ID: 1182257220

View in Genome Browser
Species Human (GRCh38)
Location 22:29048086-29048108
Sequence CACACTCATGCCTCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182257220_1182257223 -1 Left 1182257220 22:29048086-29048108 CCCTGGGTGGAGGCATGAGTGTG 0: 1
1: 0
2: 0
3: 26
4: 325
Right 1182257223 22:29048108-29048130 GTTTGCCCTCCTCCAGCTACGGG 0: 1
1: 0
2: 0
3: 19
4: 169
1182257220_1182257222 -2 Left 1182257220 22:29048086-29048108 CCCTGGGTGGAGGCATGAGTGTG 0: 1
1: 0
2: 0
3: 26
4: 325
Right 1182257222 22:29048107-29048129 TGTTTGCCCTCCTCCAGCTACGG 0: 1
1: 1
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182257220 Original CRISPR CACACTCATGCCTCCACCCA GGG (reversed) Intronic
900954372 1:5877635-5877657 CCCACTAATGCCTTCACCCAGGG + Intronic
901628395 1:10636217-10636239 CACCCTCCTGCCTCCTCCCTCGG - Intergenic
902813832 1:18904794-18904816 CACCCTGATCCCTCCCCCCAGGG + Exonic
903262086 1:22136842-22136864 CACACTCATGCCTCGAAGCTTGG + Intronic
903668090 1:25020258-25020280 CACATGCATGCCTACACACATGG + Intergenic
904489976 1:30852710-30852732 CACAAACATGCCTTCACACAAGG + Intergenic
904590173 1:31609387-31609409 GACACTCCAGCCTCCACCCTGGG - Intergenic
904867259 1:33590262-33590284 CAGACTCATGCCACCACACCTGG + Intronic
905347192 1:37319167-37319189 CTCACTCAGGCCCTCACCCAGGG - Intergenic
905347222 1:37319326-37319348 CACACCCAGGCCCTCACCCAGGG - Intergenic
905347231 1:37319356-37319378 CACACCCAGGCCCTCACCCAGGG - Intergenic
905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG + Intergenic
906691166 1:47793524-47793546 CACCCTCATGCCGCCCTCCAGGG - Intronic
906845383 1:49185991-49186013 TACACTCCTGCCTCCATCCAGGG + Intronic
907179588 1:52557860-52557882 CTCACTGAAGCCTCCACCCCCGG - Intergenic
907706836 1:56839708-56839730 CACCCTCAAGCCTGGACCCATGG - Intergenic
909566472 1:77058408-77058430 CTCACTCATGCCCCGCCCCAGGG - Intronic
911061593 1:93752426-93752448 CAAATTCCTGCCCCCACCCACGG + Intronic
911249628 1:95559962-95559984 CTGACTTATGCCTCCACTCAGGG - Intergenic
911304980 1:96222685-96222707 CACACTCCTACCTCCATCCCTGG + Intergenic
912041891 1:105400735-105400757 CAGACTCATGCCACCACGCCCGG + Intergenic
915702090 1:157805750-157805772 CAAACTCATGCCACCACGCCTGG - Intronic
919468655 1:197952043-197952065 CAAACTCATGCATGCAGCCAGGG + Intergenic
922604174 1:226878945-226878967 CAGACTCCTGCCTGGACCCAGGG - Intronic
923030093 1:230242669-230242691 CACGCACAGGCCACCACCCACGG + Intronic
1062769048 10:85398-85420 CACTGTCGTGCTTCCACCCAAGG - Intergenic
1062961924 10:1578857-1578879 CACACTCATGCATTCTCCCTGGG + Intronic
1063313405 10:4978272-4978294 CACAGGGATGCCTCCTCCCAAGG - Exonic
1063314547 10:4989445-4989467 CACAGGGATGCCTCCTCCCAAGG + Exonic
1063355175 10:5392445-5392467 CAACTTCATGCCTCCAGCCAAGG + Intergenic
1065041887 10:21705665-21705687 CTCATTCACGCCTCCACCCTGGG + Intronic
1066570548 10:36766888-36766910 CACATACATGCCTGCACCGATGG - Intergenic
1067060445 10:43075594-43075616 CACACTCAGGCCTGTGCCCAGGG - Intergenic
1068415981 10:56723405-56723427 CACACTCAGGCATACACCTATGG + Intergenic
1069983353 10:72267729-72267751 CTCCTTCATGCCTCGACCCACGG + Intergenic
1070555623 10:77525587-77525609 CAAACTCATGGATCCACCCTGGG - Intronic
1070557149 10:77537400-77537422 CACATCCTTGCCCCCACCCAGGG + Intronic
1070764404 10:79048243-79048265 CACACCCATGCCCACACCCACGG + Intergenic
1070829977 10:79412153-79412175 CACACGCATGCATGCACACAGGG + Intronic
1075125140 10:119693459-119693481 CCCATTCACGCCTCCACCCAAGG + Intergenic
1075495321 10:122914724-122914746 CTCACTGAAGCCTCCACCCCAGG - Intergenic
1075568197 10:123519967-123519989 CACATTCCTGCCTGCACCCCTGG + Intergenic
1075670823 10:124263075-124263097 CACACTCATCCGTCCACCCCAGG + Intergenic
1076075573 10:127531235-127531257 CACACCCATGGAGCCACCCAAGG - Intergenic
1076135274 10:128041238-128041260 TGCACTCCTGCCTCCAGCCAAGG - Intronic
1077311382 11:1890404-1890426 CACACACCTCGCTCCACCCAGGG - Exonic
1078332055 11:10430621-10430643 CTCACTCATGTCACCATCCAAGG - Intronic
1078650332 11:13185208-13185230 CATACTGCTGCCTCCACCCCAGG - Intergenic
1079387995 11:19997888-19997910 CACACTCCTCCCTCCACCCCAGG + Intronic
1079836831 11:25346105-25346127 TACATGCATGCCTCCACCTATGG + Intergenic
1083580663 11:63823080-63823102 CTCACTCATGCCATCTCCCAGGG - Intronic
1084006691 11:66326934-66326956 CACACCCCTGCCCCCACCCTTGG + Intergenic
1085727317 11:78965321-78965343 CACATTCATGACTCCCCCTACGG + Intronic
1087845190 11:102964537-102964559 CACCCTCAAGCCTGGACCCATGG + Intergenic
1089155702 11:116400618-116400640 CACACTCATTCCTTCACACAGGG + Intergenic
1089608041 11:119653131-119653153 CACACCCATGTCACCACCCCCGG - Intronic
1089757253 11:120695958-120695980 CTCTCACATGCCTCCTCCCAGGG + Intronic
1091794061 12:3287343-3287365 CTCACGCCTGCCTCCACCCTGGG - Intergenic
1093645090 12:21576991-21577013 GACACTTATGACTCCACCTATGG + Intronic
1097094002 12:56530914-56530936 CACAGTCATGCCTTAACCCCAGG - Intronic
1097288935 12:57897746-57897768 CACACTCAGCCCTGCACTCAAGG - Intergenic
1098192076 12:67960120-67960142 CACACTCTTGCCTGCCGCCATGG - Intergenic
1098956694 12:76695971-76695993 CACAGGGATGCCTCCACCCCTGG + Intergenic
1101260481 12:103024665-103024687 CACATTCATGCCCCTTCCCAAGG - Intergenic
1102012165 12:109625561-109625583 CACCCTCCTGCCTCCCCACACGG + Intergenic
1103404003 12:120662145-120662167 CCCACGCATGCATCCATCCACGG + Intronic
1104128804 12:125873035-125873057 CTCTCTCCTCCCTCCACCCAGGG - Intergenic
1104482064 12:129116073-129116095 GAGACTCCTGCCTCCAGCCAGGG + Intronic
1104760685 12:131296160-131296182 GACACTCTTCCCTCCCCCCATGG + Intergenic
1104819090 12:131664632-131664654 GACACTCTTCCCTCCCCCCATGG - Intergenic
1104827958 12:131728161-131728183 CACACACATGCACGCACCCATGG - Intronic
1104833742 12:131773138-131773160 CACACTCAAGCCTGGACCCGTGG - Intronic
1104930270 12:132335512-132335534 CACACACATGCATGCACACACGG - Intergenic
1104955327 12:132462071-132462093 CACACTCACACCTGGACCCAAGG + Intergenic
1105973032 13:25448105-25448127 CACCCTCAAGCCTGGACCCATGG - Intronic
1108151727 13:47542841-47542863 CACTCTCAGGGCTCCACCCTTGG + Intergenic
1113443328 13:110346719-110346741 CACACCCATGTCTACACCCTGGG + Intronic
1117422492 14:55560526-55560548 CTCACTCTTGCTCCCACCCATGG - Intronic
1118593596 14:67419505-67419527 CAAAGGCATGCCTCCACGCAGGG + Intergenic
1118762638 14:68890104-68890126 CAGCCTCCTGCCTCCCCCCAGGG - Intronic
1120523223 14:85548770-85548792 CACCCTCAAGCCTGGACCCATGG + Intronic
1121202843 14:92133599-92133621 CAGGCTCATGCCACCACCCCTGG + Intronic
1121972987 14:98375884-98375906 CATAATGATGTCTCCACCCATGG - Intergenic
1122128044 14:99589843-99589865 TACACCCCTGCCTGCACCCAGGG + Intronic
1123414602 15:20086031-20086053 CCCAATCCTGCCTCCACCCCAGG + Intergenic
1123523944 15:21093142-21093164 CCCAATCCTGCCTCCACCCCAGG + Intergenic
1124398764 15:29330304-29330326 CACGCTCATGCCACCACTCCTGG - Intronic
1124597973 15:31106649-31106671 AACTCTCATGCATCCACTCAGGG - Intronic
1124900360 15:33816973-33816995 CACACTCATATCTGCTCCCAGGG - Intronic
1126111506 15:45177839-45177861 CAAACTCATCCCCCCTCCCAAGG + Intronic
1126866335 15:52941298-52941320 CACACGCATGCATCCACCTCAGG - Intergenic
1129509751 15:76112674-76112696 CACACTCATGGGGCCATCCAAGG + Intronic
1129692314 15:77720899-77720921 CTCCCTCATCCCTCCACCCACGG + Intronic
1129698924 15:77756513-77756535 CACACACATTCCTGCACACAAGG + Intronic
1130939959 15:88499066-88499088 GACACCCCTGCCTCCACCCCAGG + Intergenic
1131066140 15:89436035-89436057 CACACTCAATCCACCACCCCAGG - Intergenic
1132018633 15:98340761-98340783 GGCACTCATGCCTCCACCGCTGG - Intergenic
1133675728 16:8069638-8069660 TACAGGCATGCCACCACCCACGG - Intergenic
1134506331 16:14810518-14810540 CACACTCCAGCCTCCAGCCTGGG + Intronic
1134574221 16:15318245-15318267 CACACTCCAGCCTCCAGCCTGGG - Intergenic
1134728199 16:16438052-16438074 CACACTCCAGCCTCCAGCCTGGG + Intergenic
1134857465 16:17532304-17532326 CACACTTATGCCCCCAAGCAGGG - Intergenic
1134939240 16:18273774-18273796 CACACTCCAGCCTCCAGCCTGGG - Intergenic
1137669723 16:50272092-50272114 CCCATTCTTGCCTCCTCCCAGGG + Intronic
1138101477 16:54255341-54255363 CACACTCACCCCTCCGCCCTAGG - Intronic
1138376553 16:56568348-56568370 CACCCTCAATCCTCCAGCCATGG + Intronic
1138654922 16:58485607-58485629 CACACTCACCCATCCATCCAGGG - Intronic
1140443714 16:75006836-75006858 CACACTCAAGACTGAACCCATGG - Intronic
1140982572 16:80125135-80125157 GCCAGTCCTGCCTCCACCCAAGG + Intergenic
1142568390 17:855764-855786 CACACACATTCCTCCTGCCAAGG - Intronic
1143487003 17:7260831-7260853 GAAAATTATGCCTCCACCCATGG + Exonic
1143699256 17:8645992-8646014 CTCTCTGATGCCTCCACCTATGG - Intergenic
1143729767 17:8874442-8874464 CCCAGTCATGCCTCCCCCCGGGG - Intergenic
1144737677 17:17564095-17564117 CCCACCCATGCCTCCGCCCTGGG - Intronic
1145223397 17:21107473-21107495 TACACTCTTGTCTCCACACACGG - Intergenic
1145836042 17:27955054-27955076 CCCACCCATCCCTCCACCCTTGG - Intergenic
1148107825 17:45128623-45128645 CCCACTCAGGCCTCTGCCCATGG + Intronic
1148628668 17:49089914-49089936 CACACTAATGCCTTTTCCCATGG - Intergenic
1150207964 17:63423270-63423292 CTATCTCATGCCCCCACCCAGGG - Exonic
1150706501 17:67491786-67491808 CACACTACTGCCTCCAGCCTGGG + Intronic
1150738833 17:67763128-67763150 CACACACATGCCACCACACCTGG - Intergenic
1151498433 17:74473575-74473597 CACACTCAGGGATCCCCCCACGG - Exonic
1151508630 17:74544886-74544908 CACACTCAGGGATCCCCCCACGG + Exonic
1151702905 17:75752864-75752886 GACACTCAGGCCACCCCCCAGGG + Intronic
1153811170 18:8753137-8753159 CACATTCATACCTGGACCCAGGG + Intronic
1154248742 18:12724270-12724292 CACAATCATGCCTCACCCCATGG - Intronic
1154937192 18:21073022-21073044 CAAAATCATGCCTCCAGCCTGGG + Intronic
1155176983 18:23309368-23309390 CACCCTCACTCCTCCACCCCAGG - Intronic
1156503633 18:37575496-37575518 CACCCTCATTCCTCCCCACAAGG - Intergenic
1157402533 18:47400468-47400490 CACAATCATCCTCCCACCCAGGG + Intergenic
1157402586 18:47400678-47400700 CACAATCATCCTCCCACCCAGGG + Intergenic
1157402640 18:47400887-47400909 CACAATCATCCTCCCACCCAGGG + Intergenic
1157402662 18:47400971-47400993 CACAATCATCCTCCCACCCAGGG + Intergenic
1157402703 18:47401137-47401159 CACAATCATCCTTCTACCCAGGG + Intergenic
1157402766 18:47401387-47401409 CACAATCATCCTCCCACCCAGGG + Intergenic
1157402788 18:47401471-47401493 CACAATCATCCTCCCACCCAGGG + Intergenic
1157402809 18:47401552-47401574 CACAATCATCCTCCCACCCAGGG + Intergenic
1157402906 18:47401928-47401950 CACAATCATCCTCCCACCCAGGG + Intergenic
1157403127 18:47402766-47402788 CACAATCATCCTTCTACCCAGGG + Intergenic
1157608298 18:48939922-48939944 CACACCCAGGCCACCCCCCATGG + Intronic
1157880751 18:51318967-51318989 CACAGTCATGCCTCCTCTGAAGG - Intergenic
1158212277 18:55064986-55065008 CACTCTCCTCCCTCTACCCAAGG - Intergenic
1159815800 18:73072538-73072560 CTTGCTCATGCCTCCACTCAGGG - Intergenic
1160127415 18:76189317-76189339 CACCCTCAGGCCTGGACCCATGG + Intergenic
1160982005 19:1820477-1820499 CTCACTCTTGCCTCCAGCCATGG - Intronic
1161285646 19:3467071-3467093 AACACTCCCTCCTCCACCCAGGG - Intronic
1162063103 19:8108749-8108771 CTCACTCAAGCCTCCTCCCCTGG + Intronic
1162244483 19:9388451-9388473 CAGACACATGCCACCACACATGG + Intergenic
1162476087 19:10900167-10900189 CACGCACATGCCACCACCCCTGG - Intronic
1162895126 19:13760842-13760864 CTCACTGAAGCCTCCACCCCAGG + Intronic
1162906168 19:13825453-13825475 CACACAGATCCTTCCACCCAGGG - Intronic
1163548339 19:17952031-17952053 CACTCTCCCCCCTCCACCCAGGG - Intronic
1164389021 19:27801868-27801890 CACTCTCTTGTCTCCACACATGG - Intergenic
1164645801 19:29858215-29858237 CACCCTCCTTCCTCCACCCCCGG + Intergenic
1165165261 19:33849515-33849537 CACACTCATGCCTTGGCCCCCGG - Intergenic
1165178639 19:33948801-33948823 CACACTCCTGCATCCTCCTAAGG + Intergenic
1165765357 19:38347066-38347088 CAGACTCATGCCACCACCCCTGG - Intronic
1165955207 19:39498138-39498160 CACACACACGCCTGCACACAGGG + Intergenic
1166007153 19:39915669-39915691 CACACGCAGCCCTCCACGCAGGG + Exonic
1166129550 19:40737786-40737808 GACACCCATACATCCACCCATGG - Intronic
1167884508 19:52489124-52489146 CAGACGCATGCCACCACCCTCGG - Intronic
1167889926 19:52531004-52531026 CAGACGCATGCCACCACCCTTGG - Intronic
1167908115 19:52678929-52678951 CACACAACTGCCTCCACCCTGGG + Intronic
1168326919 19:55543223-55543245 CCCACCCATCCATCCACCCATGG + Intronic
926077515 2:9952399-9952421 CCCACTCATGCCGCCAGCCAGGG - Intronic
926297679 2:11580462-11580484 CACACTTCTGCCTACACACAAGG - Intronic
926468401 2:13220702-13220724 CACACTCATGCACCCACACACGG + Intergenic
927336954 2:21936242-21936264 CACACACATACCCCCACACAGGG + Intergenic
927647104 2:24884874-24884896 CACATTCAAAGCTCCACCCACGG + Intronic
927693952 2:25227667-25227689 CAAACTCTTTCCTGCACCCAGGG + Intergenic
928155735 2:28874618-28874640 CAAGCTCATGCCACCACCCCTGG + Intergenic
929458845 2:42086350-42086372 AACACCCATGCCTCCCTCCATGG - Intergenic
930364202 2:50418334-50418356 CAGACTCATTCCTCAACACATGG + Intronic
930798622 2:55419712-55419734 CACATTCAAGCCCCCACCCCCGG - Intronic
930804444 2:55476281-55476303 CAGACTCATGCCACCACACCTGG + Intergenic
931418523 2:62103981-62104003 CACACACATGCCACCACACTCGG + Intronic
933140948 2:78792523-78792545 CACCCTCAGGCCTGCACCCGTGG - Intergenic
933250688 2:80025263-80025285 CACCCTCAAGCCTGGACCCATGG - Intronic
933462853 2:82611860-82611882 CACACTCAAGCCTGGACCCACGG + Intergenic
933630181 2:84646988-84647010 CAGGCACATGCCACCACCCATGG + Intronic
935701523 2:105816163-105816185 CACAGGCATGCCACCACCCCTGG - Intronic
936112391 2:109675852-109675874 CACACTCCTGTCCCCACCCCAGG + Intergenic
937294272 2:120800198-120800220 CACACCCTTGCATCCACCCGGGG - Intronic
937977279 2:127589538-127589560 CCCACTCACCCATCCACCCATGG - Intronic
937986767 2:127641517-127641539 CCCACCCAAGCCGCCACCCAAGG + Intronic
939776186 2:146390948-146390970 CACCCTCAAGCCTGTACCCATGG - Intergenic
940394190 2:153168531-153168553 CACACACACCCCTCCACACACGG - Intergenic
942105447 2:172629231-172629253 CACCCTCAAGCCTAGACCCATGG + Intergenic
943754496 2:191543840-191543862 CACACTAATGCCCCAAGCCAAGG - Intergenic
948399046 2:237669714-237669736 CACAGTGATGCCTCCACCCCGGG + Intronic
948917084 2:241039829-241039851 CACACCCATCCCTCCATCCCAGG + Intronic
949077672 2:242071388-242071410 CACACTGAGGCTTCAACCCAGGG + Intergenic
1168851137 20:977935-977957 CCCACTCAGGCCTCCACATATGG + Intronic
1169078313 20:2776794-2776816 CAGACTCGTGCCACCACCCCTGG + Intergenic
1169128811 20:3151960-3151982 CACGCTCATGCCACCACACCTGG - Intronic
1169973882 20:11301906-11301928 CTCTCTCTTCCCTCCACCCAGGG - Intergenic
1172302474 20:33859880-33859902 CACACACATACCTCCTCCCCAGG + Intergenic
1173255031 20:41388133-41388155 CAGACACATGCCACCACCCCTGG - Intergenic
1175283978 20:57824946-57824968 CACCCACATGCCACCAACCAGGG - Intergenic
1175400376 20:58696762-58696784 CACACTCCTGCCTCAGCGCAGGG - Intronic
1175693834 20:61086290-61086312 CAGAAGCATGCCACCACCCATGG + Intergenic
1175702415 20:61149452-61149474 CACCCTCCTGCCTCTTCCCAGGG + Intergenic
1177903785 21:26950444-26950466 CACATTCCTGCCTCCACTCGAGG + Intronic
1180934939 22:19619256-19619278 CAGACTCATGCTTTCATCCAGGG - Intergenic
1181048071 22:20225886-20225908 CACACACATGCATGCACACATGG + Intergenic
1181264207 22:21620937-21620959 CACTCTCATGCATGCACACAGGG - Intronic
1182255352 22:29033748-29033770 CTCCCCCATTCCTCCACCCATGG - Intronic
1182257220 22:29048086-29048108 CACACTCATGCCTCCACCCAGGG - Intronic
1182522322 22:30891517-30891539 CACACTCATGCCAGGAGCCAGGG - Intronic
1183323439 22:37178702-37178724 TGCACACATTCCTCCACCCAGGG - Intergenic
1183472845 22:38018824-38018846 CACACACTGGCCTCCTCCCATGG - Intronic
1184205300 22:42998702-42998724 CACCCTCAAGCCTGGACCCAAGG + Intronic
1184707718 22:46225852-46225874 CACACACATGCACCCACACATGG + Intronic
1185038546 22:48491829-48491851 CACACTCATCCCTCCTCCTTAGG + Intronic
949901345 3:8817280-8817302 CAGGATCATGCCTCCACCCCTGG + Intronic
950092046 3:10302789-10302811 TACACTTATTCCTCCACCAAAGG - Intronic
951122952 3:18949823-18949845 CACATTCTTGCCTCCATCCTAGG + Intergenic
951682244 3:25306899-25306921 CACACCCATGACTCCCACCAAGG - Intronic
952583248 3:34860463-34860485 CACACACATACATCCCCCCATGG - Intergenic
952713628 3:36456080-36456102 CACACTCCTGCCTCCAGTCAGGG + Intronic
953241558 3:41154067-41154089 GACACTGATGCCTAGACCCATGG + Intergenic
953294214 3:41696616-41696638 CAATCTCTTGCCTCCACACACGG + Intronic
954363042 3:50132608-50132630 CAGGCTCATGACTCCACCCCAGG + Intergenic
955856581 3:63278926-63278948 CACACTCCCGCCTCCAAGCAGGG - Intronic
955971761 3:64444588-64444610 CACACGCATGTCTCCACCACGGG + Intronic
957153077 3:76511583-76511605 CACACTCATGCCTCTGTTCACGG - Intronic
957410271 3:79830897-79830919 CACCCTCAAGCCTGGACCCATGG - Intergenic
958023905 3:88028147-88028169 CACCCTCAAGCCTGGACCCATGG + Intergenic
959817746 3:110694885-110694907 CACATTCATGCCACCACTCTCGG + Intergenic
960639155 3:119810255-119810277 CACAAGCATGCCCACACCCACGG - Intronic
961094469 3:124142658-124142680 CACACACAGGCCTCTCCCCACGG - Intronic
962682148 3:137811379-137811401 GGACCTCATGCCTCCACCCAGGG + Intergenic
964468684 3:157027670-157027692 CAGACTCATGCCACCACCCCTGG - Intronic
965300878 3:167002847-167002869 CACCCTCAAGCCTGGACCCACGG - Intergenic
966125204 3:176568325-176568347 CGCATTCATGGCTCAACCCATGG - Intergenic
966185357 3:177222001-177222023 CACACTTCTCCCTCCTCCCAGGG + Intergenic
966516621 3:180828179-180828201 CACAGCCATGCCATCACCCAGGG - Intronic
967790242 3:193540863-193540885 CACAATGATGCCGTCACCCACGG - Intronic
968309737 3:197673613-197673635 CACACACATGGCCCCACCCAAGG + Intronic
969174131 4:5385990-5386012 CCCACCCATGGCCCCACCCACGG + Intronic
969901913 4:10357902-10357924 CATACTCATTTCTTCACCCAAGG - Intergenic
971887650 4:32473720-32473742 CACACTCAGGCCTGTGCCCAGGG - Intergenic
971994167 4:33942734-33942756 CCCACTCTTGCCAACACCCAGGG - Intergenic
975473376 4:74794638-74794660 CACACCCATACCCACACCCAGGG + Exonic
975664681 4:76723342-76723364 CAAACTCATTCCTCCTCTCAAGG + Intronic
977294428 4:95194804-95194826 AACACCCCTGCCCCCACCCAAGG - Intronic
977721543 4:100244978-100245000 CACCCTCAAGCCTGGACCCATGG - Intergenic
979598414 4:122559471-122559493 CAGACTCCTGCCACCACCCCTGG + Intergenic
981597714 4:146446048-146446070 CACCCTCAAGCCTGGACCCACGG - Intronic
983207122 4:164922172-164922194 CAGACGCATGCCACCACACATGG + Intergenic
983717615 4:170804955-170804977 CACCCTCAGGCCTGTACCCATGG + Intergenic
983859965 4:172693634-172693656 CGCACTCAAGGCTCCACCTATGG + Intronic
984386010 4:179059460-179059482 CACACTCTTCCCTCCATGCAAGG - Intergenic
984747864 4:183240661-183240683 GACAGACACGCCTCCACCCAAGG - Intronic
984759861 4:183354268-183354290 CACACTCATGTCTGCATCCTAGG - Intergenic
984984134 4:185311017-185311039 CACACACATGCACACACCCAAGG - Intronic
985113181 4:186566823-186566845 GACACACACGCATCCACCCAAGG - Intergenic
986109258 5:4695025-4695047 CCCACACCTGCCTCCACCCTTGG - Intergenic
988708117 5:33745256-33745278 CCTCCTCCTGCCTCCACCCAAGG + Intronic
989618154 5:43357896-43357918 GACACTCCCACCTCCACCCAGGG + Intergenic
990728747 5:58785647-58785669 CAAAATAATGCCTCCACACAAGG + Intronic
991356523 5:65774865-65774887 CACACACATGCCACCACACCCGG + Intronic
992193887 5:74320727-74320749 CTCACTCATGCCTCCACTCCAGG - Intergenic
993301689 5:86219542-86219564 CAGGCTCATGCCACCACCCCTGG - Intergenic
993308505 5:86298704-86298726 CATACTCCTGCCCCCAACCAGGG - Intergenic
994026454 5:95089978-95090000 CACACTCAGGCCTCTCCCCAGGG + Intronic
994536606 5:101039039-101039061 CATGCTCATGCCACCACCCCCGG + Intergenic
997266830 5:132499756-132499778 CACACTCATGCCCCAGCCCATGG - Intergenic
997350487 5:133227453-133227475 CCCACTCCTCCCTCTACCCAAGG - Intronic
999658150 5:153830551-153830573 CACACACATGCCACCACGCCTGG + Intergenic
1001649110 5:173302596-173302618 CACAGTCTAGCCTCCAGCCATGG - Intergenic
1001993418 5:176135056-176135078 CACCCTCACGCCTATACCCAGGG + Intergenic
1002001028 5:176196357-176196379 CACACTCAGGCCTATGCCCAGGG + Intergenic
1002253307 5:177942615-177942637 CACACTCAGGCCTATGCCCAGGG - Intergenic
1002694252 5:181073620-181073642 AAATCTCATGCCTCCAGCCAGGG + Intergenic
1003192111 6:3883406-3883428 CACACACATGCCACCACGCCTGG + Intergenic
1003243778 6:4367397-4367419 CACACTCACACGTCTACCCACGG + Intergenic
1003594416 6:7461595-7461617 CACACTCAAGCCTCCATTCCTGG - Intergenic
1004005500 6:11634072-11634094 CACACTCCTGACCCCACCCCAGG + Intergenic
1004064420 6:12228868-12228890 CACCCTCCTCCCTCCTCCCAAGG - Intergenic
1004467484 6:15899412-15899434 CACACTACTGCCTCCAGCCTGGG + Intergenic
1007852450 6:44817119-44817141 CACACACATGCCCACACACACGG + Intronic
1011167416 6:84464524-84464546 CACACTCATGCCCCAACAAAAGG + Intergenic
1011289862 6:85765791-85765813 AAAACTCATGCCACCACACAGGG - Intergenic
1011645144 6:89450559-89450581 CACACTGCTGCCTCCAGCCTGGG - Intronic
1013758325 6:113486519-113486541 CCCACACATGCCTAAACCCATGG + Intergenic
1015168379 6:130224351-130224373 CACCCTCAGGCCTGTACCCATGG - Intronic
1015905427 6:138111827-138111849 CAAACCCATGCCTTCACCCAAGG - Intergenic
1017649811 6:156570543-156570565 CAGACTCCTGCCTCTACTCAGGG - Intergenic
1018092321 6:160355870-160355892 CCCACTGCTGCCTCTACCCAGGG + Intronic
1018231783 6:161682493-161682515 CTCACTCCTGCCTCTGCCCAGGG - Intronic
1020358918 7:7306172-7306194 CACACTCAGGCCTCCTTCTAAGG - Intergenic
1020381746 7:7555385-7555407 CAAAATCATGCCTCCTCCAAGGG + Intergenic
1021481141 7:21118576-21118598 CACGGTGATGCCTCAACCCAGGG + Intergenic
1021486664 7:21175565-21175587 CTCTCTCATTCATCCACCCAGGG + Intergenic
1022130082 7:27396985-27397007 CACACTCCTGTCCCCACTCATGG + Intergenic
1023428329 7:40063295-40063317 CATACACATGCACCCACCCAGGG - Intronic
1023943395 7:44784714-44784736 CTCACTCATGCCCCTCCCCAGGG + Intergenic
1024540695 7:50473210-50473232 GACACTTGTGCCTGCACCCAAGG + Intronic
1026014552 7:66662773-66662795 CACACACATGCGTGCACACACGG - Intronic
1027054127 7:75038573-75038595 GGCACTCCTGCCCCCACCCATGG - Intronic
1027816833 7:82984733-82984755 CACAGTCATGCCTCTATCCCTGG + Intronic
1029264885 7:99330757-99330779 CACATTTCAGCCTCCACCCAAGG + Intronic
1030746074 7:113167739-113167761 CACAATCTTGCTACCACCCAGGG + Intergenic
1032023082 7:128421033-128421055 CCCACTCCTGCCTCCAGCCCAGG + Intergenic
1033294382 7:140117458-140117480 CACACACACGCCTCTACCCTTGG - Intronic
1034390553 7:150784294-150784316 CACACTAAAACCTCCACCCGGGG + Intergenic
1035226161 7:157433715-157433737 TACACTCATGCATGCACACACGG + Intergenic
1035536208 8:393184-393206 CACACTGAGGCTTCAACCCAGGG + Intergenic
1036284036 8:7427955-7427977 CCCACTCATGGCTCCACGTATGG - Intergenic
1036284389 8:7430868-7430890 CAAACGCATACCTCCACACATGG + Intergenic
1036337087 8:7880662-7880684 CAAACGCATGCCTCCACACATGG - Intergenic
1036466737 8:9004588-9004610 CTCACTGCAGCCTCCACCCATGG - Intronic
1037127606 8:15369869-15369891 CAGGCTCATGCCACCACGCACGG + Intergenic
1038328407 8:26589434-26589456 CTCACTCATTCATTCACCCATGG - Intronic
1039135407 8:34317032-34317054 CAGAATAATGCCTCCACCCCTGG - Intergenic
1040741680 8:50583356-50583378 CACACTACTGCCTCCAGCCTGGG + Intronic
1042567253 8:70124607-70124629 CACCTTCATGCCTGCACCCGAGG - Intronic
1043514199 8:80981147-80981169 CACCCTCATGGCTGCACCCCAGG + Intronic
1044973036 8:97638370-97638392 CAAAGTCATGCCTCCTTCCAGGG - Intergenic
1045165002 8:99593901-99593923 CTCCCTCACCCCTCCACCCATGG - Intronic
1045702937 8:104887650-104887672 TAAACTCATGACTCAACCCAAGG - Intronic
1046719125 8:117599188-117599210 CACAATCATGCCTGCCACCATGG + Intergenic
1049112118 8:140653104-140653126 CTCACTGAAGCCTCCACCCCTGG + Intergenic
1049537317 8:143188440-143188462 CTCACCCCTGCCTCCACTCAGGG + Intergenic
1049960675 9:735064-735086 CTCACAGATGCCTCCACCCCAGG - Intronic
1050024413 9:1319310-1319332 CTCACTCCTGCCCTCACCCAAGG - Intergenic
1050059212 9:1687712-1687734 CACCCTCAAGCCTAGACCCATGG - Intergenic
1051575587 9:18611863-18611885 CACACTCCCACCTCCACCAAAGG - Intronic
1052788250 9:32850112-32850134 CAGACACATGCCACCACCCCTGG + Intergenic
1058525036 9:105849362-105849384 TACACACATGGCTCCAGCCAGGG + Intergenic
1058818806 9:108710240-108710262 CACACTCAAGCCTGTAGCCATGG + Intergenic
1059666700 9:116453129-116453151 CACTCCCACCCCTCCACCCATGG - Intronic
1061824372 9:133248676-133248698 CAAACACATGCTTCCATCCAGGG - Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1062187102 9:135224006-135224028 CACCCTGATGGCTCCACCCCGGG + Intergenic
1062218814 9:135403478-135403500 CACACTCTTGGCTGGACCCAGGG + Intergenic
1062320214 9:135986944-135986966 CACCCCCATGTCTCCAGCCAGGG - Intergenic
1062644169 9:137538294-137538316 CCCACCCACGCCTCCACCCCAGG + Intronic
1186158391 X:6750112-6750134 CACAGTCAAGGCTACACCCAGGG + Intergenic
1187994746 X:24913883-24913905 CACACGCATGCCACCACGCCTGG - Intronic
1188355443 X:29184641-29184663 CAGGCTCATGCCACCACACATGG + Intronic
1188437514 X:30179381-30179403 CACTCTCAAGCCTGGACCCATGG + Intergenic
1188526609 X:31094392-31094414 CACCCTCAAGCCTGGACCCATGG - Intergenic
1189147171 X:38667048-38667070 CACACACATGCATCCATGCATGG - Intronic
1190145041 X:47882945-47882967 CACACCACTGCCTCCAGCCAGGG + Intronic
1191126698 X:56963206-56963228 CAGGCACATGCCTCCACCCCCGG - Intergenic
1191626780 X:63278575-63278597 TACACACATGCCTCCATGCAAGG + Intergenic
1194015397 X:88613216-88613238 CACATTCCTGCCTCAACCCACGG + Intergenic
1197336786 X:125218975-125218997 CACACTCATGGCTACACCGAAGG + Intergenic
1197711958 X:129678085-129678107 CACCCTCATGCCTCCTCCCGGGG + Intergenic
1198850441 X:140960809-140960831 TAACCTCATGCCTCCTCCCAAGG - Intergenic