ID: 1182263055

View in Genome Browser
Species Human (GRCh38)
Location 22:29089741-29089763
Sequence CTGGAGCAGGAGAATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 709}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182263055 Original CRISPR CTGGAGCAGGAGAATGAGCA GGG (reversed) Intronic
900481247 1:2900500-2900522 CTGGAGCAGGAGCTTGCACAGGG - Intergenic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
900696630 1:4016170-4016192 CCGCAGCAGAAGAATGGGCAAGG + Intergenic
901020530 1:6252974-6252996 CAGGATCAGGAGACAGAGCAAGG - Intronic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901354898 1:8636807-8636829 GTGGAGCAGGAGATAGAGCATGG + Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901805733 1:11737273-11737295 CTGGAGCAAGGGAATGGGCTTGG + Intronic
902466124 1:16619876-16619898 CTGCAGCAGGAGCATGACGAGGG - Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903614742 1:24643523-24643545 CCGGAGGAGGAGACTGCGCAGGG - Intronic
903976493 1:27153826-27153848 CTGGAGCCTGAGAAGGACCAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905290889 1:36921029-36921051 CTGGAGGTGGAGAGTGGGCATGG + Intronic
905386180 1:37605892-37605914 CTGGAGCAGGACACTGAGATGGG - Intergenic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
906199054 1:43947549-43947571 CTGGGGCAGGAGACAGATCAGGG + Exonic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906645958 1:47475275-47475297 ATGAAGCTGGAGCATGAGCAGGG - Intergenic
906651331 1:47515209-47515231 CTGGAGCAGAGGGCTGAGCAAGG - Intergenic
906702638 1:47871236-47871258 CAGGAGCAGGAGAATGTGCTTGG + Intronic
907049216 1:51318383-51318405 CTGCAGCAAGAGCATGACCATGG - Intronic
907195601 1:52684072-52684094 CAGGAGCAAGAGAGTGAGCAAGG - Intergenic
907315573 1:53568717-53568739 GTGGAGCAGGAGACAGAGAAGGG - Intronic
908113898 1:60922865-60922887 CTTAAGCAGGAGTCTGAGCAAGG + Intronic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909451217 1:75799664-75799686 CTAGAGCAGGAGAGTGATCTAGG + Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
911512419 1:98824075-98824097 CTGGGGCAGGAGAATGAACCTGG - Intergenic
911695600 1:100887795-100887817 CTGAGGCAGGAGAATGACCCGGG - Intronic
912262217 1:108121628-108121650 CTGGAGCAGGAGCCTCAGGAAGG + Intergenic
912392106 1:109310531-109310553 CTGAAGCAGGAAAATGAACATGG - Exonic
912474676 1:109927988-109928010 CTAGAGCATGGGAATGGGCAGGG + Intronic
912516017 1:110216981-110217003 CAGGACCAGGAGAGAGAGCAGGG + Intronic
912558814 1:110535543-110535565 CTGGGGCAAAAGGATGAGCAGGG + Intergenic
912695581 1:111839497-111839519 CTGAAGCAGGAAAATGAACAAGG - Intronic
912753316 1:112303487-112303509 CGGGAGCAGGAGAATGATGGGGG - Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913502848 1:119487997-119488019 GTGGAGAAGGAGGAAGAGCAGGG + Intergenic
913714402 1:121519388-121519410 CTGGAGGAGGAGAAGCAGCCGGG - Intergenic
913718573 1:121566226-121566248 CTGGTCCAGGAGATTCAGCAAGG - Intergenic
914003976 1:143716954-143716976 CTGGAGCAGGCGGCTGGGCACGG + Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
915147090 1:153801690-153801712 CGGGAGCAGGGGAATGTGAAGGG - Intergenic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915976684 1:160395664-160395686 CTGGAGAAGGCGAATGAGTTGGG + Intergenic
916636083 1:166670156-166670178 CTGAAGCAGGTGAGTGTGCAGGG + Intergenic
916827989 1:168462038-168462060 TTGGAGCAGGAGAAAGAGTGAGG + Intergenic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917367112 1:174244344-174244366 CTGAAGCAGGAGTAGCAGCATGG + Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918157374 1:181862169-181862191 CTGGATCAGGAAAATGAGATAGG + Intergenic
918260048 1:182787477-182787499 CTGGTGCAGGGGAAAGAGCTTGG - Intergenic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919553953 1:199028574-199028596 CAAGAGCAGGAGAATGAGTGGGG - Intergenic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919895342 1:202006326-202006348 CTGGTGCAGGAAAATGAAAAAGG + Intergenic
920954713 1:210607859-210607881 CTTGGGGAGGAAAATGAGCAGGG - Intronic
921405315 1:214772631-214772653 CTGGAGCAGAAGGAAGAGCGAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921714287 1:218402101-218402123 CTGGAGCAGGAGTACAGGCAGGG + Intronic
922119360 1:222647781-222647803 ATGGAGCAGAGGAATTAGCAAGG + Intronic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923062580 1:230489426-230489448 GTGGAGCAGGAGAGAGAGAACGG - Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923329035 1:232905732-232905754 CTGAGGCAGGAGGCTGAGCAGGG - Intergenic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924528765 1:244875782-244875804 TTGGTGCAGGAGAAAGAGCTCGG - Intergenic
1062985540 10:1765270-1765292 CAGGAGCATGAGACTGAGAATGG - Intergenic
1063284155 10:4664714-4664736 CTGAGGCAGGAGAATTAGCTGGG - Intergenic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064641214 10:17417595-17417617 TTGGTGCTGGAGAATGTGCAGGG - Intronic
1064876510 10:20000994-20001016 CTGGAGTAGCAGGATGAGCTGGG + Intronic
1065223978 10:23524218-23524240 TAGGAGCAGGAGCAGGAGCAGGG + Intergenic
1065223981 10:23524230-23524252 CAGGAGCAGGGGCAAGAGCAGGG + Intergenic
1065624851 10:27619829-27619851 CTGGAGCAGGAGAGAGAGACGGG + Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1065895640 10:30160989-30161011 CTGAAGCAGAAGAGTGGGCACGG + Intergenic
1065917324 10:30364751-30364773 CTGGAGCAGGATCATCAGCAGGG + Intronic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067466489 10:46502957-46502979 CTGGACCAGGAGCAGGAGCTGGG + Intergenic
1067620699 10:47881648-47881670 CTGGACCAGGAGCAGGAGCTGGG - Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1069129694 10:64683339-64683361 CTGAAGCAGGAGAATCACCTGGG - Intergenic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069533241 10:69234172-69234194 CAGGAGGAGGAGATTGATCAGGG - Intronic
1069797346 10:71061867-71061889 CCGGAGCTGCAGAAAGAGCAGGG - Intergenic
1069851052 10:71405240-71405262 TCGGAGCAGGAGAAGGAACATGG - Intronic
1069919113 10:71805713-71805735 CTACGGCAGGAGAAAGAGCAAGG + Intronic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070147076 10:73782231-73782253 CGGAAGCCGGAGCATGAGCAGGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070424682 10:76273779-76273801 CTGGATCAGGTGAATGAAAAGGG + Intronic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1070688238 10:78505668-78505690 CTGGAGAAGGAGACAGGGCAGGG + Intergenic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071718159 10:88117537-88117559 CTGGGGGAGGAGGAAGAGCACGG + Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1071983899 10:91031675-91031697 CTGGAGCACAGGAATGAGCATGG - Intergenic
1072173450 10:92891075-92891097 CTGGAGAAGGAGAATAGTCAAGG + Intronic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1073458385 10:103651387-103651409 CTGGGGCAGGAGAAAGGCCAGGG - Intronic
1073509884 10:104036311-104036333 CTGGAGCAGGTCAAGAAGCATGG - Intronic
1074643201 10:115412444-115412466 GTGGATCAGGAGTCTGAGCATGG - Intronic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075624485 10:123951865-123951887 CAGGAGCAGGACCAAGAGCAAGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075894640 10:125984276-125984298 CTGTAGCAGGGGAGAGAGCATGG + Intronic
1076146733 10:128127736-128127758 TGGGAGCATGAGAATGAGAAGGG - Intergenic
1076627420 10:131830642-131830664 CTGGAGCAGGCGCAGCAGCACGG - Intergenic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077233639 11:1469629-1469651 CAGGAGCAGGAGCAGGTGCAGGG + Intronic
1077415041 11:2420914-2420936 CTCGAGCTGGAGGAAGAGCAGGG - Intronic
1078042949 11:7884881-7884903 GTGGAGCAGGTAAATGATCAAGG + Intergenic
1078263522 11:9734702-9734724 CTTGAGCAGGGGAGTGAGCATGG - Intronic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1078576531 11:12507589-12507611 CTGGAGCTGGACACTGAGAAGGG - Intronic
1079517295 11:21284315-21284337 CTGGAGCATGAGAGTGTGAAAGG + Intronic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1079890457 11:26046023-26046045 CTGAAGCTGTAGAATGATCATGG + Intergenic
1080871727 11:36242418-36242440 CTGGAGCAGTAGAACAAGCATGG + Intergenic
1080946549 11:36980744-36980766 CTAGAGCAGGAGAAAGAGAAGGG + Intergenic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1082898841 11:58223532-58223554 CTGGATGAAGGGAATGAGCAGGG + Intergenic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1084155784 11:67311765-67311787 CAGGAGCAGGAGCAGGGGCAGGG + Exonic
1084912973 11:72406188-72406210 CTTGGGCAGGAAAATGAGAAAGG + Intronic
1085059281 11:73430020-73430042 CAAGAGCAGGAGAAAGAGTATGG - Intronic
1085139841 11:74129973-74129995 CTGAGGCAGGAGAATCAGCAGGG + Intronic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085241798 11:75062642-75062664 CAGGAGCAAGAGAGAGAGCAAGG - Intergenic
1085295206 11:75427580-75427602 AAGGAGCAGGAGAATAAGCCAGG - Intronic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1085857166 11:80188334-80188356 CTGGAGAAGGAAAAGGGGCAGGG - Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086393663 11:86391929-86391951 CTGGAGCAGGAGTAAGAGGGAGG + Intronic
1086402088 11:86469397-86469419 CTGGACCAGCTGAGTGAGCAGGG + Intronic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1087181517 11:95146750-95146772 TGGGAGCAGGAGAATTTGCATGG - Intergenic
1087491077 11:98828003-98828025 CAGGATTAGGAGACTGAGCATGG - Intergenic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1088522810 11:110717592-110717614 CTGAAGAATGAGAATAAGCAAGG + Intergenic
1088559055 11:111094100-111094122 CTGTTGCAGGAGAATGACCCTGG - Intergenic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089073276 11:115717338-115717360 CTGGAGCAGGAGCAAGATCCGGG - Intergenic
1089473521 11:118739875-118739897 ATGGAGCAGGGAAAAGAGCAAGG + Intergenic
1090119587 11:124011402-124011424 ATGGATCAGGAAAATGATCAAGG + Intergenic
1091234993 11:134015661-134015683 CTGGAGCAGGAGCCTGAGGTGGG + Intergenic
1091237550 11:134032274-134032296 AGAGAGCAGGAGAATGAACATGG + Intergenic
1091356081 11:134938627-134938649 CTGGAGCAAGGGGATGAGGATGG + Intergenic
1091396079 12:154967-154989 CTGGAGGAGGTGAACCAGCATGG - Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1092154477 12:6273594-6273616 GGGGAGCAGGGGAAGGAGCAGGG + Intergenic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1092840417 12:12535171-12535193 CTGGTGGAGGAGGATGGGCAGGG - Intronic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1094141823 12:27189249-27189271 CTGAAGCAGGAGCATGCTCAGGG - Intergenic
1094472332 12:30815057-30815079 CTGAAGCAGGAGAATCAGTTGGG - Intergenic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1095826609 12:46536493-46536515 CAGGAGCAGGACCATGAGCATGG + Intergenic
1096005643 12:48168850-48168872 CTGGAGCAGCCGGAGGAGCACGG + Intronic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096103701 12:48984485-48984507 CAGGAGCTGGAGGAAGAGCAAGG + Intergenic
1096143850 12:49264763-49264785 CTGGGGCTGGAGAATGGGCCGGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096541737 12:52311732-52311754 ATGGAGCTGGAAAAGGAGCATGG - Intergenic
1096666979 12:53172437-53172459 CTGGAGAAGGAGAGTAAGCCAGG + Intronic
1096688596 12:53305669-53305691 TTTGTGCAGCAGAATGAGCATGG + Intronic
1096813005 12:54183566-54183588 GTGGAGAAGGAGCATGTGCATGG - Intronic
1096860537 12:54524199-54524221 CTGGTTTAGTAGAATGAGCAAGG + Intronic
1096878268 12:54647092-54647114 CTGGGGCAGGAGGAAGAGAAAGG + Intronic
1096975364 12:55696691-55696713 CTGGAGGAGGAGGAGGTGCAAGG - Intronic
1097038641 12:56140847-56140869 ATGGAGCAGGTGGAGGAGCAAGG + Intronic
1097736918 12:63192694-63192716 CTTTAGCAGGAGAATCATCAAGG + Intergenic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098393098 12:69990302-69990324 CAGGACCTGGAAAATGAGCAAGG - Intergenic
1098702224 12:73644163-73644185 CAGGAGGAGGACAATGTGCAAGG + Intergenic
1099621158 12:85004424-85004446 ATAGAGCATGAGAATGAGCAGGG - Intergenic
1100214410 12:92432998-92433020 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1100864499 12:98842412-98842434 CTGGAGTAGGAATAGGAGCAGGG + Intronic
1102658258 12:114501926-114501948 GGGGAGCAGGAGAAGGAGAAAGG + Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1105660003 13:22483819-22483841 CTTGAGCTGGTGAATGAGCTAGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106776083 13:33011151-33011173 CTGGAGCAGAGTAACGAGCAGGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1106978616 13:35251817-35251839 CTAGAGCAGGTGGAGGAGCATGG - Intronic
1107230127 13:38098934-38098956 CTGGAGCAAGAGAGAGAGCAGGG + Intergenic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1109595561 13:64549230-64549252 GTGGAGCAGGAGAGAGAGCGAGG - Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1112235769 13:97634862-97634884 CAGGAGCAAGAGAGAGAGCAAGG + Intergenic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1113001173 13:105639104-105639126 CAGGAGCAGGAGCAAGAGTAGGG - Intergenic
1113594520 13:111521561-111521583 CTGGAGGAGGAGAAAGACCCAGG + Intergenic
1113984934 13:114306497-114306519 CTGAGGCAGGAGAATGAACCTGG + Intergenic
1114265108 14:21069304-21069326 CTGGCGCAGGAGACAAAGCAGGG - Intronic
1114467219 14:22931539-22931561 CTGAGGCAGGAGAATGACCCAGG + Intergenic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115121250 14:29940713-29940735 CTGGAGCAGGAGGATGAGTTGGG - Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116107226 14:40525501-40525523 CTGCATCAGGTGATTGAGCAAGG - Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1117314877 14:54565197-54565219 CTGGATCTGGAGAGTGCGCAGGG - Intergenic
1117707671 14:58488666-58488688 CTGGAGGTGGAGGCTGAGCAGGG - Exonic
1118424936 14:65650474-65650496 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1118636527 14:67753248-67753270 CTGGAGCAGGGGCTGGAGCAGGG - Intronic
1118841389 14:69515680-69515702 CAGGAGCAAGAGAGAGAGCATGG + Intronic
1119757700 14:77130569-77130591 CCTGAGCAGACGAATGAGCAAGG - Intronic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1121217727 14:92261600-92261622 CTGGAGAAGGACAGTGATCAGGG - Intergenic
1121557320 14:94848260-94848282 TTGGAGGATGAGAATGAGAACGG + Intergenic
1121570274 14:94941895-94941917 TTGGAGCAGGTGAATGACTAAGG - Intergenic
1122136816 14:99638234-99638256 CTGCAGCGGGAGAATGTGCCAGG - Intergenic
1122211886 14:100178755-100178777 CTGGGGCAGGACAAAGAGCAAGG + Intergenic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122457412 14:101865103-101865125 CTGGTTCAGGGGAAAGAGCATGG + Intronic
1122498454 14:102176825-102176847 CTGAGGCAGGAGAATGAACCCGG - Intronic
1122802244 14:104237533-104237555 CTGGAGCAGGGCTCTGAGCATGG + Intergenic
1122844790 14:104486976-104486998 CTGGAGCAGAGTAATGAGAATGG - Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1123448482 15:20345847-20345869 CAGGAGCAGGAGCAGGATCAGGG + Intergenic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1124844946 15:33281172-33281194 CTGGAGCAGGAATATGGGGAAGG - Intergenic
1125407524 15:39369250-39369272 CTGGAGCAGGAGAGTGGGACAGG + Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126519011 15:49568446-49568468 TTGGTACAGGAGAATCAGCATGG + Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128171477 15:65517449-65517471 CCGGCGCAGGAGAAGGAGAAGGG + Intronic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1128680874 15:69650441-69650463 CTGGTGCAGAAGAATGAGTTAGG - Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129244184 15:74269737-74269759 CTGGGGCAGGAGAGTGGGCAGGG - Intronic
1129253860 15:74323006-74323028 CTGGAGCAGGGGTAGGAGCGGGG - Intronic
1129301053 15:74625779-74625801 CTGGAGGAGGAGGATGGGCAGGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130655868 15:85791902-85791924 CAGGAGCAGTGGAAAGAGCATGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131463974 15:92639758-92639780 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1131618818 15:94045371-94045393 CTGTAGCAGGAGATGGAACATGG - Intergenic
1131781612 15:95865813-95865835 CTGCTGCAGGAGAAAGGGCATGG - Intergenic
1132068961 15:98758605-98758627 CTGGGACAGCAGGATGAGCAGGG + Intronic
1132891898 16:2208736-2208758 CTGGAGGGGGAGATTGTGCAGGG - Intronic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133563597 16:6971942-6971964 CGGGAGAATGTGAATGAGCATGG + Intronic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134039243 16:11055355-11055377 CTGGAGCATGAGGAGGAGCCAGG + Intronic
1134090684 16:11390265-11390287 CTGGAGCTGGTGAGTGAGCAAGG - Exonic
1134395271 16:13856668-13856690 CTGCAGCAGGAGAAAGTGCTGGG - Intergenic
1134818654 16:17227743-17227765 ATGGAGCAGGAGAAAGAGTTGGG + Intronic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1135644607 16:24150740-24150762 CTGGATCAAGAGAATGAGTGTGG - Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136538872 16:30917233-30917255 CTGGGGTAGGAGATTGAGCCTGG - Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1138047121 16:53736890-53736912 CTGGGGGAGGGGAATGAGTATGG - Intronic
1138157937 16:54722991-54723013 CTGGAGGTGGAGGATGAGGATGG + Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138689712 16:58755907-58755929 CTGGAGCAGGAGAAAGAATGGGG + Intergenic
1138825570 16:60315159-60315181 CTGGAGCATGAGAAAGATCAGGG + Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140716086 16:77726963-77726985 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1140933894 16:79653129-79653151 TTGGAGCAGGACAATGAACTGGG + Intergenic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1141289814 16:82707381-82707403 CTGGCCAATGAGAATGAGCAGGG + Intronic
1141492694 16:84385234-84385256 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1141671246 16:85492869-85492891 CTGGAGCAGGTGACAGAGCAGGG + Intergenic
1143347708 17:6262161-6262183 CTGGGGCTGGAGACTGGGCAGGG - Intergenic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1143685716 17:8514145-8514167 TGGCAGCAGGAGAATGTGCAGGG - Intronic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1144535137 17:16081456-16081478 TTTGATCAGGAGAATGAGAATGG - Intronic
1144555546 17:16279634-16279656 CTGGAGCAAGAGAAGGACAATGG - Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144645859 17:16972922-16972944 CTGTGGCAGGAGAATGAACCTGG + Intergenic
1145274561 17:21421978-21422000 CAGGAGCAGGAGTGAGAGCAGGG - Intergenic
1145312414 17:21707876-21707898 CAGGAGCAGGAGGGAGAGCAGGG - Intergenic
1146290544 17:31603476-31603498 CTGGAGGATGAGAAGGGGCAGGG - Intergenic
1146348440 17:32076199-32076221 AAGGAGCAAGAGAAAGAGCAGGG - Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146785072 17:35712527-35712549 CTGAGGCAGGAGAATCAGCTTGG + Intronic
1147459854 17:40561280-40561302 TTGGAGGAGGTGGATGAGCAAGG + Intronic
1147659808 17:42111498-42111520 CTGGGGGTGGAGAATGAGCTGGG + Intronic
1147884461 17:43675501-43675523 CTGGAGGAAGAGAATGAACTTGG + Intergenic
1148629791 17:49098312-49098334 CTGGAGCAGGAGAATTGCCTGGG - Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150490106 17:65568529-65568551 CTGAAGCAGGAGAATGACATGGG - Intronic
1150653834 17:67026900-67026922 CTGGGGCAGGAGAGAGAGAAAGG - Intronic
1150940508 17:69688117-69688139 CTGGCACATGTGAATGAGCATGG - Intergenic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1151980070 17:77503371-77503393 CTGGAGCAGGAGAGGAAGCAGGG - Intergenic
1151984105 17:77530966-77530988 GTGGGGCAGGAGAATGACTAAGG - Intergenic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1153078400 18:1192450-1192472 CTGGAGCACTAAAATGGGCATGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153486091 18:5599646-5599668 CAGGAGCAAGAGATAGAGCAAGG - Intronic
1154124143 18:11674633-11674655 GTGGAGCAAGAGAAAGAGAAAGG + Intergenic
1154498534 18:14980677-14980699 CTGGAGCAAGGGGATGAGGATGG - Intergenic
1155660846 18:28246605-28246627 CTGGAGCAACAGCATGAACAGGG + Intergenic
1156074393 18:33255749-33255771 CTGGGACAGGAGATGGAGCAAGG + Intronic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1158519501 18:58159438-58159460 CTGGAGCAGGATGTTGATCATGG + Intronic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1160119849 18:76120569-76120591 CTGGAACAGTAGAATGACAAAGG + Intergenic
1160679276 19:405312-405334 CCGGGGCAGGAGAATGCGGAGGG + Intergenic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1162291097 19:9781223-9781245 CTGGGGCAGGAGAATTCGCTTGG - Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162738730 19:12761624-12761646 CTGAGGCAGGAGAATGAACCCGG - Intergenic
1163476088 19:17526992-17527014 CTGGAACAGGGGGATGGGCAGGG - Intronic
1164054892 19:21614388-21614410 CTGAGGCAGGAGAATCAGCCAGG - Intergenic
1164156996 19:22603067-22603089 CTGGAGCTGGCTCATGAGCAGGG - Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165154636 19:33779530-33779552 CTGGAGAGGGAGAATGGACATGG - Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165572127 19:36784348-36784370 CAGGAGTATGATAATGAGCACGG + Intergenic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348647 19:42182888-42182910 CTGGAGCAGGCAATGGAGCAGGG + Intronic
1166565332 19:43761765-43761787 CTGGAGCAGGGGAATTGACAGGG - Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167756707 19:51417363-51417385 CGGGGGTAGGAGAAAGAGCAGGG + Exonic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
925427411 2:3762230-3762252 CAGGAGCAGGACAAAGTGCATGG - Intronic
925803461 2:7625510-7625532 CTGGAGCAGGAGAACTGGCTGGG - Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
925871792 2:8278164-8278186 CTGGACCAGGAGCATGTGCTGGG - Intergenic
925991271 2:9256908-9256930 CTGCAGCAGGAGGATCAGGAAGG - Intronic
926133542 2:10320430-10320452 CTGGAGCAGAAGGGAGAGCAGGG - Intronic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926225013 2:10961249-10961271 CTGGAGGAGCAGAACGAGCCCGG - Intergenic
926253178 2:11167740-11167762 CCAGTGCAGGAGAACGAGCAGGG + Intronic
926410468 2:12597159-12597181 CTGGAACAGAAGCATGGGCAGGG + Intergenic
926671152 2:15578063-15578085 CTGGACCAGGAGTATTAGCATGG + Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927081398 2:19634288-19634310 CTGGAGGGGGAGCATGACCAGGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
928301944 2:30132976-30132998 GTGGACTAGGAGAATGAGCATGG + Intergenic
928345937 2:30496091-30496113 CTAGAGCAGGAGGAAGAGAAAGG + Intronic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
928792392 2:34973316-34973338 TTTGAGCAGGAAAATGAGTAAGG - Intergenic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
929032113 2:37658788-37658810 CTTGTGCAGGAGAAAGATCATGG - Intronic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929502803 2:42504627-42504649 CTAGAGCAGAAGAAAAAGCAAGG - Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930096483 2:47570395-47570417 CGGGAGCAGGAGCGTGAGGATGG + Exonic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
930940799 2:57012494-57012516 CTGGAGCAGGAGGAAGAGTTGGG - Intergenic
931370921 2:61661829-61661851 CTGGAGCAGTGGCATGATCATGG + Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931516733 2:63054518-63054540 CTGGGGCAGGCGAAGAAGCAGGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931932146 2:67150543-67150565 CTGAGGCAGGAGAATGAACCTGG + Intergenic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932598929 2:73111274-73111296 CTGGAGGAGGGGGATGAGCCTGG - Intronic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
933290259 2:80430488-80430510 ATGGAACAGGAGAAAGAACATGG - Intronic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
933537722 2:83597396-83597418 CTGGAGCAAGCCAAGGAGCATGG - Intergenic
933690838 2:85178474-85178496 AAGGAGCTGGAGAAGGAGCAGGG + Intronic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
935402350 2:102673884-102673906 CTGAGGCAGGAGAATGGGCATGG - Intronic
935662030 2:105475133-105475155 CTGAACCAGGAGGAAGAGCAGGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936082804 2:109446490-109446512 CTGGAGCTAGAGCAGGAGCAGGG + Intronic
936732407 2:115400025-115400047 CTGGAGCAGGAGCAAGAGACGGG + Intronic
937176119 2:119937128-119937150 CTGTAGCATGAGAATCAGCCAGG + Intronic
938044001 2:128100133-128100155 CTAAGGCAGGAGAATGAGAATGG - Intronic
938098525 2:128479426-128479448 CTGGAGCAGGAGAAACAGGGAGG - Intergenic
938249037 2:129799457-129799479 CTGGGGCATGGCAATGAGCAAGG + Intergenic
938292885 2:130159737-130159759 CTGGAGGAGGAGAAAGACCCTGG - Intronic
938370906 2:130767880-130767902 CTGGAGCTTGAGGAAGAGCAGGG - Exonic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939471554 2:142628394-142628416 CTGGAGGAGGAAACTGAGCTTGG - Intergenic
939667352 2:144967915-144967937 TTAGAGCAGAAGAATGAACATGG + Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
941431991 2:165424149-165424171 CTGGAGCAGGAAAGAGAGCATGG + Intergenic
943004937 2:182377308-182377330 CAGGAGCAGGAGAAAGATAAAGG - Intronic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944469082 2:200033632-200033654 CTGGAGTCGGAGAAAGAACAGGG - Intergenic
944528366 2:200642974-200642996 TTGGAGCAGGAGTCTGAGTAAGG - Intronic
944809518 2:203314357-203314379 CTAGGGCAGGAGAATGAGGTGGG + Intergenic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945135140 2:206619034-206619056 TTGAGGCAGGAAAATGAGCATGG - Exonic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946368588 2:219266501-219266523 CTGCTGCAGGATAGTGAGCAGGG - Intronic
946415527 2:219538098-219538120 CAGGAGCAGGAGAATGTGCTGGG - Exonic
946733747 2:222733883-222733905 CTGCAGCAGGAGAGTGAGTCTGG - Intergenic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948140548 2:235669733-235669755 CCGGAGCGGGAGGATGCGCACGG + Intronic
948155579 2:235778482-235778504 CTGGGGCAGGAGGAAGAGCACGG - Intronic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170532683 20:17310074-17310096 CAGGAGCAAGAGAAAGAGCAAGG + Intronic
1171415746 20:24979421-24979443 CTGAAGCAGGAGCCTGAGCTGGG + Intronic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172046166 20:32081862-32081884 GTGGGGCAGGAAAATGAGCCTGG + Intronic
1172353139 20:34259636-34259658 CTGGGGCAGGAGACTGAGGCAGG + Intronic
1172353216 20:34260225-34260247 GTGGAGCTGGAGGATTAGCAAGG - Intronic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1173631740 20:44521615-44521637 CTGGAGCTGGAGAGGGACCAAGG - Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174159471 20:48540764-48540786 GTTGAGCAGGAGAAAGAGAAGGG - Intergenic
1174468756 20:50739346-50739368 CTGAGGCAGGAGAATCAGCCAGG + Intronic
1174775821 20:53342198-53342220 CTGGAGCAGGAAAATGACGCAGG - Intronic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175547220 20:59786156-59786178 CAGAAGCTGGGGAATGAGCAGGG - Intronic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177252357 21:18611151-18611173 CTGAAGATGGAGAATGAGCTAGG + Intergenic
1177258731 21:18700665-18700687 CTGGAGCAGGAGGAAGTGCAGGG - Intergenic
1177598575 21:23280631-23280653 CTGGAGGAGAAGAATGACCCAGG - Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178454516 21:32735737-32735759 CTGGACCAGCAGTATCAGCATGG - Intronic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179485328 21:41706296-41706318 GAGGAGCAGGAGAGTGTGCAAGG + Intergenic
1179907040 21:44427797-44427819 CTGGAGCCGGAGGTTGAGTAAGG + Intronic
1180015388 21:45079047-45079069 CTGGAGGAGGAATATCAGCAAGG + Intronic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180231749 21:46430550-46430572 CAGGAGCTGGAGAGTGAGCAGGG + Exonic
1180516248 22:16147689-16147711 CTTGAGCAGGAGAAGGATCTGGG - Intergenic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181372435 22:22429037-22429059 CCAGAGCAGGAGAATGAGGCTGG - Intergenic
1181439257 22:22927384-22927406 CTGGGGCCGGGGAAGGAGCAAGG - Intergenic
1181455298 22:23056125-23056147 CTGGAGCAGGTGAATGAAGGGGG + Intergenic
1181628837 22:24139863-24139885 CTGATCCAGGAGAATGAGCTTGG - Intronic
1181958766 22:26607850-26607872 CTGGGGCTGGAGAATCAGCCAGG - Intronic
1182081344 22:27531133-27531155 GTGGATCAGGAGTCTGAGCATGG - Intergenic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182764399 22:32748275-32748297 GTGGCCCAGGAGAAAGAGCATGG + Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183011824 22:34952968-34952990 CCAGAGCAGGAGCAAGAGCATGG + Intergenic
1183086531 22:35490516-35490538 CTGGGCCAGGAGGATGGGCAGGG + Intergenic
1183680949 22:39328827-39328849 CTGGAGCAGTAGGACAAGCAAGG + Intergenic
1184186962 22:42871430-42871452 ATGGAGGACGAGGATGAGCAGGG - Exonic
1184259966 22:43309120-43309142 CTGGAGCTGGTGAAGGTGCAGGG - Intronic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
1184637648 22:45847708-45847730 GTTAAGCAGGAGAAAGAGCAGGG - Intergenic
1184864604 22:47195355-47195377 AGGGTGCAGGAGAAAGAGCAGGG - Intergenic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
949811477 3:8011494-8011516 CTGGATCAGGAGTCTGGGCATGG + Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
951569548 3:24047512-24047534 CTGCAGCAGGAACATGAGCCTGG - Intergenic
952258375 3:31714831-31714853 CTGGAGCAGAAGGATGAGCTGGG - Intronic
953061807 3:39434066-39434088 GTGCACCTGGAGAATGAGCAGGG - Intergenic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
954025602 3:47781352-47781374 CTGGCACACGAGACTGAGCAGGG + Intronic
954065791 3:48104866-48104888 TTGGAGCAGGTGAAAGAACAGGG + Intergenic
954393389 3:50279284-50279306 CTGGAGCTGGAGCATGAAAATGG - Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
954660995 3:52226713-52226735 CTGAGGCAGGAGAATGCCCAGGG - Intergenic
954940557 3:54368484-54368506 AAAGAGCAGGAGAGTGAGCACGG + Intronic
955209607 3:56928506-56928528 TTGCAGCAGGAAAATGACCATGG + Intronic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
956191220 3:66610280-66610302 CAGGGGCAGGAGGATGTGCATGG + Intergenic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956508215 3:69965203-69965225 CCGGAGGAGCAGTATGAGCATGG + Exonic
957007133 3:74962827-74962849 CCGGAGCAGGAGGATAAGGAGGG - Intergenic
957212082 3:77272393-77272415 CAGGAGCAGGAGGAAGAGAAGGG + Intronic
958672541 3:97223058-97223080 TTAAAGCAGGAGAAAGAGCATGG + Intronic
959171709 3:102852147-102852169 CTGGAGCAGGAGAAAGGGAATGG - Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959572589 3:107900671-107900693 CCTGAACATGAGAATGAGCATGG + Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960258041 3:115532787-115532809 CTGGAACATGTGAATGAGGATGG - Intergenic
961073581 3:123961334-123961356 CTGGAGCAGGAGAAAGGGAGTGG - Exonic
961131126 3:124468089-124468111 CTGTTGAGGGAGAATGAGCAAGG + Intronic
961180007 3:124869074-124869096 CTGGAGCAGGAGAATCCCCATGG + Intronic
961350093 3:126294543-126294565 GTGGGGCAGGAGGAAGAGCAAGG + Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961453970 3:127015304-127015326 CCGTACCAGGAGAAGGAGCAGGG - Exonic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
962944301 3:140153465-140153487 CTGGTGGAGAAGAGTGAGCAGGG - Intronic
963860981 3:150310104-150310126 CTGAAGCATGAGAATGAACCTGG - Intergenic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
965078901 3:164012677-164012699 CTGGAACATGAGAGTGATCAGGG - Intergenic
965152378 3:164995077-164995099 CTGCACCAGGGGAATAAGCAAGG + Intronic
965318828 3:167226013-167226035 CTGGACCAAGGGAATGAGTATGG - Intergenic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966690961 3:182740942-182740964 CTGTAACAGTAGAATGAGCAAGG - Intergenic
966958849 3:184912899-184912921 ATGGAGCAGGAGCATCAACAGGG - Intronic
967739447 3:192988996-192989018 CTGGAGAAGGAAAAAGGGCATGG - Intergenic
967967917 3:194976595-194976617 TTGGAGCAGGAGACCGACCATGG - Intergenic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968531455 4:1094134-1094156 CTGAGGCAGGAGACTGAGGATGG - Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968882148 4:3306679-3306701 CTGGTGCAGGGGACCGAGCAGGG + Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969941783 4:10739335-10739357 GTGGAGCAGGAGAGAGAGCAAGG - Intergenic
970223209 4:13831468-13831490 CAGCTGCAGGAGAATGAGTAAGG - Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
970560769 4:17280194-17280216 CTGGAGCAGGAAAATGTTAAGGG - Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
971896796 4:32606485-32606507 CTGGAGCAGGAGGATGGGGTGGG + Intergenic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
973336573 4:48962659-48962681 CTGAGGCAGGAGAATAACCAGGG - Intergenic
973589711 4:52428626-52428648 TTGGAGCATTAGAATGAGCTGGG + Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973846854 4:54921574-54921596 CTGGAGCAGGAGCAAGAGAGAGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977444333 4:97110176-97110198 CAGAAGCTGGAGAATGAGAAAGG - Intergenic
977496817 4:97785873-97785895 GTGGAGTATGAGAATCAGCAGGG + Intronic
977984092 4:103361220-103361242 CTGAAACAGGAGGAAGAGCACGG - Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978612711 4:110561437-110561459 CTGGAGCAGGAGAAAAACCTAGG + Exonic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
980503117 4:133682465-133682487 CTGGAGCTGAGGCATGAGCAAGG - Intergenic
981503235 4:145474554-145474576 GTGGAGCAGGAGAGAGAGCGAGG + Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982410146 4:155066198-155066220 CGTAAGAAGGAGAATGAGCAAGG - Intergenic
983780674 4:171666456-171666478 CAGGAGCAGGAGAAAGAAAAAGG - Intergenic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
985341068 4:188955295-188955317 TTGGAGCAGGAGACAGAGCAAGG + Intergenic
986198357 5:5558806-5558828 CTGGAGCAGGAAAACGTGCCAGG + Intergenic
986422285 5:7597454-7597476 CAGGAGCAGTAGAATAGGCAGGG + Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
987001793 5:13667364-13667386 CTGAAACAGGAGGATGTGCAAGG - Intergenic
987238816 5:15971771-15971793 CTGGAGCAGGAGTTTGAAAAGGG - Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
989034746 5:37158880-37158902 CTGAGGCAGGAGAATGAACCCGG - Intronic
989087873 5:37695151-37695173 CAGGAGCAGGAGTAAGAGAAGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989724547 5:44572605-44572627 CTGGAGCAGGCAAATGGTCAAGG - Intergenic
991371696 5:65926011-65926033 CTGGCGAAGGAGAACAAGCAGGG + Intergenic
992579630 5:78158356-78158378 CTGAAGCAGGAGAATCACCTGGG + Intronic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993160932 5:84290117-84290139 ATTGGGCAGGAGAATGAGTAGGG - Intronic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
995030736 5:107478169-107478191 CTGGATCAGGAGGAGAAGCAGGG - Intronic
995570406 5:113474268-113474290 CTGGTGTAGGAGTATGTGCAAGG + Intronic
996057580 5:118998588-118998610 CTGAGGCAGGAGAATCAGCCAGG - Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996903899 5:128575893-128575915 TTGTAGCAGGAGCAAGAGCAGGG - Intronic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997182163 5:131841322-131841344 CTGGCACATGAGAATGAGAATGG - Intronic
997806586 5:136923987-136924009 CTGTAGCAGGAGTAAAAGCAGGG - Intergenic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998461653 5:142314420-142314442 TTGGAGCGGGAGCAGGAGCAGGG + Exonic
998638286 5:143981550-143981572 CTGTTGGAGGAGTATGAGCATGG - Intergenic
999192267 5:149757170-149757192 CTGAAGCTGGAGAATCAGAAAGG + Intronic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003340448 6:5214961-5214983 CTGGAGCAGTGGCATGTGCAGGG - Intronic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003775165 6:9352280-9352302 CCAGAGCAGGAGAAAGAGGAGGG - Intergenic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004453971 6:15774150-15774172 CTGAGGCAGGAGGATGAGCAAGG - Intergenic
1004523559 6:16384712-16384734 CTGGAGCAGGAGGAAGGGAAAGG - Intronic
1004582131 6:16964663-16964685 TCGGAGCAGAAGAAAGAGCATGG + Intergenic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1005881841 6:30068144-30068166 CTGGAGCTTGAGAATGAGAGAGG + Intronic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006513156 6:34532438-34532460 CTGGGCGAGGAGGATGAGCAGGG + Exonic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1007009139 6:38397983-38398005 ATGGAGCAGGAGAAACTGCATGG + Intronic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008465755 6:51828960-51828982 CAGGAGAGGGACAATGAGCAAGG + Intronic
1009033372 6:58087159-58087181 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009208985 6:60838928-60838950 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1010901974 6:81438603-81438625 CTGGAGCAGGCAAAACAGCATGG - Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011398734 6:86937458-86937480 CAGGAGCAGGAGCATGGGCAGGG - Exonic
1011398737 6:86937464-86937486 GAGGAGCAGGAGCAGGAGCATGG - Exonic
1011528275 6:88290708-88290730 CAGGAGCAGAAGAATGCCCATGG + Intergenic
1012657197 6:101839023-101839045 CTGGTGCAGGAGCATGAACCTGG - Intronic
1012674780 6:102101686-102101708 CTAGAGCAGGAGAAAGAGAGAGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1016145231 6:140663304-140663326 CAGGAGGAGGAGAATGTTCAAGG + Intergenic
1016406964 6:143741147-143741169 CTGAGGCAGGAGAATGAGTCAGG + Intronic
1016936137 6:149450722-149450744 CTGTACCAGGAGGATGAGCCTGG + Exonic
1017072582 6:150588992-150589014 CTGGAGCAGGTGATTTTGCAGGG - Intergenic
1017315907 6:153031110-153031132 CTGGAGCAGGAGAATAAAACAGG + Intronic
1017869352 6:158473751-158473773 CTGAAGCAGGAGAATCAGTGAGG - Intronic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1019969601 7:4529567-4529589 CAGGAGCAGGAGCAAGAGAAAGG + Intergenic
1020365557 7:7377455-7377477 CTGGGGCAGGAAACTGAGGATGG + Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023854676 7:44175475-44175497 TGGGAGCAGGAGAATGAGAGGGG + Intronic
1024180115 7:46883876-46883898 GTGGAGCAGTAGAGTGATCATGG + Intergenic
1024452645 7:49565088-49565110 CTGAGACAGGAGAATGAGTAAGG + Intergenic
1024656868 7:51458356-51458378 CTGGTGGAGGAGACTTAGCAAGG - Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026433376 7:70370322-70370344 CTGGGGCAGTGGAATGGGCAAGG - Intronic
1026481246 7:70781525-70781547 CTGGAGCTGGAGACTGTGAACGG - Intronic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1028570045 7:92277038-92277060 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028738001 7:94239864-94239886 CCGGAGCAGGAGCCTGAGCTGGG + Intergenic
1029111154 7:98213605-98213627 CTGGAGCAGGAGACAGGGCTGGG + Intergenic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1030320750 7:108164573-108164595 GAGGAGCAGGAGCAGGAGCAGGG + Intronic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031371024 7:120966669-120966691 CTGGAGTATGTGAATGAGCATGG - Exonic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033844099 7:145411566-145411588 CAGGAGCATGACAGTGAGCATGG + Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1035311950 7:157975095-157975117 CAGGAGGAGGAGAATGTGCTGGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1037497639 8:19455717-19455739 CTGGAGCAGGAGGCTGAGTAGGG - Intronic
1037771343 8:21801899-21801921 CGGGTGCTGGAGAATGAGAAAGG + Intronic
1037910935 8:22743190-22743212 CTGGGGCTGGGGAGTGAGCAAGG + Intronic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038318605 8:26508710-26508732 CTGGTGCAGGATAATGAGTGTGG - Exonic
1038696949 8:29814622-29814644 CTGGTACAGGATAAAGAGCATGG + Intergenic
1038713136 8:29967183-29967205 CTGGAGCAGGAGGAAGAGCTGGG + Intergenic
1039788938 8:40858786-40858808 CAGGGGCAGGAAGATGAGCACGG - Intronic
1040385865 8:46914650-46914672 CTGGGGCAGGAGTGTGTGCAGGG - Intergenic
1040478511 8:47802574-47802596 CTGAGGCAGGAGAATGAACCTGG - Intronic
1040767548 8:50931941-50931963 CTGGAGCAGGAGCAAGAAAATGG - Intergenic
1040973581 8:53164644-53164666 TTGGGGCAGGAGTTTGAGCATGG - Intergenic
1042802228 8:72732025-72732047 CTGAAGGAGGAGATTCAGCAGGG - Intronic
1042939848 8:74096563-74096585 ATAGAGCAGGAGAGTCAGCAGGG - Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046632727 8:116637484-116637506 CTGGAGTAGGAGAGAGAGAAAGG - Intergenic
1047298665 8:123593688-123593710 CTGGAGCAGGATGATGAGTGGGG + Intergenic
1047655738 8:126974976-126974998 CTGCAGCAGGTCAATGAGGAAGG - Intergenic
1048005068 8:130412395-130412417 CAGGAGCAAGAGAGAGAGCAAGG - Intronic
1048285083 8:133135254-133135276 CTGAAGCAAGACAATGAGGATGG + Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048942674 8:139415371-139415393 CTGGAGCACAAGACAGAGCAGGG + Intergenic
1048985298 8:139731732-139731754 GTGAAGCAGGAAAATGTGCAGGG - Intronic
1049783691 8:144440477-144440499 CTGGAGCAGGAGGAAGGACAGGG + Intronic
1052904059 9:33818008-33818030 TGGGACCAGGAGTATGAGCACGG + Intronic
1053680875 9:40484415-40484437 CTGGAGAAGGACACTGGGCAGGG - Intergenic
1053706071 9:40753670-40753692 CTTGAGCAGGAGAAGGATCTGGG + Intergenic
1053930863 9:43112729-43112751 CTGGAGAAGGACACTGGGCAGGG - Intergenic
1054282838 9:63140520-63140542 CTGGAGAAGGACACTGGGCAGGG + Intergenic
1054293118 9:63315863-63315885 CCAGAGCAGGAGACAGAGCAGGG - Intergenic
1054293957 9:63319930-63319952 CTGGAGAAGGACACTGGGCAGGG - Intergenic
1054391982 9:64624419-64624441 CTGGAGAAGGACACTGGGCAGGG - Intergenic
1054416147 9:64877274-64877296 CTTGAGCAGGAGAAGGATCTGGG + Intergenic
1054503747 9:65891909-65891931 CTGGAGAAGGACACTGGGCAGGG + Intronic
1054797791 9:69318650-69318672 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1055107327 9:72526766-72526788 CAGGAGCAGGAAAAGAAGCAGGG - Intronic
1055468513 9:76589037-76589059 ATAGAGCAAAAGAATGAGCATGG + Intergenic
1055555561 9:77470122-77470144 CTGGAGGCGGAGAATGCTCACGG + Intronic
1055661404 9:78507402-78507424 CTCTAGCAGGAGAATGAAAAAGG + Intergenic
1056652419 9:88477804-88477826 CTAGAGCAGGTAAATGAGAAAGG - Exonic
1056791851 9:89631031-89631053 ATGGACCAAGACAATGAGCAAGG + Intergenic
1056947346 9:91009980-91010002 CAGGAGCAAGAGAGAGAGCAGGG - Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1058924014 9:109643972-109643994 TGGGAGCAGGAGCAAGAGCAAGG + Intronic
1059387261 9:113974338-113974360 CTGGAGCTGGAGTAGCAGCAAGG + Intronic
1059458800 9:114416534-114416556 CTGGAGGAGGAGGAAGAGAAGGG - Intronic
1059747858 9:117220281-117220303 GGGGAGCTGGGGAATGAGCAGGG - Intronic
1060438268 9:123615047-123615069 CTGGAGAATGCGAATGATCATGG + Intronic
1060625848 9:125110618-125110640 CTGGAGCAGGAGCAAGAGAGTGG - Intronic
1060785419 9:126448673-126448695 CGGGAGCAAGAGAAAGAGAAGGG + Intronic
1060799452 9:126534458-126534480 ATGGAGCGGGAGAAGGGGCACGG + Intergenic
1061138663 9:128751327-128751349 CTGGGGCTGGAGACTGAGCTGGG - Intronic
1061601461 9:131673000-131673022 CTGAAGCAGAAGGAAGAGCAGGG - Intronic
1061656862 9:132098600-132098622 TTGGAGCAAGAGAAAGATCATGG + Intergenic
1061798930 9:133103842-133103864 TTGGGGTAGGAGGATGAGCAAGG + Intronic
1062112752 9:134790985-134791007 CAGGAGCATGGGAGTGAGCAAGG - Intronic
1062212929 9:135374209-135374231 CTGGAGCAGGAGAAACAGATTGG - Intergenic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1185603646 X:1355122-1355144 GAGGAGGAGGAGAATGGGCAGGG + Intronic
1185826365 X:3255100-3255122 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1187122289 X:16421145-16421167 CTGGAGCAAGAGAGAGAGCAAGG + Intergenic
1187778066 X:22786229-22786251 TTGAAGCAGGACAATGAGCATGG - Intergenic
1188131714 X:26442903-26442925 TTGGTGCAGGAGAATGAGTGGGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188314414 X:28656205-28656227 CTAAAGGAGGAGAATGACCAGGG - Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1190084226 X:47381229-47381251 GAGGAGCAGGAGGAGGAGCAGGG + Intronic
1190116213 X:47627584-47627606 TTGGAGCAGGTGACAGAGCAAGG + Exonic
1190407865 X:50105465-50105487 CTGGTGTAGTAGAAAGAGCATGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1191207807 X:57853038-57853060 CTGGTACATGAAAATGAGCATGG - Intergenic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192527956 X:71863762-71863784 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1194388434 X:93286791-93286813 CAGGAGGAAGACAATGAGCAGGG + Intergenic
1196717892 X:118827607-118827629 CTGGAGCACGTGAAGGAACATGG + Intergenic
1198052922 X:132966005-132966027 CTGGAGCTGGATGATGATCAGGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198840982 X:140857927-140857949 TAGGACCAGGAGAATGTGCAGGG - Intergenic
1198890661 X:141392177-141392199 CTGGCACATGTGAATGAGCATGG - Intergenic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199117251 X:144007724-144007746 CTGGAACAGGAGGAAGAGAAAGG + Intergenic
1199235607 X:145488803-145488825 CAGGTGAGGGAGAATGAGCAAGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199707095 X:150437188-150437210 CTGGCACATGTGAATGAGCATGG - Intronic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic