ID: 1182265563

View in Genome Browser
Species Human (GRCh38)
Location 22:29112277-29112299
Sequence TGGCCACAGCTGCCTCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182265563_1182265569 22 Left 1182265563 22:29112277-29112299 CCAGTGTGAGGCAGCTGTGGCCA 0: 1
1: 0
2: 4
3: 30
4: 313
Right 1182265569 22:29112322-29112344 TCCCCAGCCAGCAGTAGTTATGG 0: 1
1: 0
2: 0
3: 8
4: 139
1182265563_1182265571 23 Left 1182265563 22:29112277-29112299 CCAGTGTGAGGCAGCTGTGGCCA 0: 1
1: 0
2: 4
3: 30
4: 313
Right 1182265571 22:29112323-29112345 CCCCAGCCAGCAGTAGTTATGGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182265563 Original CRISPR TGGCCACAGCTGCCTCACAC TGG (reversed) Intronic
900246507 1:1638605-1638627 TGGCCACTGAGACCTCACACAGG - Intronic
900257735 1:1705747-1705769 TGGCCACTGAGACCTCACACAGG - Intronic
900394962 1:2449620-2449642 TGGGCAGAGCTGCCCCACCCAGG - Intronic
901127985 1:6942798-6942820 TGGCCACACTGGCCTCACAGGGG - Intronic
901230410 1:7638846-7638868 GGGACACTGCTGCCTTACACAGG + Intronic
901780356 1:11590206-11590228 TGGCCACTCCAGCCTCACCCCGG + Intergenic
902239859 1:15081210-15081232 GGGCCAGGGCTGGCTCACACAGG + Intronic
903857661 1:26346240-26346262 TGGCCATAGCTCCCACACATGGG + Exonic
904339202 1:29822867-29822889 TGGCTACAGATGCCACATACAGG + Intergenic
904586631 1:31584411-31584433 TGGCCTCAGCTGCCTCATCTGGG + Intronic
905176052 1:36136007-36136029 AGGCCACAGCTCCCTCTCCCAGG - Intergenic
905651737 1:39661339-39661361 TTGCCCCACCTGCCTCATACAGG + Intronic
905722925 1:40222193-40222215 TGACCACAGCTGGGTCACTCTGG - Intronic
906150076 1:43582577-43582599 GGGCCACAGCTGTCTAAAACAGG + Intronic
906480696 1:46197423-46197445 TGGCCCTAACTGCCTCACAGGGG + Intronic
911104476 1:94119038-94119060 AGTCCACAGATGCCTCACATAGG + Intronic
914050792 1:144128370-144128392 TGGCCAGAACTGACTCACTCAGG + Intergenic
914128389 1:144837074-144837096 TGGCCAGAACTGACTCACTCAGG - Intergenic
915251196 1:154589915-154589937 TCCCCACAGCTCCCTCTCACTGG - Exonic
915980846 1:160419127-160419149 TGGCCCCCGCTGCCACACCCAGG - Exonic
917294682 1:173506297-173506319 TGGCCCAAGCTGCCTGCCACTGG - Intronic
917475046 1:175362161-175362183 TGGCCATAACTCCCTCACCCGGG - Intronic
918214541 1:182382076-182382098 AGGCCCCAGCTACCTCGCACTGG + Exonic
920032375 1:203045209-203045231 TGGCTACAACTGCCTCCCTCTGG - Intronic
920806225 1:209236510-209236532 GGGTCACAGCTGCTTTACACTGG + Intergenic
922222288 1:223617923-223617945 TGGTCACAGCTGCCTGAACCGGG + Intronic
924033419 1:239910433-239910455 TGGCCACAGCTGATTAACAAAGG - Exonic
1062858102 10:789604-789626 TGGCCAGTGCTGCCTCACGAGGG - Intergenic
1065047474 10:21757305-21757327 TGGCCACAGCTGTCACACCCTGG + Intronic
1066193128 10:33074205-33074227 TGGAAACAGCTGCCTCTCAGGGG + Intergenic
1066761152 10:38754931-38754953 TGGCCAGAACTGACTCACTCAGG - Intergenic
1066960440 10:42217491-42217513 TGGCCAGAACTGACTCACTCAGG + Intergenic
1067746375 10:48939354-48939376 TGGCCACACCTGTCACACAGGGG - Intronic
1069495683 10:68901359-68901381 TGGCCACCGCCGCCTCCCTCCGG - Exonic
1069680584 10:70282604-70282626 TTGCCACAGCTGCCTCATACTGG + Intronic
1070539957 10:77408877-77408899 AGGCCACAGCTGCCTCTCAGTGG + Intronic
1071671819 10:87616113-87616135 TGATCACAGCTACCTCACAAGGG + Intergenic
1071915705 10:90293306-90293328 TGACCACAACTGCCTGACAGGGG - Intergenic
1072555032 10:96508308-96508330 TGGCAACAGCTGCCCCAGAGAGG + Intronic
1075414038 10:122249427-122249449 TGGCCCCAGCTGCCACCAACTGG - Intronic
1076189779 10:128474977-128474999 TGGCCACAGCAGTTTCTCACTGG + Intergenic
1076656158 10:132025058-132025080 CGTCCAAAGCTGCATCACACGGG - Intergenic
1076995098 11:293933-293955 TGGCCACACCTGCCTCCCACTGG + Intronic
1077233427 11:1468781-1468803 TGGCCACAGGTGCATCATGCAGG + Intergenic
1077484607 11:2832985-2833007 TGCCCACATCTGTCTCCCACTGG - Intronic
1078319541 11:10321930-10321952 AGGCCTGAGCTGCCTCACCCAGG - Intronic
1078520122 11:12056152-12056174 TGGCCTCAGCTGCCTGCCTCTGG - Intergenic
1080391891 11:31855723-31855745 TCACCACAGGTGCCGCACACTGG - Intronic
1082825438 11:57574316-57574338 TGGTCACAGCTGCATGACTCTGG + Intergenic
1083429193 11:62605132-62605154 CGGCCACAACTGCCCCACTCGGG + Exonic
1085284350 11:75350445-75350467 TGGGCACAGCAGCCTCTCCCTGG - Intronic
1085475832 11:76788348-76788370 TGGCCCCAGCTGCCTGACCCTGG - Intronic
1086498090 11:87424683-87424705 TGGCGACTCCTGCCTCTCACTGG + Intergenic
1086645047 11:89209709-89209731 GGCCGACAGCTGCCTCATACAGG + Intronic
1089736809 11:120555321-120555343 TGGCCCTTGCTGCCTCACAGTGG - Intronic
1092124446 12:6065643-6065665 GGGCCACACCAGCCTCAGACTGG + Intronic
1092131249 12:6114746-6114768 TGCCTGGAGCTGCCTCACACAGG - Intronic
1093583259 12:20807584-20807606 AGGCCTCAGCTGCCTCCCCCTGG - Intergenic
1093916506 12:24808273-24808295 TCACCACAGCTTCTTCACACAGG + Intergenic
1094664909 12:32510003-32510025 TGGCCACAGCTGACTAGCAAAGG - Intronic
1096648733 12:53051695-53051717 TGGCCACAGCTGCTTCAGGGCGG - Intronic
1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG + Intergenic
1101030319 12:100651818-100651840 TGGCTCCAGCTGCCCCAGACAGG - Intergenic
1102199322 12:111046555-111046577 TGGCCAAAGCTGCCCCTCCCAGG + Intronic
1102895362 12:116594410-116594432 TGTCCACAGATGCCTAAAACAGG + Intergenic
1103009647 12:117448345-117448367 AGGCCATACCTGCCTCACCCTGG + Intronic
1103682031 12:122701835-122701857 TTCCCACATCTGCCTCAGACTGG - Exonic
1103683779 12:122715296-122715318 TTCCCACATCTGCCTCAGACTGG - Exonic
1104607558 12:130201104-130201126 TGGCCACTCCTGCCTCAGGCTGG - Intergenic
1105657351 13:22455538-22455560 TGGCAACAGATGCCTGACACAGG + Intergenic
1106119476 13:26847618-26847640 TGTGCACAGCTGCCTACCACAGG + Intergenic
1107040838 13:35945467-35945489 TGGCCACAGCTTCCAAACTCTGG - Intronic
1107158456 13:37197743-37197765 TTGCCACAGCTGGCTCTTACTGG - Intergenic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1113852131 13:113423851-113423873 TTGCCACTGCTGCCTCAGGCTGG - Intronic
1113871189 13:113560861-113560883 TGGCCACTGCTGCCACATCCCGG + Intergenic
1113893617 13:113749323-113749345 TGGCCTCAGGTGCCCCTCACAGG + Intergenic
1118624171 14:67642328-67642350 TGGCTACAGCTGTGTCACACTGG + Exonic
1118766554 14:68913632-68913654 TGGCCACAGCCACCTCCCAGGGG + Intronic
1118887307 14:69878343-69878365 TGGTCACAGCTGCATCACACCGG - Intronic
1120442554 14:84558796-84558818 TGGCCACAGCTGTTTCACCCTGG + Intergenic
1121720177 14:96103821-96103843 TGGGCACAGGTGGCCCACACTGG - Intergenic
1202931860 14_KI270725v1_random:45214-45236 TGGCCAGAACTGACTCACTCAGG - Intergenic
1123420660 15:20127696-20127718 TGGCCAGAACTGACTCACTCAGG + Intergenic
1123445201 15:20325831-20325853 TGGCCAGAACTGACTCACTCAGG - Intergenic
1123529885 15:21134225-21134247 TGGCCAGAACTGACTCACTCAGG + Intergenic
1124347238 15:28930948-28930970 TGACCAGAGCTGCCTCACAGGGG - Intronic
1124622275 15:31280446-31280468 GGGCCTCATCTGCCACACACTGG + Intergenic
1126503926 15:49380805-49380827 TGACCACAGCTGTGTCACAAGGG - Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127051633 15:55089914-55089936 TGCCCACAGCTGCCTGCCCCGGG + Intergenic
1128047847 15:64634825-64634847 TGGCAACAGCAGCCACACAAAGG + Intronic
1128329430 15:66745976-66745998 TGGCCACACCTGCCTGCAACAGG - Intronic
1129176941 15:73847172-73847194 GGGCCAGACCTGCCTCACACAGG - Intergenic
1129395202 15:75240541-75240563 TGGCTAGAACTGCGTCACACAGG - Intergenic
1129691604 15:77717112-77717134 TGCCCACAGCTGCCACCCAGAGG + Intronic
1129948417 15:79562440-79562462 TGGCCACTCCTGCCCCTCACTGG + Intergenic
1130542059 15:84827355-84827377 TGGCCAGAGCTGCAGCACCCCGG - Intronic
1130996159 15:88905578-88905600 TGGCCATAGCAGCCCCACCCAGG - Intronic
1131559152 15:93424366-93424388 TGCCCCCAGCTGCGGCACACTGG - Intergenic
1131880686 15:96859009-96859031 GGGCCACAGATCCCTCACCCAGG - Intergenic
1132295557 15:100731689-100731711 TCGCCACAGCTGCCATCCACTGG + Intergenic
1132314804 15:100881770-100881792 AGGCCCCAACTGCCTGACACCGG + Intronic
1132588296 16:715575-715597 TGTCCCCAGCGGCCTCACCCAGG + Exonic
1132671858 16:1105357-1105379 TGGCCACCGCTGGCTCCCAGTGG - Intergenic
1132853675 16:2035585-2035607 TGGCCACCGCCGCCGCACCCTGG + Intronic
1133221114 16:4319572-4319594 GGGCCACATCTGCCTCTCAGTGG + Intronic
1135427669 16:22353224-22353246 AGGACACAGCTGCCCCACAAAGG + Intronic
1136098801 16:27978181-27978203 GGGTCACAGCTGCCTCACTCTGG + Intronic
1136475639 16:30511446-30511468 GCGGCACAGCTGCCTCACAGAGG - Intronic
1136721561 16:32322782-32322804 TGGCCAGAACTGACTCACTCAGG + Intergenic
1136839940 16:33529070-33529092 TGGCCAGAACTGACTCACTCAGG + Intergenic
1138423037 16:56912257-56912279 TGGCCACAGCTGCCCAGCTCTGG - Intronic
1138444503 16:57054994-57055016 TGGCCACAGCTGTCTGACCCAGG + Intronic
1141629656 16:85280286-85280308 TGGCCAGAGAAGCCTCACCCTGG - Intergenic
1141833081 16:86520559-86520581 GGAGCACAGCTGCCTCACTCAGG - Intergenic
1142032245 16:87844407-87844429 TGGCCGCATCTGCCTGACTCAGG - Intronic
1142343323 16:89538033-89538055 TGGCCACACCAGCGTCACCCAGG - Intronic
1203004871 16_KI270728v1_random:194988-195010 TGGCCAGAACTGACTCACTCAGG - Intergenic
1203136421 16_KI270728v1_random:1731107-1731129 TGGCCAGAACTGACTCACTCAGG - Intergenic
1203150109 16_KI270728v1_random:1829355-1829377 TGGCCAGAACTGACTCACTCAGG + Intergenic
1143163089 17:4884205-4884227 GGGCCACAGAAGCCTCACAAAGG - Intronic
1143254557 17:5546037-5546059 TGGCCTCAGCCTCCTCACAGAGG - Intronic
1143373625 17:6455105-6455127 CAGCCACTGCTGCCTCCCACGGG - Exonic
1143600865 17:7944990-7945012 TGGCCATAGCTCACTCAGACTGG + Intronic
1143741723 17:8959252-8959274 TGACAACAGCTTCCTCCCACAGG + Intronic
1146607929 17:34277754-34277776 GGTCAACAGATGCCTCACACAGG + Intergenic
1146638065 17:34520606-34520628 TGGTCACTGCTGCCTGACAGTGG + Intergenic
1147382827 17:40065721-40065743 TGGCCACAGCTGCGGCACTAAGG - Intronic
1147938002 17:44024597-44024619 TGGCCACACCTCCCTCACAATGG - Intergenic
1149604275 17:57913852-57913874 TGGCCCCAGAAGCCTCACCCTGG + Intronic
1149641036 17:58202987-58203009 TGGCCACAGCTTCCCCCCAGAGG + Intronic
1150102626 17:62437599-62437621 TGGCCAAAGCTGATTCAAACAGG - Intronic
1150586025 17:66518823-66518845 TGACAACAGCAGCATCACACAGG - Intronic
1151780943 17:76244977-76244999 TTGCCTCACCTGCCTCACTCTGG + Intergenic
1151920432 17:77150682-77150704 TGGGCACAGCTGCCCAACATGGG - Intronic
1152182767 17:78834685-78834707 TGCCCACCTCTGCCTCCCACAGG + Intronic
1152260257 17:79262989-79263011 AGGCCTCAGCTGCCTCCCCCGGG + Intronic
1152354149 17:79798485-79798507 TGGGGACAGCAGCCTCACTCTGG + Intronic
1152522841 17:80869935-80869957 TGGCCACAGCTGTCTTCCGCTGG + Intronic
1152563876 17:81091593-81091615 TGGGCACACCTGCCTCTCTCAGG - Intronic
1153526625 18:6001058-6001080 TTGGCACAGCTGCCTGCCACAGG - Intronic
1153646688 18:7202291-7202313 TGGCCACAGCTACCAGAGACTGG + Intergenic
1155066286 18:22272037-22272059 TGGGCAGAGCTGGCTCACAGAGG - Intergenic
1156814300 18:41290665-41290687 GGACCACAGGTGCCCCACACCGG - Intergenic
1157227582 18:45880891-45880913 TGTCCCCAGGTACCTCACACTGG - Intronic
1157324856 18:46661536-46661558 TGGCAATAGCTGGCTGACACAGG - Intergenic
1157519337 18:48334625-48334647 TGGCCAGAGCTGCCATTCACAGG + Intronic
1158580730 18:58680124-58680146 TAGCCATAGTTGCCTCACAGAGG - Intronic
1159957450 18:74529944-74529966 TGGCTCCAGCAGCCTCACCCTGG - Intergenic
1160005463 18:75065697-75065719 TTGCCACAGCTGCCCACCACTGG - Intergenic
1160630317 18:80242370-80242392 TGGCCTCAGCTCCATCCCACCGG + Intronic
1161007781 19:1945017-1945039 TGGGCACAGCTAGCTCACGCTGG - Intronic
1161697323 19:5776617-5776639 GGGCCAGAGCTGGCTCAAACTGG + Intronic
1162768750 19:12936780-12936802 AGCCCACAGGTGCCTGACACAGG + Intergenic
1164241731 19:23395251-23395273 TCGCCACAGCCGCATCCCACCGG + Intronic
1166772175 19:45290453-45290475 TGGCCACAGCTGGCTGCCACTGG - Intronic
1167137857 19:47628337-47628359 TGACCACAGCAGCCTCACCTGGG - Intronic
1167478366 19:49713651-49713673 TTGCCACAGCTGGCTGACACAGG + Exonic
1167562307 19:50233143-50233165 TGGGCACAGCACCCTGACACGGG - Intronic
1202690200 1_KI270712v1_random:81009-81031 TGGCCAGAACTGACTCACTCAGG + Intergenic
925084743 2:1099315-1099337 TGACCTCATGTGCCTCACACCGG + Intronic
926151576 2:10428492-10428514 TGGCCACGGCTGGCTTACGCTGG + Intergenic
926706529 2:15841533-15841555 TGGCCACATGTGCTTCTCACTGG + Intergenic
928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG + Intergenic
928404551 2:31004641-31004663 TGGCCAGAGCAGCCTCCAACAGG + Intronic
928531964 2:32201574-32201596 TGGCCACTGCTGCCTCCCTCCGG - Intronic
929012265 2:37456724-37456746 TGGGCACATCAGCCCCACACAGG - Intergenic
931636342 2:64343922-64343944 TGCCAACAGCTGCCGGACACAGG - Intergenic
931697035 2:64879095-64879117 TGGCCTCAGCTGGCTCACTCAGG + Intergenic
931756024 2:65375314-65375336 TGGTCACAGCTACCTGAGACCGG - Intronic
933793962 2:85905476-85905498 TGCCTACATCAGCCTCACACTGG - Intergenic
933956218 2:87375004-87375026 TGGCCAGAACTGACTCACTCAGG - Intergenic
934240368 2:90267028-90267050 TGGCCAGAACTGACTCACTCAGG - Intergenic
934272823 2:91549719-91549741 TGGCCAGAACTGACTCACTCAGG + Intergenic
934324457 2:91999614-91999636 TGGCCAGAACTGACTCACTCAGG - Intergenic
934462828 2:94230307-94230329 TGGCCAGAACTGACTCACTCAGG - Intergenic
935687162 2:105694529-105694551 TGAACACAGCTGACTCACACTGG + Intergenic
935809202 2:106780135-106780157 TGGGCACAGCTGCCTGCCACAGG + Intergenic
936148896 2:109999639-109999661 TGGCCAGAACTGACTCACTCAGG + Intergenic
936195785 2:110371729-110371751 TGGCCAGAACTGACTCACTCAGG - Intergenic
937605597 2:123798144-123798166 TCTCCACAGCTGCCTGCCACTGG + Intergenic
938305960 2:130254056-130254078 TGGCCTCTCCTGCCTCACACAGG - Intergenic
938448194 2:131393715-131393737 TGGCTTCTCCTGCCTCACACAGG + Intergenic
938730042 2:134140275-134140297 CGGCCACAGCTCCCACACCCAGG - Intronic
940142528 2:150508901-150508923 TGTCAACAGCCGACTCACACTGG - Intronic
942219776 2:173757878-173757900 TGGCCTCTGCTCCCTCACCCCGG - Intergenic
943222860 2:185132829-185132851 GGGCCTCAGCTGCCTCCCACGGG + Intergenic
944216710 2:197263527-197263549 TGGAGACAGCTGCTTCACATGGG - Intronic
945063100 2:205925572-205925594 TTCCCATAGCTGCCTCCCACGGG + Intergenic
945302546 2:208227838-208227860 GGGCCTCAGCCGCCTCCCACTGG - Intergenic
946547930 2:220766167-220766189 TGGCCACAGATGCCTGAGGCTGG + Intergenic
949077494 2:242070415-242070437 CGACCACAGCTGCATCCCACGGG + Intergenic
1170893094 20:20392322-20392344 TGCCCAGAGAGGCCTCACACAGG - Intronic
1171402324 20:24882802-24882824 TGTGCACAGCTGCCTGCCACAGG - Intergenic
1172006548 20:31822420-31822442 TGGTCACTGCTCCCACACACAGG - Intronic
1172391346 20:34567482-34567504 TGGCCTCAGTTTCCTCAAACTGG - Intronic
1172425180 20:34851230-34851252 GGGCCTCAGCGGCCTGACACAGG - Exonic
1172555681 20:35839054-35839076 TAGCAACAGCTTTCTCACACAGG - Intronic
1172758886 20:37308177-37308199 TGGCCACAGCTGTCCCAAGCTGG - Intronic
1173305503 20:41844187-41844209 GAGCCACAGCTGACTCACAGTGG + Intergenic
1173352787 20:42260535-42260557 TGACCACAGCTCTCTCATACTGG - Intronic
1173895302 20:46546234-46546256 TGGCCACAGCTGGCTGGAACAGG + Exonic
1174978668 20:55364930-55364952 TTGCCACATCTTCCTCACTCTGG - Intergenic
1175124907 20:56744097-56744119 TGGCCACAGGTGTCTCATTCAGG + Intergenic
1175894441 20:62329866-62329888 TGGCTACGGCTGCCGCACCCTGG - Exonic
1176129422 20:63490399-63490421 TGCCGACAGCAGCCTCACCCAGG + Intronic
1176593889 21:8673359-8673381 TGGCCAGAACTGACTCACTCAGG - Intergenic
1178860562 21:36285638-36285660 TGCCCACATCTGCCTCAGAGAGG + Intronic
1179554693 21:42164644-42164666 TGGCCACAGTTGCCTGACTTTGG - Intergenic
1179637771 21:42724406-42724428 TGGCCACAGTTTCCTCCCAGGGG - Intronic
1179682475 21:43033310-43033332 TGCCCACTGCTACCTCACACAGG - Exonic
1179923460 21:44520152-44520174 CGGCCACAGCAGCCTCCCAATGG + Intronic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1180096281 21:45556676-45556698 TGGCCGGAGCTGCCACAGACAGG + Intergenic
1180276742 22:10650486-10650508 TGGCCAGAACTGACTCACTCAGG - Intergenic
1180583962 22:16869394-16869416 TGGCCAGAACTGACTCACTCAGG - Intergenic
1181352784 22:22270381-22270403 TGGCCAGAACTGACTCACTCAGG + Intergenic
1181482305 22:23207982-23208004 TGGGCACACCTGCCTCAGCCAGG - Intronic
1181866751 22:25864121-25864143 TTTTCACAGCTGCCTCACCCTGG + Intronic
1182265563 22:29112277-29112299 TGGCCACAGCTGCCTCACACTGG - Intronic
1182340902 22:29620013-29620035 TGGCCACCCCGGCCTCCCACTGG - Intronic
1182921985 22:34088696-34088718 TGGCCACAGATGCAGCCCACAGG + Intergenic
1183440149 22:37818363-37818385 TGGCCACAGCTACCCCAGCCAGG - Intergenic
1183984589 22:41562479-41562501 TGGCCACAGATGGCTCTCCCAGG + Intronic
1184347250 22:43921511-43921533 TGCCCACATCTGGGTCACACTGG + Intergenic
950155053 3:10715733-10715755 TGGCCCCAGCTGGCTCATCCCGG - Intergenic
950850245 3:16055363-16055385 TGGCCTCGGCTGCCTGTCACTGG - Intergenic
951415456 3:22417169-22417191 GGGCCTCAGCTGCCTCCCCCCGG + Intergenic
954283735 3:49603052-49603074 TGGCCATACCTGCCTCTCACTGG + Intronic
954754930 3:52833989-52834011 TGGCTGCTGCAGCCTCACACTGG + Intronic
955794859 3:62624885-62624907 TGGCCACAGCTGCTTGATCCAGG + Intronic
956183927 3:66544800-66544822 TGGCCTCAGCTGCCTCCCTGCGG - Intergenic
959391770 3:105783738-105783760 TGGCCAGAACTGCATCACCCTGG - Intronic
961739029 3:129020932-129020954 TGGCCACGGCAGCCTCACCCTGG - Intronic
962350234 3:134651030-134651052 TGCGCGCAGCTGCCCCACACGGG + Intronic
963290787 3:143485104-143485126 TTGGCACAGCTGCCTGCCACAGG - Intronic
964444436 3:156744007-156744029 TGCCCAGAGCTGCCACACACAGG - Intergenic
964693547 3:159481144-159481166 TGGCCTCAGAGGCCTGACACTGG + Intronic
968654934 4:1774382-1774404 AGGCCACAGCGGCCTCAGCCAGG + Intergenic
969080919 4:4617373-4617395 TGGACTCAGCTGCCTCTCACGGG - Intergenic
969271733 4:6107857-6107879 TGGCAACAGCTGCCCCTCAAAGG + Intronic
969388543 4:6873445-6873467 TGGCCACAGCTGTGCCACAGAGG + Intronic
969575484 4:8033924-8033946 TGGCCACAGAGCCCTCCCACAGG + Intronic
971792337 4:31185110-31185132 GGGCCACAGCTGCCCCACCATGG - Intergenic
972867778 4:43255936-43255958 TGGCCAGAGCTGTTTCACCCTGG + Intergenic
973290294 4:48464261-48464283 GGGCCACAGCCTCCTCACAAAGG - Intergenic
973341216 4:49006725-49006747 TGGGCACAGAGGCCTCACAGAGG - Intronic
974514943 4:62897086-62897108 TGGCTACAACTGCTTCACAAGGG - Intergenic
975243803 4:72094565-72094587 CTGCCTCTGCTGCCTCACACAGG + Intronic
975278890 4:72537165-72537187 TGTGCACAGCTGCCTGCCACAGG - Intronic
975364913 4:73518228-73518250 TGCCAACAGATGCCTCATACAGG - Intergenic
979208042 4:118064964-118064986 TGGCCACATCTCTCTCAAACTGG + Intronic
979949499 4:126874598-126874620 GGGCCTCAGCTGCCTCCCGCAGG - Intergenic
980902521 4:138918503-138918525 CGGCAACAACAGCCTCACACTGG + Intergenic
981352056 4:143742749-143742771 TGGCCACAGCTGACTGGAACAGG + Intergenic
983486381 4:168335887-168335909 AGGCCACAGTTGCCTCAAAGTGG + Intergenic
983656754 4:170091446-170091468 AGGCCTCAGCTGCCTCCCAGCGG + Intronic
983843161 4:172482015-172482037 TGGCCTCAGCTGCCTCCCGGTGG - Intronic
984124351 4:175787854-175787876 TGACTACAGCTGGCCCACACTGG + Intronic
984765837 4:183399730-183399752 AGGCCACAGCGGCCTCCCAAAGG + Intergenic
985551892 5:537950-537972 TGGGCACAGCTGCCCTGCACAGG + Intergenic
985570831 5:643884-643906 GGGCCACCGGTGCCTCACACTGG + Intronic
986508170 5:8474277-8474299 TGGCCAGAGCTGTTTCACTCTGG + Intergenic
989127976 5:38075289-38075311 TGGCCACAGCTGCTGCCCACTGG - Intergenic
991166536 5:63569779-63569801 TGGCCAGAGCTGTTTCACCCTGG - Intergenic
991505440 5:67319079-67319101 GGGCCTCAGCTGCCTCACTGTGG + Intergenic
991622983 5:68565579-68565601 CTGCCACTGCTGCATCACACAGG - Intergenic
993005708 5:82426110-82426132 TGACCACAGTTCCCTTACACAGG - Intergenic
996516972 5:124381557-124381579 TGCACACAGCTGCCTGCCACAGG - Intergenic
997574449 5:134963274-134963296 TGACCACACCTGCCTCTCCCTGG - Intronic
999704286 5:154257338-154257360 TGACCAAAGCTGCCTCACCCTGG + Intronic
1002099135 5:176848733-176848755 AGGCTTCAGCTGCCTCACCCAGG + Intronic
1002102490 5:176864299-176864321 TGGCCACTGCTGCCTGCCCCGGG - Intronic
1003180694 6:3788821-3788843 AGGGCAGAGCTGCCTCTCACTGG + Intergenic
1004425983 6:15507436-15507458 TGGACACAGCTGCCACAGGCAGG - Intronic
1006803881 6:36776465-36776487 GGGCCACAGCTGCCCCTGACTGG + Intronic
1006878162 6:37316431-37316453 TGGCCAGAGCGGCCCCACAAAGG + Intronic
1007606264 6:43120274-43120296 GGGGCACAGATGTCTCACACTGG + Intronic
1010090906 6:71980512-71980534 TGGCCTCAACTGCCTTTCACAGG - Intronic
1011193314 6:84757025-84757047 AGGCCACTGCTGCCTCAGAGTGG - Intronic
1011597326 6:89028458-89028480 TTGCCCCAGGTGCCTCACATAGG + Intergenic
1013270246 6:108538313-108538335 TGGCGACCACTGCCCCACACTGG - Intergenic
1013647501 6:112159992-112160014 TGGGCACAGCTGCTTAATACTGG + Intronic
1014726510 6:124978251-124978273 TGGCCACTGCTGCCTCTGCCTGG + Intronic
1015507902 6:134008158-134008180 TGGCCAGAGCGGCCTCTCCCTGG - Intronic
1016119223 6:140327064-140327086 TGGCCAGAGCTGTTTCACCCTGG + Intergenic
1018478592 6:164167896-164167918 GGCCCACAGCTGCCTCACTCAGG - Intergenic
1019918094 7:4145955-4145977 TGGGCACAGCTTCCTCAATCAGG + Intronic
1022031124 7:26492626-26492648 TAGCCCCAGCTGCCTCTCCCTGG + Intergenic
1023004186 7:35845173-35845195 TGACCACCCCTGCCTCACAGAGG + Intronic
1023504104 7:40882093-40882115 TGACCAGATCTGCCACACACAGG + Intergenic
1023749733 7:43360820-43360842 TGGCCATAGCTGTCTCTCCCTGG + Intronic
1025263381 7:57437682-57437704 TGGCCACAGCGGCCACAGCCAGG - Intergenic
1025740506 7:64192289-64192311 TGGCCACAGCGGCCGCAGCCAGG - Intronic
1026909971 7:74085759-74085781 TGGCCGCAGCTTGCACACACGGG - Exonic
1026942234 7:74293801-74293823 TGGCCAGGGCTGCCTGCCACTGG + Intronic
1027748575 7:82110705-82110727 TGGCCACAGCCTTCTTACACAGG + Intronic
1029277885 7:99418375-99418397 GGGCCACAGCTGCCTTTCAGAGG - Exonic
1029553044 7:101248327-101248349 TGGCCACAGCTCCGCTACACAGG + Intronic
1031128894 7:117807973-117807995 TGGCAATAGATGCCTCAGACAGG - Intronic
1031971643 7:128068928-128068950 TGGGCCCTGCTGCCTCACAGTGG - Intronic
1032031830 7:128490788-128490810 TGGCCAAAGCTGATTCAAACAGG - Intronic
1032437141 7:131909545-131909567 GGGCCTCAGCTGCCTCCCGCGGG + Intergenic
1032676798 7:134137040-134137062 TGGCCACAGCCTCCTCTCTCAGG - Exonic
1034429425 7:151033791-151033813 GGGCCTCTTCTGCCTCACACAGG - Exonic
1034557127 7:151857348-151857370 TGGGCACAGCCCCCTCTCACAGG - Intronic
1035795072 8:2348404-2348426 TTGCCACAGCTTGCTCACCCAGG + Intergenic
1036403923 8:8437185-8437207 TGCCCACATCTGCCTCCCAAAGG - Intergenic
1037560125 8:20065996-20066018 TGGCCACAGCGGCCTGGCAGTGG + Intergenic
1040072590 8:43200734-43200756 TGGCCACGTTTTCCTCACACAGG - Exonic
1040759237 8:50818045-50818067 TGGCCACAACAGAATCACACTGG - Intergenic
1043857018 8:85275421-85275443 TGGCCACTGTTGACTCATACGGG + Intronic
1044291559 8:90477282-90477304 TGGCAATAGCTGCCTGACATTGG - Intergenic
1045780063 8:105852199-105852221 TGACCACAGCTGCATAAAACTGG + Intergenic
1045872645 8:106943792-106943814 TGGGCTCACCTGCATCACACAGG + Intergenic
1047526503 8:125638525-125638547 GGGCAACATCTGCCTCACCCGGG - Intergenic
1048138124 8:131766059-131766081 TGGCCACAGCTGCCAAGGACTGG - Intergenic
1048716970 8:137281768-137281790 AGGCCACAGCTGCCAGACAAAGG + Intergenic
1052089038 9:24304303-24304325 TGTGCACAGCTGCCTGCCACAGG + Intergenic
1052273739 9:26655263-26655285 AGGCCAAAGCTGCCTTCCACAGG - Intergenic
1053940025 9:43238976-43238998 TGGCCAGAACTGACTCACTCAGG - Intergenic
1056803295 9:89708925-89708947 TGGCCACACCATCCTCACAATGG + Intergenic
1057210189 9:93196950-93196972 TGTCCACAGCTCCCACACCCAGG + Intronic
1057805275 9:98215478-98215500 TGGTCACATCTGCCTTATACTGG - Intronic
1058153501 9:101486837-101486859 TGGCCACAGCTGGCACAAGCAGG - Intronic
1058744590 9:107977478-107977500 TGACCACAGCTGGCTCTCATTGG - Intergenic
1059764164 9:117367637-117367659 TGGTCACAGCTGCCTCCCTAGGG + Intronic
1061368715 9:130186078-130186100 TGGCCACACATGCCCCCCACAGG - Intronic
1061575597 9:131503828-131503850 CGGCCACAGCTACCTGACCCTGG - Intronic
1061847424 9:133395475-133395497 TGGCCACACCTGGCTCTCCCTGG + Intronic
1061880894 9:133568390-133568412 CGGCCTCGGCTGCCTCGCACAGG - Exonic
1061892454 9:133629965-133629987 TGGTGACAGCTGTCCCACACAGG + Intergenic
1062030789 9:134361034-134361056 TGGCGAGTGCTGCCTCACCCCGG + Intronic
1203624023 Un_KI270749v1:153589-153611 TGGCCAGAACTGACTCACTCAGG - Intergenic
1186209508 X:7234567-7234589 AGGCCAGAGCTGCCTCTGACTGG - Intronic
1186404548 X:9290453-9290475 TGGCCACATCTGCCTCACTGGGG - Intergenic
1186811858 X:13198169-13198191 TGGCAACATCTGCAGCACACAGG - Intergenic
1189196681 X:39159535-39159557 TGGCCACGGCTGACTCACCAAGG + Intergenic
1189295548 X:39915120-39915142 TGACCACAGCTGCCTCACTCTGG - Intergenic
1195378491 X:104250295-104250317 AGGTCACATGTGCCTCACACTGG - Exonic
1196556170 X:117087086-117087108 TGCAGACAGCTGCCTCACTCAGG + Intergenic
1197268841 X:124404295-124404317 TGGCCACATCATCCTAACACTGG + Intronic
1197308761 X:124878254-124878276 TCGTCATAGCTGCATCACACTGG - Intronic
1198939142 X:141934039-141934061 TGGCCAGAGTTGCCACACACTGG + Intergenic
1199312528 X:146337921-146337943 TGGCCACAGCTGTGTTACTCTGG - Intergenic
1199697407 X:150352613-150352635 TGCCCAGAGCTGGATCACACAGG - Intergenic
1200297097 X:154931199-154931221 AGGCCACAGCTCCATCACAGTGG - Exonic