ID: 1182262141

View in Genome Browser
Species Human (GRCh38)
Location 22:29081142-29081164
Sequence AACAGTAAAAAGAAGGACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 478}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182262141_1182262146 -8 Left 1182262141 22:29081142-29081164 CCCCCGTCCTTCTTTTTACTGTT 0: 1
1: 0
2: 0
3: 36
4: 478
Right 1182262146 22:29081157-29081179 TTACTGTTAGTTGCCTGCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182262141 Original CRISPR AACAGTAAAAAGAAGGACGG GGG (reversed) Intronic
902095508 1:13941217-13941239 AACAATAAAAAGGAGTAGGGGGG + Intergenic
902520650 1:17013863-17013885 AGCAATAAAAAGAATGAAGGGGG - Intergenic
903004919 1:20292193-20292215 AAAAAAAAAAAGAAGGAAGGAGG - Intronic
903524448 1:23982473-23982495 AAAATTAAAAACAAGGCCGGGGG - Intergenic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
903959221 1:27046256-27046278 AAAAAAAAAAAGAAGGAAGGAGG - Intergenic
904065458 1:27746740-27746762 AACAATAAAAAGAATCACTGGGG + Intronic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
907255284 1:53174166-53174188 AACAGGACAAAGAAGGCAGGAGG + Intergenic
907519646 1:55014880-55014902 AACAGTAGAATGAAGGAGTGAGG + Intergenic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
909602740 1:77477967-77477989 AACGGTTTAAGGAAGGACGGTGG + Intronic
909606236 1:77511401-77511423 AACAGGATAAAGAAGGATGGAGG + Intronic
910321470 1:85949894-85949916 TACAGTAAAAGGGAGGAGGGAGG - Intronic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
910909004 1:92214366-92214388 GACAGTTAAAAGAAGCAAGGAGG + Intergenic
910997795 1:93127805-93127827 AAAAGTAAAAATAAGGTAGGGGG - Intronic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911122745 1:94312423-94312445 AAAAAAAAAAAGAAGGAGGGGGG - Intergenic
912039339 1:105367648-105367670 AACAGTAAAAAGTAGAAGAGAGG + Intergenic
912276000 1:108259544-108259566 AACAGGTAAAAGAAGGAAGAAGG - Intergenic
912292228 1:108434815-108434837 AACAGGTAAAAGAAGGAAGAAGG + Intronic
912611161 1:111045936-111045958 AACAGAAAAAAGAAACACAGTGG - Intergenic
913271069 1:117094232-117094254 ATCAGTGAAAAGAAGGACTTAGG - Intronic
913352609 1:117878323-117878345 AACATTAAAAAGAAGAAACGAGG + Intronic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914383721 1:147146693-147146715 AACAGGTAAAAGAAGGAAGAAGG - Intergenic
916192203 1:162190789-162190811 AAAAGTAAAAAGCAGAACAGCGG - Intronic
916572886 1:166042460-166042482 AAAAGAAAAAAGAAGAACAGAGG - Intergenic
916867854 1:168879560-168879582 AACAGGAAAAAAAATGAAGGTGG - Intergenic
917049352 1:170901896-170901918 AACAGAAAAAAGATGGTAGGAGG - Intergenic
917249787 1:173045922-173045944 AAGAGAAAATAGAAGTACGGAGG - Intronic
917601568 1:176579271-176579293 AACAGGAAAAAGGAGGAAGTGGG + Intronic
917616643 1:176752642-176752664 AACAGTAAACTGAAGAACAGAGG - Intronic
918054990 1:181013310-181013332 AACAGGAAAAAGGATGATGGGGG - Intronic
918685180 1:187405961-187405983 AACACTAAAAAGAAGGCAGAAGG - Intergenic
918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG + Intergenic
918930343 1:190847220-190847242 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919100603 1:193092912-193092934 AAATGTAAAAATAAGGACTGAGG + Intergenic
919251670 1:195064808-195064830 AAAAGTAAAAAGATGGACAAAGG - Intergenic
919990068 1:202703384-202703406 GGGAGTAAAAAGAAGGGCGGGGG + Intronic
921274205 1:213501947-213501969 AACAGGAAATGGAAGGATGGAGG - Intergenic
921567553 1:216738203-216738225 AACATTAAAAAGAAGGAAAAAGG + Intronic
924468972 1:244322933-244322955 AGCAGTAGCAAGACGGACGGTGG + Intergenic
924748971 1:246867810-246867832 AACTGTAAAATGAAGAACGCTGG + Exonic
1062922890 10:1293193-1293215 AATAGAAAAAAGAGGGAGGGAGG + Intronic
1063440801 10:6071449-6071471 AACAAAAAAAAGAAAGAAGGAGG - Intergenic
1063668457 10:8080743-8080765 AACAGTAAGAAGAGAGAGGGTGG - Intergenic
1065275484 10:24081521-24081543 AACAGGAAAAGGAAGGAACGAGG - Intronic
1065698832 10:28404904-28404926 AAAAAAAAAAAGAAGGAAGGCGG + Intergenic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068158041 10:53226078-53226100 GACAGTAAAAAAAAGAACAGAGG + Intergenic
1068885052 10:62089511-62089533 AAAAAGAAAAAGAAGGAAGGAGG - Intronic
1069457739 10:68567085-68567107 CAGAGTAAAAAGATGGACGTTGG - Intronic
1070402421 10:76065349-76065371 CACAATAGAAAGAAGGAAGGTGG + Intronic
1070411819 10:76148833-76148855 AACAGTAAAGATAATAACGGAGG - Intronic
1071704910 10:87987666-87987688 AACCTTAAAAAGAAGGTGGGTGG + Intergenic
1071956029 10:90760303-90760325 AGGAGTAAAAAGGAGGACAGAGG + Intronic
1072347824 10:94526116-94526138 AAAAGTAAAAAGTAGAACAGAGG - Intronic
1072826559 10:98612649-98612671 GAAAGGAAAAAGAAGGACAGAGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073857018 10:107688256-107688278 ACCAGGAAAAGGAAGGAGGGAGG + Intergenic
1075546211 10:123356789-123356811 ATCTGTAAAAAGAAGGTCGTTGG - Intergenic
1076226174 10:128778136-128778158 AACATTAACAAGAAGGATTGGGG + Intergenic
1077204968 11:1337620-1337642 AACGTTAAAAAGAGGGAGGGTGG + Intergenic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078513134 11:12000889-12000911 AACAGTAATAATAAGAACAGTGG + Intronic
1078592664 11:12658372-12658394 AACAGTCAAGTTAAGGACGGGGG + Intergenic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1080375343 11:31703242-31703264 AACAGTGAAAAGAAGACAGGGGG + Intronic
1080733644 11:34987133-34987155 AACAGTAAAAGCAAGGAGAGAGG - Intronic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081819703 11:45980280-45980302 AGCAGTAAAAAGCAGGACTCTGG + Intronic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1083107141 11:60369153-60369175 AAGAAGGAAAAGAAGGACGGTGG - Intronic
1083516508 11:63263652-63263674 AACAGTAAAAAGATGGGCAGAGG - Intronic
1083788874 11:64971434-64971456 AAAAAAAAAAAAAAGGACGGAGG + Intronic
1085374902 11:76051555-76051577 ACAAGTAAAAAAAAGGAGGGGGG + Intronic
1085890313 11:80571884-80571906 AACAGAAAATAGAATGATGGTGG - Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086342374 11:85859113-85859135 AAAAATAAAAAGCAGGAAGGTGG + Intronic
1086975708 11:93130328-93130350 AGAAGTAAAAAGTAGGACAGAGG - Intergenic
1087063974 11:94010258-94010280 CACAGTGAAAAGAAGAACAGAGG - Intergenic
1087214521 11:95481008-95481030 AACTGTAAAAAGTAAGATGGGGG + Intergenic
1088719154 11:112576559-112576581 TACAGCACAAAGAAGGACAGGGG - Intergenic
1090941088 11:131389045-131389067 AAAAGGAAAAAGAAAGATGGTGG + Intronic
1091161050 11:133420904-133420926 AACAGTAAAAAGGATTACAGTGG + Intronic
1092288265 12:7142522-7142544 AAGAGTCAAAACAAGGAGGGAGG - Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093429691 12:19070728-19070750 AAAAGTAAAAAGAAAGAATGTGG - Intergenic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1095132799 12:38563990-38564012 AACAGTAAAAAGAAAGAATCAGG - Intergenic
1095279846 12:40337301-40337323 AACAGTTAAAAGCAAGATGGAGG - Intronic
1095754998 12:45754985-45755007 AACAATAAAAAGGAAGATGGGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098367134 12:69715896-69715918 AATAGTACAAAGGAGGATGGCGG + Intergenic
1099115368 12:78617722-78617744 AAAAGAAAAAAGAAAGAAGGGGG + Intergenic
1100022437 12:90086117-90086139 AACAGTACAAAGGAGGACAGTGG - Intergenic
1100391137 12:94147489-94147511 AATAGTAGAAAGCAGGGCGGGGG + Intergenic
1100635906 12:96434238-96434260 AACACTAAAGAGAAGGGCAGAGG + Intergenic
1100877221 12:98975095-98975117 AACAGAAGAAAGTAGGAGGGAGG - Intronic
1101662880 12:106782010-106782032 AACAAGAAAAAGAAAGAAGGAGG - Intronic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1102749174 12:115277251-115277273 AAGAAAAAGAAGAAGGACGGGGG + Intergenic
1102780215 12:115557790-115557812 AACAGAAAAAAAAAGAAAGGAGG + Intergenic
1102799651 12:115720757-115720779 AACAAAAGAAAGAAGGAAGGTGG + Intergenic
1103521863 12:121541408-121541430 AAAAAAAAAAGGAAGGACGGAGG + Intronic
1103642139 12:122360037-122360059 AACAGGAAAAAGAGGGAGAGAGG + Intronic
1104101271 12:125613940-125613962 AACAGCAAAAAGAATGTAGGTGG - Intronic
1104220658 12:126781691-126781713 TACAGCAACAAGAAGGAAGGAGG - Intergenic
1104238780 12:126966407-126966429 AAGAGAATAAAGAAGGACTGAGG - Intergenic
1104772872 12:131375153-131375175 AACAGGAAAGAGAGGGATGGAGG + Intergenic
1106527680 13:30556718-30556740 AGAAGTAAAAAGTAGGACAGAGG + Intronic
1108243325 13:48489973-48489995 AACTGTCAGAAGAAGGATGGTGG - Exonic
1108278596 13:48838270-48838292 AACAGTAAAAACTAGGAGAGAGG + Intergenic
1108377051 13:49823531-49823553 AACATTAAAAAGAAGGAAAATGG + Intergenic
1109119482 13:58436034-58436056 AAAAGCACAAAGAAGGAAGGAGG - Intergenic
1109138157 13:58679641-58679663 AACAGCAAAAAGTAGAATGGTGG - Intergenic
1110086110 13:71382009-71382031 AAAAGAAAAAAGAAGGACAAAGG - Intergenic
1110335306 13:74323295-74323317 AACACTAAAAAGAAGGAGAGAGG - Intergenic
1110345591 13:74444038-74444060 TGCAGTAAAAAGAAGGACAGAGG + Intergenic
1110448497 13:75615812-75615834 TTCACTAAAAAGAAGGAAGGAGG - Intergenic
1113186911 13:107698101-107698123 ATCAGTAAAAAGAATGAGGATGG - Intronic
1114811449 14:25905187-25905209 AACAGGAAAAAAAATGAAGGTGG + Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1115163574 14:30423295-30423317 AATAGTAAAGTGAAGGAGGGTGG - Intergenic
1115302885 14:31903992-31904014 AACAAGAAAAACAAGGAAGGTGG - Intergenic
1116012726 14:39369630-39369652 AACAGTAAAAAGAATAAAGGAGG - Intronic
1117063662 14:51987817-51987839 AATAATAAAAAGAAGTACAGAGG - Intergenic
1117123257 14:52592266-52592288 AACAGCAAAAAGAACGAAGCTGG - Intronic
1117131129 14:52687836-52687858 AACAGTAAATAGGAGGACCAAGG + Intronic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118733778 14:68687966-68687988 ACCATTAAAAAGAATGAAGGAGG + Intronic
1118983691 14:70735290-70735312 GACAGTAAAAGGGAGGACTGAGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119821888 14:77623496-77623518 AACAGTAAGAAGCAGGAAGTGGG + Intergenic
1120006533 14:79364165-79364187 GACAGAAAAAAGAAGAACTGGGG - Intronic
1120774229 14:88415368-88415390 AACAGTAAATAGAAGAGCAGGGG - Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1202831018 14_GL000009v2_random:30467-30489 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1124035891 15:26053357-26053379 AAAAGGAAAAAGAAAGAGGGAGG + Intergenic
1124037440 15:26068774-26068796 GAAAATAAAAAGAAGGAAGGAGG - Intergenic
1124647804 15:31452021-31452043 AACAATAAAAAGGAGGTAGGTGG - Intergenic
1124944274 15:34248998-34249020 AACAGTAAAAAGAGGTAGAGAGG + Intronic
1125717743 15:41828637-41828659 AATAGAAAAAAGAAGGAAGGAGG - Intronic
1126786898 15:52184701-52184723 AAAAGTGAAAAGAAGGGAGGGGG + Intronic
1127017671 15:54707454-54707476 AAAAGTAAAAGGAAAGAGGGCGG - Intergenic
1127498261 15:59532511-59532533 AACACTAAAAAAAAGGCAGGGGG + Intergenic
1128204132 15:65835688-65835710 AACAGAAAAAAGAAGTGAGGAGG + Intronic
1128434271 15:67630079-67630101 AAAAGTAAAAAGTAGCATGGTGG + Intronic
1130031625 15:80319531-80319553 AACAGTATAAAGAAAAAAGGGGG + Intergenic
1130557250 15:84931248-84931270 AAAAATAAAAAGGAGGAGGGAGG - Intronic
1130790306 15:87147883-87147905 AAAAGTAAAAAGTAGAACAGAGG + Intergenic
1131150614 15:90045311-90045333 AACAGCAGAAAGAAGGAAGCTGG + Intronic
1131531259 15:93194395-93194417 AACAGCATAAAGAAGGAAGAAGG - Intergenic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1134264398 16:12680989-12681011 AACATTAAAAAGAAAGAAAGAGG - Intronic
1135521514 16:23182190-23182212 AAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1135790926 16:25395090-25395112 AAAAGAAAAAAAAAAGACGGAGG - Intergenic
1135853381 16:25984594-25984616 AGAAGTAAAAAGTAGGACAGAGG - Intronic
1136406906 16:30053384-30053406 AACAGGAAAGGGAAGGAGGGTGG + Intronic
1136519903 16:30788527-30788549 AAAAAAAAAAAGAAGGAGGGAGG + Intergenic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1139633388 16:68244212-68244234 AAAAGAAAAAAGAAAGAGGGAGG + Intergenic
1140356919 16:74314410-74314432 AACTGGGAAAAGAAGGATGGAGG - Intergenic
1140599235 16:76455486-76455508 AACAGTGAAAGGGAGGAAGGTGG - Intronic
1140767819 16:78176303-78176325 AATAATAAAAAGAGGGACAGGGG - Intronic
1142670794 17:1486503-1486525 AACAGAAAAAAAAAGGAGGGAGG - Intronic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1143075288 17:4337357-4337379 AAAAGGAAAAAGAAGGCTGGGGG + Intronic
1143229119 17:5336702-5336724 AACAGGAAAAAAAAGGAGGGAGG - Intronic
1143244695 17:5473997-5474019 AACATGAAAAAAAAGGAGGGAGG - Exonic
1145064291 17:19751690-19751712 AAAAATAAAAAAAAGGAAGGAGG + Intergenic
1145819109 17:27817709-27817731 AACAGAGAAACAAAGGACGGAGG - Intronic
1146176828 17:30670470-30670492 AAAAAAAAAAAGAAGGCCGGGGG - Intergenic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1150506648 17:65705575-65705597 AAAAGAAAAAGGAAGGACAGAGG + Intronic
1151391964 17:73793397-73793419 AAAAGAAAAAAAAAGCACGGAGG - Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1154395277 18:13981887-13981909 AAAAGAAAAAAGAAAGAAGGTGG - Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1155667207 18:28325807-28325829 AACAGTAGAAAGGAGGAAAGTGG - Intergenic
1156709117 18:39920247-39920269 AACAGGAAAAAAAAGGAAGTCGG + Intergenic
1157348837 18:46866708-46866730 AACAGCAAAAAGAATGGAGGGGG + Intronic
1160614304 18:80112431-80112453 AACAAAAAAAAAAAGGAGGGGGG + Intronic
1161897799 19:7095665-7095687 AAAAAAAAAAAGAAGGAAGGAGG + Intergenic
1163204297 19:15790964-15790986 AGAAGTAAAAAGTAGGACAGAGG + Intergenic
1163456985 19:17412673-17412695 AACAGTAAAAAGAAAATAGGCGG + Intronic
1163462831 19:17448888-17448910 AACAAGAAAAAGGAGGCCGGGGG + Intronic
1164861676 19:31566706-31566728 AAAAGAAAAAAGAGGGAAGGAGG + Intergenic
1165160979 19:33816120-33816142 AACATTCAAAAGAAGGAAAGTGG + Intergenic
1165217103 19:34282967-34282989 AACAGTAATGAGAAGGTCTGAGG - Intronic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1165399146 19:35586565-35586587 AAAAAAAAAAAAAAGGACGGGGG - Intergenic
1165442982 19:35841490-35841512 AACAGAAAAAAGATGGAGAGGGG - Intronic
1165686516 19:37825769-37825791 AAAAGAAAAAAGAAAGACTGAGG + Intergenic
1168159943 19:54503463-54503485 AACACCAAAAAGAAGGGCTGGGG + Intronic
1168454104 19:56492029-56492051 AATAGTACAAAGAAAGATGGTGG + Intergenic
1202641677 1_KI270706v1_random:97306-97328 AATAGTAAAAAGAATGAGGTAGG - Intergenic
925467954 2:4126869-4126891 AAAAGTAAAAAGAAGAACAGAGG + Intergenic
926356194 2:12042796-12042818 AACATTAAAAAAAAGGGGGGGGG - Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926591248 2:14742442-14742464 AACAGTAAAAAGTAAGACCATGG + Intergenic
927175857 2:20406970-20406992 AAAAGAAAAAGGAAGGAAGGAGG - Intergenic
928081303 2:28314966-28314988 AAAAGAGAAAAGAAGGAAGGTGG + Intronic
928312448 2:30222111-30222133 AACAGTAAAAAGAAGGGGTAGGG - Intergenic
929037678 2:37710342-37710364 AAAAGTAAAAACAATGAGGGAGG + Intronic
929891787 2:45924371-45924393 AATAGGAAAATGAAGGATGGAGG + Intronic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931431221 2:62210466-62210488 AAGATTAAAAAGGAGGACAGTGG + Intronic
931497500 2:62825537-62825559 AACAATAAAAAAAAGGCCTGGGG + Intronic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
931903611 2:66819514-66819536 AAAAGTTAAAAAAAGGATGGTGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932659772 2:73642024-73642046 AACAGAAAAAGGAAGAGCGGTGG - Intronic
933671266 2:85009662-85009684 AACAGAAAAAAGAAAGAAGAGGG - Intronic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
935022775 2:99247596-99247618 GACTGTAAAAGGAAGGAGGGAGG - Intronic
935516662 2:104048882-104048904 GAAAGTAAAAGGAAGGAAGGAGG - Intergenic
936032825 2:109085972-109085994 AACAGTTAAGAGATGGATGGTGG - Intergenic
936763805 2:115819512-115819534 AACAAAAAAAAGAGGGATGGAGG - Intronic
938265834 2:129927668-129927690 AAAAAAAAAAAAAAGGACGGGGG - Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
939379346 2:141414250-141414272 AAAAGAAAAAGGAAGGAAGGAGG + Intronic
939758542 2:146144787-146144809 AACAGTAAAGAGAAGAGCAGAGG - Intergenic
939833187 2:147097091-147097113 AAAAGAAAAAAAAAGGAAGGGGG - Intergenic
941361784 2:164560571-164560593 AACATTAATAAGAAGGATTGGGG + Intronic
941840470 2:170077570-170077592 AACAGGAAAGAGAAAGACGCAGG - Intronic
943380786 2:187143864-187143886 AATATTAAAAAGAAGAACTGGGG + Intergenic
944343449 2:198631755-198631777 AACAGTAAATCGATGGATGGTGG - Intergenic
945120496 2:206452482-206452504 AACTGTAAAGAGAAGGACAGTGG - Intronic
945472392 2:210241941-210241963 AAAAGTGAAAAGAAGCACAGAGG + Intergenic
946517003 2:220423463-220423485 AACAGTAGAAAGAATGAGAGTGG - Intergenic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947989172 2:234473458-234473480 AACAGTAACAAGCAGCATGGTGG - Intergenic
948157311 2:235793647-235793669 AGCAGCAAAAAGGAGGAAGGGGG + Intronic
1168904404 20:1392212-1392234 AAAAGTAAAAAGACGGAAGAAGG + Intronic
1169603306 20:7287040-7287062 AACAGTAAAAATAAAGTTGGTGG + Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170915666 20:20622269-20622291 AACAGGAAAAAAAAAGATGGGGG + Intronic
1171370857 20:24661284-24661306 AGCAGAAGAAAGAAGGAGGGAGG + Intronic
1174079288 20:47959627-47959649 AAAAGTAAAATGAAGGAGAGGGG - Intergenic
1174434545 20:50496710-50496732 AAAAGGAAAAAGAAGGAAGGAGG - Intergenic
1175410609 20:58765465-58765487 AACAGTAAAAACAAGCACTGGGG + Intergenic
1176610206 21:8875306-8875328 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1177390660 21:20465875-20465897 AGAAGTAAAAAGTAGAACGGTGG - Intergenic
1177401877 21:20614942-20614964 AGCAGGAAAAAGAATGAAGGAGG - Intergenic
1177890394 21:26797699-26797721 AAGAGAAAAAAAAAGGGCGGGGG - Intergenic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178763838 21:35430475-35430497 AAAAGAAAAAGGAAGGAAGGAGG - Intronic
1178793303 21:35720550-35720572 ACCAGCAAAAAAAAGGACGGAGG + Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179406063 21:41126842-41126864 AGAAGTAAAAAGTAGGACAGAGG - Intergenic
1179565534 21:42245556-42245578 GACAGGAAGAAGAAGGACAGAGG + Intronic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1181596554 22:23918746-23918768 AAAAAAAAAAAAAAGGACGGGGG + Intergenic
1181613525 22:24035899-24035921 AAAAAAAAAAAGAAGGGCGGGGG - Intronic
1182138515 22:27930919-27930941 CACAATAAAAAGAAGGGCAGGGG - Intergenic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182641566 22:31772071-31772093 AACAATAAAAAAAAGAACGGGGG + Intronic
1182829834 22:33296096-33296118 AACAGTAAACATCAGGACAGTGG - Intronic
1182879830 22:33723877-33723899 AACAGGAAAGAGAATGAAGGAGG + Intronic
1183922765 22:41182447-41182469 AAAAAAAAAAAGAAGGGCGGGGG + Intergenic
1203238073 22_KI270732v1_random:26673-26695 AAAAGTAAAAAGATGGAGGAGGG - Intergenic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950012985 3:9736454-9736476 AACAGAAAAGAGAAAGACTGTGG - Intronic
950403878 3:12792452-12792474 AAAAGAAAAAAGAATGAGGGTGG - Intergenic
951486340 3:23215701-23215723 AACAGCAAAGAGAAGGGTGGTGG - Intronic
952185493 3:30963501-30963523 AACAAAAGAAAGAAGGAAGGAGG - Intergenic
952236962 3:31490139-31490161 AACAGTACAAAGAAGGTGGAAGG - Intergenic
952980815 3:38734011-38734033 AACAATAAAAAGAAGGCCAGGGG - Intronic
953174990 3:40542767-40542789 AGAAAGAAAAAGAAGGACGGAGG + Intronic
955096588 3:55804773-55804795 AGCAGTGAAAAGAATGATGGTGG - Intronic
955434338 3:58885642-58885664 AGAAGTAAAAAGAAGTACAGAGG - Intronic
955671810 3:61410274-61410296 AAAAGGAGAAAGAAGGAGGGAGG + Intergenic
955697258 3:61649172-61649194 AATAGAAAAAGGAAGGAAGGAGG - Intronic
955731872 3:61995760-61995782 AAAAAGAAAAAGAAGGAGGGAGG - Intronic
959082144 3:101813257-101813279 AACAGTAAAAGGCAGGACAAAGG - Intronic
960026719 3:113019150-113019172 TACAGGAAAAAGAAGGAAAGGGG + Intronic
960551659 3:118982541-118982563 GACAATAAAAAGAAGGACAAAGG + Intronic
960651499 3:119956117-119956139 ATTAGTAAATAGAAGGAGGGAGG + Intronic
960865462 3:122194961-122194983 AAAAGTAAGAAGAAGAAAGGAGG - Intronic
962084728 3:132178682-132178704 AACAGTAACAATAAGGACAGAGG - Intronic
962191233 3:133312869-133312891 GACAATAAAATGAAGGAGGGAGG - Intronic
963431287 3:145207688-145207710 AAAAAGAAAAAGAAGGAGGGAGG + Intergenic
964249937 3:154701665-154701687 AACAGCACAAAGAAGGTGGGTGG + Intergenic
964408528 3:156375274-156375296 AACTCTACAAAGAAGGACTGTGG - Intronic
964926563 3:161964844-161964866 AAAACTAAAAACAAGAACGGTGG + Intergenic
966459229 3:180156806-180156828 AGAAGTAAAAAGTAGGACAGAGG - Intergenic
966820484 3:183920493-183920515 AACAGCAAAAAGAAGAAGGCAGG + Exonic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
967607324 3:191462980-191463002 AAAAGAAAAAAGAGGGAGGGAGG - Intergenic
1202736888 3_GL000221v1_random:10092-10114 AATAGTAAAAAGAATGAGGTAGG + Intergenic
968550499 4:1221149-1221171 AACACGAAAAAGACGGCCGGAGG + Intronic
969828171 4:9774762-9774784 AGAAGGAAAAAGAAGAACGGAGG - Intronic
970093965 4:12441587-12441609 GACAGTAAAAGGAAGGACCCAGG + Intergenic
970458645 4:16250964-16250986 AAAAGTGAAAACAAGGAAGGTGG - Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971392607 4:26200186-26200208 GACTGTAAAAATAAGGACGAAGG - Intronic
971432945 4:26587992-26588014 GACAGTATAAGGAAGGAAGGAGG - Intronic
971645075 4:29189019-29189041 AAAAGTAAAAAGAAGGGAGCCGG - Intergenic
972476346 4:39453491-39453513 AAAAGTAAATATAAGGACAGAGG - Intergenic
972696476 4:41451485-41451507 AACAGAATATAGCAGGACGGGGG - Intronic
973088969 4:46107538-46107560 AATAAGAAAAAGAAGGAGGGTGG - Intronic
973385188 4:49507822-49507844 AATAGTAAAAAGAATGAGGTAGG - Intergenic
974137067 4:57832223-57832245 AATAGTAAAAAGGAGGAGGCAGG - Intergenic
974226756 4:59055906-59055928 AACTGTAAAATGAAGGACTGTGG - Intergenic
974394156 4:61313755-61313777 ATTAATAAAAAGAAGTACGGTGG + Intronic
975687097 4:76927684-76927706 AACAATAAAAAGGAGAAAGGAGG - Intergenic
975883861 4:78941385-78941407 AACAGGAAAAGGAAGAAAGGAGG + Intergenic
976732667 4:88280057-88280079 AACAGTCAAAAGAAAGAATGAGG + Intronic
976885540 4:89979463-89979485 AAAAGAAAAAAGAAGGAAGAAGG - Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
978254595 4:106679280-106679302 AGCAGCAATAAGAAGGAAGGAGG - Intergenic
978545541 4:109868560-109868582 AAAAAAAAAAAAAAGGACGGGGG + Intronic
978571274 4:110140545-110140567 AAAATTAAAAAGAAGCATGGTGG - Intronic
980170443 4:129283454-129283476 TACAGTAGAAAGAAGAAAGGAGG - Intergenic
980332678 4:131429809-131429831 AATAATAAAAAGAAGGACTCTGG + Intergenic
980616253 4:135229392-135229414 AATAATAGAAAGAAGGAAGGAGG - Intergenic
980903216 4:138924626-138924648 AAAAGAAAAAAGAAGGAGGTGGG + Intergenic
981599776 4:146473306-146473328 AACAGTAAAAAGCATGTCAGTGG - Intronic
981601251 4:146491526-146491548 AAAAGGAAAAAGATGGAGGGAGG + Intronic
981912129 4:149994022-149994044 AACATTAAAAAGAATGAAAGAGG - Intergenic
982031825 4:151308857-151308879 AAAAGAAAAAAGAAAGACGCAGG - Intronic
982779066 4:159471647-159471669 AAAAGAAAAAAGAAAGACAGAGG - Intergenic
983113067 4:163777729-163777751 AACAGTAAAAAATATGAAGGAGG - Intronic
1202769050 4_GL000008v2_random:183180-183202 AATAGTAAAAAGAATGAGGTAGG - Intergenic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
987123655 5:14791344-14791366 AACAGCAAAATGAAGAACTGTGG + Intronic
988799107 5:34679698-34679720 AGCAGTAATGAGAAGGAAGGGGG + Intronic
988842002 5:35092497-35092519 AAAAGAAAAAAAAAGGTCGGTGG - Intronic
988914653 5:35880399-35880421 AACAAGAAAAAGTAGGAAGGGGG - Intergenic
989079707 5:37605009-37605031 AAAAAAAAAAAGAAGGAGGGGGG - Intronic
989494620 5:42098064-42098086 AGCAGTAAAAAGAAGGAAGTTGG - Intergenic
990652450 5:57917447-57917469 AAAAGTAAAAAGTAGAACAGAGG - Intergenic
992204655 5:74419750-74419772 AACAGTAAGAAGAAGTGAGGGGG - Intergenic
992247642 5:74843046-74843068 AACAGTAAGAAGAAATAAGGGGG + Intronic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
993168234 5:84384058-84384080 TACAGGAAAGAGGAGGACGGTGG - Intronic
995274307 5:110260914-110260936 AAAAGCAAAAGCAAGGACGGGGG - Intergenic
996174103 5:120333288-120333310 AACAATAAAAAGGAGGAAGAAGG - Intergenic
996808491 5:127486183-127486205 AACAGTAAAAAAAAGGGGGAGGG - Intergenic
997153957 5:131530588-131530610 AACAGTAACATGAGGGAAGGGGG + Intronic
997893958 5:137699334-137699356 AACAGTGAGAAGAAGGAAGCTGG + Intronic
998243168 5:140469131-140469153 AAAAGGAAGAAGAAGGAAGGAGG - Intronic
998698842 5:144673909-144673931 AAGAGTAAAAAGAAGTAATGGGG - Intergenic
999480375 5:151942565-151942587 AAAAAGAAAAAGAAGGCCGGGGG - Intergenic
999796978 5:154998020-154998042 AACGATAAAAACAAGGAGGGAGG - Intergenic
1000437161 5:161226400-161226422 AGCATTAAAAAGAATGAGGGTGG + Intergenic
1000711405 5:164584327-164584349 AAAAGTAAAAATAAGTACTGAGG - Intergenic
1001284257 5:170410895-170410917 AACAGTAAAAGGCAGGACTCTGG - Intronic
1001330185 5:170756501-170756523 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1001796431 5:174505982-174506004 AAGAGGAAAATGAAGGACAGTGG + Intergenic
1001908885 5:175497442-175497464 AACATTAAAAAGCAGGACAAAGG + Intronic
1003118358 6:3298490-3298512 AGAAGTAAAAAGAAGAACAGAGG + Intronic
1003736745 6:8886309-8886331 AAAAGGAAAAAGAAAGACAGAGG - Intergenic
1004772559 6:18800611-18800633 CACAGTAATAAGCAGGAAGGTGG + Intergenic
1005089633 6:22043127-22043149 TGCAGTAAAAAGAAGCAAGGAGG - Intergenic
1005383529 6:25262641-25262663 AGAAGTAAAAAGTAGGACAGAGG + Intergenic
1007280299 6:40707344-40707366 AAAAACAGAAAGAAGGACGGAGG + Intergenic
1009950252 6:70387147-70387169 AAGAGCAAAAAGAAGCAGGGAGG - Intergenic
1010043638 6:71416848-71416870 ATCAGTTAAAAAAAGGTCGGGGG - Intergenic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1010247795 6:73678234-73678256 AAAAGAAAAAAGAAGTCCGGAGG + Intergenic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1012729131 6:102858064-102858086 AATAGTACAAAGAAGGATGGAGG - Intergenic
1015044488 6:128761380-128761402 AAAAGTAAAAAGCAGAACAGAGG + Intergenic
1015153593 6:130065259-130065281 CATAGTAAAAAGAAGTCCGGAGG - Intronic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1016227974 6:141763941-141763963 AACAGTAAAAAGAATTATGAGGG - Intergenic
1016305005 6:142674855-142674877 AACAGAAAAATGAATGACTGAGG + Intergenic
1016508338 6:144810591-144810613 AATAGTAAAAGGAAAGAAGGAGG + Intronic
1016533532 6:145085528-145085550 AACAGTAAATAAAATGATGGTGG + Intergenic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017681198 6:156865811-156865833 AAAAGGAAAAAGGAGGAAGGTGG - Intronic
1017926238 6:158913852-158913874 AACAGCAAAAAGAAGGGAGCTGG - Intergenic
1018134915 6:160769732-160769754 AGAAGTAAAAAGTAGAACGGAGG + Intergenic
1018282527 6:162202965-162202987 AACAATAAAAAGAAAAAAGGAGG + Intronic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1019888416 7:3925296-3925318 AAAAGTAAAAAGAAGCGAGGAGG + Intronic
1020674417 7:11164141-11164163 AACAGTAAAATGAAGGGAGACGG - Intronic
1021189665 7:17605194-17605216 ATCAGTAAAAAAAAGGATGGGGG + Intergenic
1021565071 7:22008760-22008782 ATCAATAAAAAGAAGGAAGTGGG + Intergenic
1022276203 7:28857342-28857364 AAAAGTAGAAAGTAGAACGGTGG + Intergenic
1024771071 7:52723935-52723957 AAAAGGAAAAAGAAGGCCGGGGG - Intergenic
1025207036 7:56999923-56999945 ACCAGCAAACAGAAGGAGGGGGG - Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1025481393 7:60988141-60988163 AAAAGAAAAAAGGAGGAGGGGGG - Intergenic
1025664903 7:63576979-63577001 ACCAGCAAACAGAAGGAGGGGGG + Intergenic
1027352869 7:77329367-77329389 AACAGGAAAAAGAAGGTCTGCGG - Exonic
1027568520 7:79830581-79830603 AAAAGTAAAGAGTAGCACGGTGG + Intergenic
1028646460 7:93102799-93102821 TACATTAAAAAGAAGGACTTTGG - Exonic
1028888467 7:95960519-95960541 AACAAGAAAAAGAAGGCTGGTGG - Intronic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1030167966 7:106573555-106573577 AACAGCAGAAAGAAGGCCAGTGG - Intergenic
1030183109 7:106731347-106731369 AACAGACAATAGAAGGAAGGTGG + Intergenic
1030241672 7:107332836-107332858 AACACTGAAAAGAAGGAAGGAGG + Intronic
1030262792 7:107583205-107583227 AACAGTATAAACAAAGACAGTGG - Intronic
1030989014 7:116277707-116277729 AACAGTAAACAGAAAAAAGGAGG - Intergenic
1031134065 7:117866663-117866685 ATCAGTAAAAATAAGGATGCTGG + Intronic
1031909742 7:127503212-127503234 AGCAGTCAAAAGTAGGAAGGTGG - Intergenic
1032374767 7:131401569-131401591 AACAGAAAAAAGAAAGAAGCAGG - Intronic
1033264319 7:139871711-139871733 AATAGTAAAAATAGGAACGGAGG - Intronic
1033456000 7:141504100-141504122 AATAGTAAAAATCAGGAGGGAGG - Intergenic
1033616004 7:143014820-143014842 AACAGTAACTATAAGGACTGTGG - Intergenic
1034911316 7:155001377-155001399 AACAAAAAAAAGAGGGGCGGGGG + Intronic
1036282771 8:7415781-7415803 AACAGTATAATGAAGGAAGGCGG - Intronic
1036338695 8:7895746-7895768 AACAGTATAATGAAGGAAGGCGG + Intronic
1036793972 8:11742359-11742381 AACACCAAAAACAAGAACGGAGG - Intronic
1037331106 8:17744571-17744593 AAAAGTAAAAAGATTGATGGTGG - Intronic
1037521105 8:19681457-19681479 AACATTAAAAGGAAGAACTGGGG + Intronic
1037714915 8:21389148-21389170 AAAAATAAAAAGAATGAGGGGGG - Intergenic
1037861187 8:22406699-22406721 AAAATTAAAAAAAGGGACGGGGG + Intronic
1038186206 8:25277427-25277449 AACAGTAAAAAAAAAGAGGAAGG + Intronic
1038841049 8:31185231-31185253 AAGAGGAACAAGGAGGACGGTGG + Intergenic
1039190287 8:34965961-34965983 ATGACTAAAAAGAAGGACTGTGG - Intergenic
1039867910 8:41521764-41521786 AATTGTAAAAAGAAGGAAGGAGG + Intergenic
1040573631 8:48631279-48631301 AACAGTAAGAAGCAGGAAGCAGG + Intergenic
1041549208 8:59080730-59080752 AACAGGAACAAGAGGGTCGGGGG - Intronic
1041584246 8:59497171-59497193 AATACTAGAAAGAAGGAAGGAGG + Intergenic
1041814535 8:61954336-61954358 AACAGTGAAGAGAATGACAGGGG + Intergenic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041860833 8:62510863-62510885 CACAGGAAAAAGCAGGACAGAGG - Intronic
1042100567 8:65271513-65271535 AAGATGAAAAAGGAGGACGGGGG + Intergenic
1042349575 8:67763430-67763452 AAAAGAAAAAAGAAGGACAGAGG - Intergenic
1042563992 8:70094834-70094856 AAAAGAAAAAGGAAGGAAGGAGG + Intergenic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042998253 8:74725281-74725303 AGCAGTATAAAGAAGGATGGAGG + Intronic
1044021368 8:87109950-87109972 ATCAGGAAAAAGAAGGCCTGGGG - Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1045176740 8:99733251-99733273 AACAGCAAACAGAAGGAAAGAGG + Intronic
1045533505 8:103005822-103005844 ATCAGGAAAAAGAAGGAATGGGG + Intergenic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1046567186 8:115917168-115917190 AATAGAAAAAAGAAGGACTTTGG + Intergenic
1047695288 8:127397213-127397235 AGCAAGAAAAAGAAGGAGGGAGG + Intergenic
1047744889 8:127837319-127837341 AAAGGAAAAAAGAAGGCCGGGGG + Intergenic
1049429581 8:142553915-142553937 AACACAAAGAAGAAGGAAGGAGG - Intergenic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1051583150 9:18698848-18698870 AACAGTAAGAAAAAGGCCAGGGG - Intronic
1051828510 9:21249231-21249253 AAAAGTAAAAAGTAGAACAGAGG + Intergenic
1051980279 9:23006208-23006230 AAAATAAAAAAGAAGGACAGAGG + Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1054360655 9:64112465-64112487 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055018560 9:71645126-71645148 AAAAGGAAAATGAAGGAAGGAGG - Intergenic
1055418017 9:76105340-76105362 AGCAGTAGAAAGAAGAACGGTGG + Intronic
1055613190 9:78044091-78044113 AACTGTAAAGAGTAGGATGGAGG + Intergenic
1057778519 9:98030164-98030186 AAAAGGAAAAAGAAGAAAGGTGG + Intergenic
1058026685 9:100147760-100147782 AACTGTGAAAAGAATGACGATGG + Intronic
1058125662 9:101191486-101191508 GACAGTGAAAAAAAGGAAGGAGG - Intronic
1058645396 9:107127279-107127301 GACAGTGACAAGAAGGAGGGAGG + Intergenic
1060590950 9:124816541-124816563 AATAGTAAAAAGAAAGCCAGTGG + Intergenic
1060675433 9:125510167-125510189 AAAGGTAAAAAGTAGGAAGGGGG + Intronic
1060844336 9:126823679-126823701 AATAATAAAAAGTAGGATGGGGG - Intronic
1060938934 9:127532305-127532327 AAAAGTAAAAAGATGGAGGGGGG + Intronic
1061546684 9:131308578-131308600 AACAGCAAAAATCAGGATGGTGG + Exonic
1062484454 9:136768109-136768131 AGCAGTAAAAGGAACGAAGGTGG + Intergenic
1203693930 Un_GL000214v1:76895-76917 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203705613 Un_KI270742v1:40536-40558 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203558382 Un_KI270744v1:25275-25297 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203642343 Un_KI270751v1:27168-27190 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1185783066 X:2865931-2865953 AACTGCAAAAACATGGACGGGGG - Intronic
1186217935 X:7319636-7319658 AACAGTAGAATTAAGGACTGAGG - Intronic
1186404118 X:9286651-9286673 AACAGTAATAATAAGGTTGGGGG + Intergenic
1186738376 X:12490891-12490913 AGCTGTAAAAAGAAGGAATGAGG - Intronic
1186806214 X:13142900-13142922 AACCATAAAAAGAAAGAAGGAGG - Intergenic
1186950573 X:14619998-14620020 ACCAGTAAAAAAAAAAACGGGGG - Intronic
1189170509 X:38905149-38905171 AAAAAAAAAAAAAAGGACGGAGG - Intergenic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1190241947 X:48663783-48663805 AAAAAAAAAAAGAAGGAAGGAGG - Intergenic
1190524247 X:51311890-51311912 ATTAGTAATAAGAAGGAAGGAGG + Intergenic
1190881254 X:54494391-54494413 AAAAAAAAAAAGAAAGACGGTGG - Intronic
1191036935 X:56035147-56035169 AAAAGTAAAAAGTAGAACAGAGG - Intergenic
1192980380 X:76333033-76333055 AACAGTAAAAAAAAGGACAAAGG + Intergenic
1193997533 X:88384764-88384786 AACAGTTCAGAGAAGAACGGAGG + Intergenic
1195391308 X:104365653-104365675 AACAGAACAAAGCTGGACGGAGG - Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1198804629 X:140481562-140481584 GACATTCAAAATAAGGACGGGGG + Intergenic
1198864282 X:141105038-141105060 AAAAGAAAAAAGAAGGGAGGAGG - Intergenic
1198898407 X:141482378-141482400 AAAAGAAAAAAGAAGGGAGGAGG + Intergenic
1199222077 X:145328946-145328968 AACAAGGAAAAGAAGGACAGAGG - Intergenic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1201854338 Y:18524590-18524612 CACAGTAAAAAAAAGGACAATGG + Intergenic
1201878983 Y:18795795-18795817 CACAGTAAAAAAAAGGACAATGG - Intronic