAGG + Intergenic
971352387 4:25865024-25865046 TTGGTCTTCGGGGAGCTAAATGG + Intronic
972296386 4:37743353-37743375 CTGGTCTTCTTGCAGCTCCAGGG - Intergenic
975075496 4:70202895-70202917 CTTCTCTTCTGGGAGCTCTGGGG - Exonic
975243773 4:72094404-72094426 ATAGTCTCCTGGGAGCTCCATGG - Intronic
975586740 4:75957551-75957573 TTCCTCTTCTGGGATTTCCCGGG + Exonic
977691837 4:99920034-99920056 TTGGTCTTCTGTGAGATCCTGGG + Intronic
977847289 4:101780885-101780907 TTTCACTTCTAGGAGCACCATGG + Intronic
982591679 4:157321572-157321594 TTGTTGTTGTGTGAGCTCCAGGG - Exonic
982891590 4:160859251-160859273 TTGCTCTTCAGGGTGCTATATGG + Intergenic
983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG + Intronic
985772523 5:1821825-1821847 TTGCTTTTCTTGGTGCTCCTGGG + Intergenic
986215084 5:5712635-5712657 TGGCTCTTCTGGGCCCCCCATGG - Intergenic
988589179 5:32534200-32534222 TTTTTTTTCTGGGAGCTCTAGGG + Intronic
991648124 5:68821871-68821893 TTGCTATTATGAAAGCTCCAAGG + Intergenic
991969598 5:72126243-72126265 CAGCTCTTCAGGGAGCACCATGG - Intronic
992294000 5:75309093-75309115 TTGTTTTTGTGGCAGCTCCATGG + Intergenic
992504670 5:77375254-77375276 TATCTCTTGAGGGAGCTCCAGGG + Intronic
993523407 5:88934090-88934112 GGGCTTGTCTGGGAGCTCCACGG - Intergenic
996549275 5:124712704-124712726 TTGTTCTTCTGGTAGCTGGAGGG - Intronic
997416450 5:133732347-133732369 TGTCTCTTCTGGGAGTTCTAGGG - Intergenic
997719290 5:136065138-136065160 TCCCACTTCTGGGAGCTCCTGGG - Intergenic
997894344 5:137702823-137702845 TTGCTCTTCTGGGCCCTCCGTGG - Intronic
1005869846 6:29966679-29966701 TTGATCTTCTAGGAGCTTTAGGG - Intergenic
1006652540 6:35563485-35563507 TTGATGTTCTGGGAATTCCAGGG + Intergenic
1008267295 6:49444193-49444215 TTGCTCTTCCGGTTGCTTCATGG + Intronic
1008431403 6:51421553-51421575 TTAATCTTTTGGGAACTCCATGG + Intergenic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1009885325 6:69617821-69617843 CTGCTCTTATGGGAATTCCAAGG + Intergenic
1010400801 6:75442903-75442925 TTGCTCTTCTGAGAACTCATTGG - Intronic
1011008170 6:82671949-82671971 ATGCTATGCTGGGAGCTGCAGGG - Intergenic
1011370881 6:86634962-86634984 TTGCTTTTCTTGGTTCTCCATGG + Intergenic
1014785287 6:125611719-125611741 TTGTGATTCTGGGAGCACCAGGG - Intergenic
1016357352 6:143232950-143232972 CTTCTGTTCTGGGAGCTCCCAGG + Intronic
1018546165 6:164938439-164938461 TTGGTGTTCTGTGAGCTCCCTGG - Intergenic
1018844205 6:167543833-167543855 TTGTTCTGCTGGAAGCCCCAGGG - Intergenic
1018967833 6:168502355-168502377 TTGCTCTTCTGCCATCGCCAAGG + Intronic
1019059381 6:169244697-169244719 GTGCTCTTCTGGGGGTTCCTGGG - Intronic
1019334227 7:475443-475465 GAACTCTTCTGGGAGCTTCAGGG + Intergenic
1019913832 7:4118002-4118024 TTTCTGTTCTGGGAGTTCCTGGG - Intronic
1020279937 7:6645008-6645030 TTGCTCTCCCTGGAGCACCATGG + Intronic
1020745360 7:12072660-12072682 TTGATGTACTGGGAACTCCAGGG - Intergenic
1021628754 7:22622973-22622995 TTGCTTTTTTGGCAGTTCCATGG + Intronic
1021813476 7:24425797-24425819 TTGCTAACCTGGGACCTCCATGG + Intergenic
1022505165 7:30905246-30905268 CTGATCTTCTGGGAGCTTCCGGG - Intergenic
1022712002 7:32860234-32860256 ATACTCTTCTGGGAAGTCCAAGG + Intergenic
1023202949 7:37718772-37718794 TTGCTCTTCTGAGATCACAAGGG + Intronic
1023292598 7:38684013-38684035 CTGCTCTTATGGAAACTCCATGG - Intergenic
1024434841 7:49339697-49339719 TTGCTCTTCCAGTTGCTCCAGGG - Intergenic
1024837805 7:53544318-53544340 TAGCTCTACTGAGATCTCCAAGG + Intergenic
1025195159 7:56926880-56926902 TTGCTTTTCGGGGAGCCCCTTGG + Intergenic
1025250768 7:57349954-57349976 ATGAACTTGTGGGAGCTCCATGG + Intergenic
1025637446 7:63335385-63335407 TGGCCCTTCTTGGAGGTCCAGGG + Intergenic
1025645251 7:63412714-63412736 TGGCCCTTCTTGGAGGTCCAGGG - Intergenic
1025676793 7:63650063-63650085 TTGCTTTTCGGGGAGCCCCTTGG - Intergenic
1026329438 7:69338962-69338984 CTGGTCTTCTGAGGGCTCCAGGG + Intergenic
1026613163 7:71878862-71878884 CTGCTCCTCTTGGAGCTCCACGG - Intronic
1026831499 7:73612989-73613011 TTGGTGTCCTGGGAGCTCCCTGG - Intronic
1031910420 7:127511231-127511253 TTTTTCTTCTGGAGGCTCCAGGG - Intergenic
1031949279 7:127875280-127875302 TTGCTCTTCTTGGATCTGTAGGG + Intronic
1032752948 7:134860292-134860314 TTGCTCTTTTCTGAGCTCAATGG - Intronic
1032773883 7:135090280-135090302 TTGCTCTGCTGGGCCCTCTAGGG - Intronic
1033277523 7:139983914-139983936 TTTCTCCACTGGCAGCTCCAAGG - Intronic
1035094857 7:156345949-156345971 GAGCTCTGCTGTGAGCTCCAGGG - Intergenic
1038303675 8:26379713-26379735 TTCCTCTTCTGGGATTTCCCGGG + Intergenic
1039560720 8:38510455-38510477 TTCCAGTGCTGGGAGCTCCAAGG + Intergenic
1039828253 8:41193105-41193127 TTGCCCTTCTGCGACCTCCTGGG - Intergenic
1040755208 8:50765057-50765079 CTTCTCTTCTGAGAGTTCCATGG - Intronic
1043153713 8:76751110-76751132 TTGATCTTCTGTGAATTCCAAGG - Intronic
1044847615 8:96397748-96397770 GGGCTGTTCTGGCAGCTCCAGGG - Intergenic
1047016318 8:120727277-120727299 TTTCTCTTCTGGGGTGTCCAAGG + Intronic
1047286729 8:123493689-123493711 GTTCCCTTCTGGGAGCTCTAGGG + Intergenic
1047521729 8:125600278-125600300 TTCCCCTTCTGGGAGCTCCATGG + Intergenic
1048464967 8:134657898-134657920 TTCATCTTCAGGGAGATCCAGGG + Intronic
1049247669 8:141571400-141571422 CTGCTCTGCTGGGTGCTGCATGG - Intergenic
1049268926 8:141683974-141683996 CTTCTCTCCTGGAAGCTCCAGGG + Intergenic
1049302246 8:141877732-141877754 TTGCTGCTTTGGGGGCTCCAGGG + Intergenic
1051033039 9:12706192-12706214 ATGCACTTCTGGGAACTACATGG + Intronic
1051938969 9:22481296-22481318 TTGCTCTTCAGGGAGGCACAGGG + Intergenic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1054858703 9:69927988-69928010 TTGATGTACTGGGAACTCCAGGG + Intergenic
1056600088 9:88040068-88040090 TTGATGTACTGGGAACTCCAGGG + Intergenic
1056943452 9:90974748-90974770 TGGCTTTTCTGGGAGAACCACGG + Intergenic
1056971860 9:91211515-91211537 TTGCTCTTATTCGGGCTCCAAGG - Intergenic
1057802273 9:98197780-98197802 TAGCCCTCCTGGGAGCCCCATGG + Intergenic
1058444981 9:105046860-105046882 TTGCTCTTTGGGGAGCTCCTTGG - Intergenic
1059374998 9:113875017-113875039 TTGCTCTTCTATGAGATGCAAGG - Intergenic
1061364594 9:130165318-130165340 TTGCTCTTCCAGGAAGTCCATGG - Intergenic
1061375702 9:130223089-130223111 CTCCTCCTCTGGGAGCTCCACGG - Exonic
1061385460 9:130286892-130286914 TTCCTCCTCTCGGGGCTCCATGG + Intronic
1062287610 9:135780046-135780068 GTGCCCTTCATGGAGCTCCAAGG - Intronic
1062421823 9:136486286-136486308 CTGCTCTGCTGGGGGCTCCCTGG - Intergenic
1062474101 9:136719086-136719108 TGGTCCTTCTAGGAGCTCCAGGG - Intronic
1185825178 X:3242840-3242862 TGGTTCTTCTGGATGCTCCATGG - Intergenic
1187472361 X:19580452-19580474 TTGCTCGACTGGGATCACCAAGG + Intronic
1191721470 X:64232025-64232047 CTGGTCTTCTGTGAGCTCCCTGG - Intergenic
1195388517 X:104336534-104336556 TTGGTTTTCTGAGAACTCCATGG + Intergenic
1195975021 X:110517228-110517250 TTGGTGTTCTTGGATCTCCAAGG - Intergenic
1198727122 X:139689812-139689834 TTTCTCTTCTGGTTGCCCCAGGG + Intronic
1199399276 X:147377357-147377379 TTGCTCTTCTCTGCTCTCCATGG + Intergenic
1199897014 X:152136070-152136092 TTCCTCTTTCAGGAGCTCCAGGG - Exonic