ID: 1182269046

View in Genome Browser
Species Human (GRCh38)
Location 22:29141957-29141979
Sequence TCCCTAAGGTCCCCTGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182269046_1182269051 1 Left 1182269046 22:29141957-29141979 CCTGCTTCAGGGGACCTTAGGGA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1182269051 22:29141981-29142003 TGTCATCAACCAGGGACTTCGGG 0: 1
1: 0
2: 1
3: 10
4: 113
1182269046_1182269048 -8 Left 1182269046 22:29141957-29141979 CCTGCTTCAGGGGACCTTAGGGA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1182269048 22:29141972-29141994 CTTAGGGATTGTCATCAACCAGG 0: 1
1: 0
2: 0
3: 5
4: 61
1182269046_1182269053 3 Left 1182269046 22:29141957-29141979 CCTGCTTCAGGGGACCTTAGGGA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1182269053 22:29141983-29142005 TCATCAACCAGGGACTTCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1182269046_1182269052 2 Left 1182269046 22:29141957-29141979 CCTGCTTCAGGGGACCTTAGGGA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1182269052 22:29141982-29142004 GTCATCAACCAGGGACTTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1182269046_1182269050 0 Left 1182269046 22:29141957-29141979 CCTGCTTCAGGGGACCTTAGGGA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1182269050 22:29141980-29142002 TTGTCATCAACCAGGGACTTCGG 0: 1
1: 0
2: 2
3: 7
4: 100
1182269046_1182269049 -7 Left 1182269046 22:29141957-29141979 CCTGCTTCAGGGGACCTTAGGGA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1182269049 22:29141973-29141995 TTAGGGATTGTCATCAACCAGGG 0: 1
1: 0
2: 1
3: 5
4: 83
1182269046_1182269055 11 Left 1182269046 22:29141957-29141979 CCTGCTTCAGGGGACCTTAGGGA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1182269055 22:29141991-29142013 CAGGGACTTCGGGGGAAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182269046 Original CRISPR TCCCTAAGGTCCCCTGAAGC AGG (reversed) Exonic
902782697 1:18714990-18715012 TCCCTGGGGTCCCCTGCAGGAGG + Intronic
903356310 1:22750039-22750061 CCCCCAAGGCCCCCTGAAGAAGG + Intronic
903364364 1:22796830-22796852 TCCTTACAGTCCCCAGAAGCTGG + Intronic
907464035 1:54623441-54623463 TCCCTGAGGCTCCCTGCAGCTGG + Exonic
910412444 1:86961762-86961784 TCCCTAACCTCCCCCTAAGCAGG + Intronic
911460276 1:98180903-98180925 TCCCTCAGATGTCCTGAAGCAGG - Intergenic
912561141 1:110552372-110552394 TCCCTAAGTCACCCTCAAGCAGG + Intergenic
921133952 1:212243579-212243601 TCCCTGGGTTCTCCTGAAGCAGG + Intergenic
1067242673 10:44509344-44509366 TCCCTAAGGGCAGCTGAGGCAGG - Intergenic
1070763708 10:79044369-79044391 TCCCTGGGGCCCCCAGAAGCAGG - Intergenic
1071708780 10:88028245-88028267 TCCCTTAGGTCCTCTGAATCTGG + Intergenic
1071739430 10:88340219-88340241 TTCCTAAGGCACCCTGCAGCAGG - Intronic
1081849384 11:46264740-46264762 TCACTAAGCTCCCCTGCACCAGG - Intergenic
1088458483 11:110058303-110058325 CCCCTAAGTGCCCCTGTAGCAGG + Intergenic
1088918847 11:114247131-114247153 GCCCTACTGTCCCCTGAAGAGGG + Intronic
1089593601 11:119560591-119560613 TCCCCAAGGTCCTCTGAATTAGG - Intergenic
1095412563 12:41940091-41940113 TCCCCAGTGTCCCCTGTAGCAGG + Intergenic
1101315390 12:103624190-103624212 TCCATAAGGTCCTCTTAGGCAGG + Intronic
1102051435 12:109864960-109864982 TGCCTCAGCTCCCCAGAAGCTGG + Intronic
1109284847 13:60397583-60397605 TCCCCTAGGTCCCCTGGAGGCGG + Intronic
1112155179 13:96809497-96809519 GCCCTCAGGTCCACTGAAGAGGG + Intronic
1113244347 13:108377698-108377720 CCCCTGACCTCCCCTGAAGCTGG + Intergenic
1115909184 14:38236495-38236517 TCCCTGAGGTTCCCTGATGAGGG + Intergenic
1118103399 14:62630526-62630548 GCCTGAAGATCCCCTGAAGCAGG - Intergenic
1118449033 14:65880471-65880493 TCCCTAGGAACCCCAGAAGCTGG - Intergenic
1118817400 14:69323174-69323196 TCCCTTTGCTCCCCTGGAGCGGG - Intronic
1119522073 14:75294000-75294022 TCCCTGAGGTCCCTGGAAGCCGG - Intergenic
1119912726 14:78364989-78365011 TCCCTAAGTTCCACTGTACCTGG + Intronic
1128523317 15:68389883-68389905 AGCCTTTGGTCCCCTGAAGCAGG - Intronic
1128675544 15:69605747-69605769 TCCCAACTGTCCTCTGAAGCAGG + Intergenic
1128820891 15:70652215-70652237 TCCTTAAGGACCACTGAAGAAGG + Intergenic
1130199301 15:81810322-81810344 TGCTTAAGGTCACCTGAAGCAGG - Intergenic
1131512794 15:93058683-93058705 ACCCTCAGGTACCCTGAAGGGGG + Intronic
1132357031 15:101179458-101179480 TCCCTTAGCTCCCTGGAAGCAGG - Intronic
1136269203 16:29138559-29138581 CCCCTTTGCTCCCCTGAAGCAGG - Intergenic
1138448147 16:57077617-57077639 TCTCTTAGGCCCCCTGAAGCAGG + Intronic
1144170626 17:12656541-12656563 TTTGTAAGGTCACCTGAAGCAGG + Intergenic
1145884918 17:28375207-28375229 TCATTAAGATCCCCTGAAGGGGG - Intronic
1147918205 17:43900933-43900955 TCCCTCGGGTCTCCTGAAGCTGG - Intronic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1152601334 17:81263709-81263731 TCCCACGGGTCCCCTCAAGCTGG - Intronic
1153235333 18:2980672-2980694 TTCCTGGAGTCCCCTGAAGCTGG + Intronic
1153477096 18:5509012-5509034 TCCCTACTGGCCTCTGAAGCTGG - Intronic
1153725820 18:7953765-7953787 TCTCTGAGGTCCTCTGCAGCAGG + Intronic
1155421560 18:25662166-25662188 TCCCTAACGTCTCCGGAATCAGG + Intergenic
1159918101 18:74203686-74203708 TCCCCCAGCTCCCCTGAAGCTGG - Intergenic
1161720248 19:5898269-5898291 TCCCATGGGTCCCTTGAAGCTGG - Intronic
1161753015 19:6110880-6110902 TCCCTTGGGTCCCCTAAAACTGG - Intronic
1162174991 19:8823798-8823820 GCCCGAATGTCCCCTGGAGCAGG - Intronic
1163554023 19:17982548-17982570 TCCCTAAAGTCCAGTGGAGCGGG - Intronic
1164557003 19:29261007-29261029 TCCCTTGGGTCCCCATAAGCTGG + Intergenic
1165484108 19:36084864-36084886 TCGGTAAGGGCCCCTGTAGCTGG + Intronic
1166012149 19:39950421-39950443 TACCTAAGGTCACCTCAAGGTGG + Intergenic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
932347809 2:71007188-71007210 TTTTTGAGGTCCCCTGAAGCGGG + Intergenic
934520389 2:95016703-95016725 TCCCTCAGGACCCCTGAACCAGG + Intergenic
934942402 2:98512066-98512088 TTCCTAACCTCCCCTGAGGCTGG - Intronic
936449145 2:112620379-112620401 TCCCTGAGGATGCCTGAAGCTGG - Intergenic
936463969 2:112730690-112730712 TCCCATAGGTCCCCTTTAGCTGG + Intronic
938461738 2:131501859-131501881 TCTCTATGGGCCCCTGGAGCAGG + Intergenic
942413786 2:175737444-175737466 GCCCTCGGGTCCCCTGAATCTGG + Intergenic
943228283 2:185209651-185209673 TCCCAAAGTGCCCCTGCAGCAGG - Intergenic
944288646 2:197979176-197979198 TCCCAAAGGGCCTCAGAAGCCGG - Intronic
944474107 2:200086532-200086554 TCCTTAGGGTCCCTTGAAGATGG + Intergenic
946005325 2:216520065-216520087 TCCCTAAGCTCCACTGTGGCTGG + Intronic
948836192 2:240627081-240627103 TCCCCACGGTCCCCGGCAGCGGG + Intronic
1169192413 20:3666640-3666662 TCCCCAGGGTCCCTTGTAGCTGG + Intergenic
1169193052 20:3669795-3669817 TCCCAAGGCTCCCCTGAAGAGGG - Intronic
1170533778 20:17320301-17320323 TCCCTAAGGTGCACTGTAGGAGG - Intronic
1172033674 20:31997666-31997688 TCCCTAAATTCCCCTGACCCAGG + Exonic
1174120678 20:48262955-48262977 GCTCTAAGTTCCCCTGAAGCAGG - Intergenic
1180595124 22:16967981-16968003 CCCATGAGGTCCCCTGGAGCAGG - Intronic
1181431278 22:22883150-22883172 TTCCTAGGGACCCCTTAAGCGGG + Intronic
1181672699 22:24433132-24433154 TGCCTCAGGAACCCTGAAGCTGG + Exonic
1182269046 22:29141957-29141979 TCCCTAAGGTCCCCTGAAGCAGG - Exonic
1182779364 22:32855385-32855407 TGACCAAGGTCCCCAGAAGCAGG - Intronic
1184308949 22:43628641-43628663 TCCCTGCGATACCCTGAAGCAGG - Intronic
1184329392 22:43817163-43817185 TCCCTTAGGTGCCCTGCAGTGGG + Intergenic
950857747 3:16121295-16121317 CCCCCAAGGTCCCCTGAATCCGG - Intergenic
956879149 3:73492567-73492589 TCTCTAAGCTCCTGTGAAGCGGG - Intronic
958486612 3:94719825-94719847 TCCCTAAGGCTTTCTGAAGCGGG - Intergenic
959625534 3:108445619-108445641 TACATAAGGCCCCCTGAAGAGGG + Intronic
961357657 3:126349283-126349305 CCCCCAAGGTCCCCTGGAGTGGG - Intronic
968037309 3:195558778-195558800 TCCAGAAGGCCCCCTGGAGCTGG + Intergenic
971371546 4:26023333-26023355 TTCCTAAGCTCCCTGGAAGCTGG + Intergenic
972283823 4:37629544-37629566 TCCCTAAGGTCACCAGTAACTGG + Intronic
973810578 4:54566231-54566253 TCCCTAAGATCCCTTTAATCTGG - Intergenic
981469348 4:145112518-145112540 TTCCTAAGCTCCCTGGAAGCGGG - Intronic
984759393 4:183350692-183350714 TCCCATGGGTCCCCTGAAACGGG + Intergenic
989156963 5:38353450-38353472 TTCCTAAGGCTCTCTGAAGCTGG + Intronic
995138703 5:108708262-108708284 TGCCTCAGTTCCCCTGAAGCTGG - Intergenic
997231866 5:132251377-132251399 TCCCTATGGCCCCCTGCACCTGG + Intronic
998239021 5:140426241-140426263 TGCCTCAGGTCCCCAGTAGCTGG + Intronic
998850056 5:146343606-146343628 TTCCTAAGATCACCTGGAGCAGG + Intergenic
999722058 5:154405589-154405611 TCCCCATGGTCCCTTGTAGCCGG - Intronic
1002388980 5:178894616-178894638 TTCCTAACGTCCCCTGAAGCAGG - Intergenic
1004316202 6:14590170-14590192 TCACTAAGGTCCCCAAAGGCAGG - Intergenic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1021769330 7:23983158-23983180 TCCATGAGGTCCCGTGAGGCAGG - Intergenic
1023576528 7:41634357-41634379 TCCCTAAGTTCCCCTAAGACTGG + Intergenic
1026739043 7:72967013-72967035 TCCCCAAGGTCACCAGAATCAGG + Intronic
1026790062 7:73325645-73325667 TCCCCAAGGTCACCAGAATCAGG + Intronic
1027104690 7:75398060-75398082 TCCCCAAGGTCACCAGAATCAGG - Intronic
1031564805 7:123282482-123282504 TACCTAAGGTCAACTCAAGCTGG + Intergenic
1034825511 7:154258669-154258691 TCCCTCAGGGCCCCTGGAACAGG + Intronic
1035036406 7:155897985-155898007 TCCCTGAGGCTCCCTGCAGCTGG - Intergenic
1035239197 7:157519054-157519076 TCCCCAAGCTCCCCAGAACCAGG - Intergenic
1038005654 8:23427738-23427760 CCCCTAGCGTCCCCTGCAGCAGG + Intronic
1039640036 8:39209606-39209628 TCTGTAAGGTCCTCTGAAGAAGG - Intronic
1040512340 8:48106188-48106210 TCCCTGAGGTGCTCTGAAGCTGG + Intergenic
1040590486 8:48788163-48788185 TCCCTGAGGTGCCCAGAAGCTGG - Intergenic
1043434124 8:80222029-80222051 TCCCTCAGCTCCCATGCAGCTGG + Intronic
1047029621 8:120862300-120862322 TCTGTAAGGTCCCCTGAGACAGG + Intergenic
1049020026 8:139950115-139950137 CCCCCACGGTCACCTGAAGCTGG - Intronic
1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG + Intergenic
1049581439 8:143412928-143412950 TCCCCAGGGTCCCCTGTGGCTGG - Intergenic
1050622292 9:7467038-7467060 TCCCTCAGGTTCCCAGGAGCAGG - Intergenic
1056617183 9:88178656-88178678 ACCCAAAGAACCCCTGAAGCAGG - Intergenic
1057207963 9:93184622-93184644 TCCCTGAGGGCCCCGGAGGCCGG - Intergenic
1058160431 9:101564483-101564505 GCCCTATGGTCCCCTGGTGCTGG - Intergenic
1059718110 9:116932402-116932424 TTCCTAACTTTCCCTGAAGCTGG + Intronic
1186778479 X:12889546-12889568 TCCCTATGGAACCCAGAAGCAGG - Exonic