ID: 1182273793

View in Genome Browser
Species Human (GRCh38)
Location 22:29172030-29172052
Sequence GGCAATGGGGAGCCACGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182273793 Original CRISPR GGCAATGGGGAGCCACGAGG AGG Intergenic
900151209 1:1180050-1180072 GCCAATGGGGAGCAGCCAGGAGG + Exonic
900792211 1:4688076-4688098 AGCAGTGGGGAGCCAGGATGGGG + Intronic
901239876 1:7686603-7686625 GTCAGTGGGGAGCCACGGGAGGG + Intronic
901770929 1:11530054-11530076 GCCATTGAGGAGCCAAGAGGGGG - Intronic
902215576 1:14932369-14932391 GACAGTGGAGAGCCACGTGGGGG + Intronic
902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG + Intergenic
902894462 1:19469216-19469238 GGGAAGGGGGAGCCACAAGCTGG + Intronic
903001648 1:20270487-20270509 AGCAATGGGAAGCCACCAAGAGG - Intergenic
903661887 1:24983525-24983547 GGCAGTAGGGAGCCACGGGAGGG + Intergenic
904013292 1:27402490-27402512 GCCACTGGGCAGCCAGGAGGGGG + Intergenic
904561161 1:31398107-31398129 GGCACTGGGGATACAAGAGGGGG + Intergenic
905783153 1:40730443-40730465 GGTAATAGGGAGGCCCGAGGTGG + Intronic
905885706 1:41490761-41490783 GGAAAGGGTGAGCCACCAGGAGG + Intergenic
908519370 1:64926375-64926397 GGCAGTGTGGAGCCACTTGGGGG - Intronic
911868419 1:103058671-103058693 GGCAATAGAGAGCCTCAAGGAGG + Intronic
915636884 1:157193795-157193817 GGAAATGCAGAGCCACGAGGGGG + Intergenic
915671258 1:157490771-157490793 GAAAATGCAGAGCCACGAGGGGG - Intergenic
915751190 1:158212650-158212672 GGCAGAGAGGAGCCCCGAGGTGG + Intergenic
916075897 1:161199891-161199913 GGAAATGGGGAGTCAGGAAGTGG - Intronic
917384019 1:174448692-174448714 GGCACTGGTGAGCCAAGACGTGG - Exonic
917472465 1:175337383-175337405 GGCAATGAGGAGCCCCAAGATGG + Intronic
917972884 1:180219904-180219926 GGCACTGGTGAGCCAGGAGGAGG - Intergenic
918111429 1:181458297-181458319 AGGAATGGGGAGCCAGGTGGTGG - Intronic
918872098 1:189988271-189988293 GGGAAGGAGGAGCCAAGAGGAGG - Intergenic
920010717 1:202865515-202865537 GGGAATGAGGAGATACGAGGTGG + Intergenic
1063114486 10:3064226-3064248 GGCCACGGGGAGCCACTGGGAGG - Intergenic
1063126791 10:3142835-3142857 GGCAGTGGGGAGAAACCAGGTGG - Intronic
1064191932 10:13214179-13214201 GGCAATAGGGAGATAGGAGGAGG - Intergenic
1067478434 10:46580771-46580793 AGCCATCGGGAGCCAGGAGGAGG - Intronic
1067553233 10:47249573-47249595 GGCAGTGGGGATCCAAGAGGTGG + Intergenic
1067616303 10:47761030-47761052 AGCCATCGGGAGCCAGGAGGAGG + Intergenic
1069775878 10:70926794-70926816 GGAAATGGGGAGGCAGGAGCTGG + Intergenic
1069988188 10:72298166-72298188 GCCAATGAGGAGCCTCGTGGGGG + Intergenic
1071605684 10:86986297-86986319 GGCAATGGGGAGAATCGAAGAGG - Intergenic
1072739038 10:97898622-97898644 GGCAATGGGGAGCTTCTAGAAGG + Intronic
1072809226 10:98446565-98446587 GGCAAACGGGAGCCCCGCGGCGG - Intronic
1072957066 10:99896572-99896594 GACAATGGGCAGCCAGGAGAGGG + Intronic
1073117772 10:101101678-101101700 GGCAATGAGGAGCCACCAGAGGG + Intronic
1073122732 10:101132170-101132192 GGCTTTGGGGAGCCACCCGGCGG - Intronic
1074903414 10:117839302-117839324 ACCGATGGGGAGCCAGGAGGGGG - Intergenic
1075739634 10:124686672-124686694 GGCACTGGGGAGCCACACTGGGG - Intronic
1076026016 10:127114072-127114094 TGCCATGAGGAGCCATGAGGTGG - Intronic
1076734235 10:132451650-132451672 GGCAAGGGGTGGCCACGAGGTGG - Intergenic
1077478262 11:2801175-2801197 GGAACTGGGGAGCCTCTAGGGGG - Intronic
1078703686 11:13717148-13717170 GGGGATGGGGAGGCGCGAGGGGG - Intronic
1079110603 11:17603055-17603077 GGCAATGGGGAGCCATGGAAGGG + Intronic
1079560617 11:21814504-21814526 GACAATGGGGAGCCAGGAAGTGG + Intergenic
1081304845 11:41499685-41499707 GGAAATGGGGAGCCAGCAGGAGG - Intergenic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1081731901 11:45377557-45377579 GTCACTGGGGAGCCAGCAGGTGG - Intergenic
1083455244 11:62774398-62774420 GACAATGGGGAGCCATTGGGAGG + Intronic
1083688050 11:64389111-64389133 GGCAACAGGGAGGCACGATGCGG - Intergenic
1083764435 11:64835282-64835304 GGCAATGGGGAGCCAGTTGAGGG - Intronic
1084117830 11:67052274-67052296 GGCAGTGGGGAGCCATGGTGGGG + Intergenic
1084150724 11:67286764-67286786 GGCACTGGACAGCCACTAGGTGG - Intergenic
1084698170 11:70768727-70768749 GGCCATGGGGAGCCTGGAGATGG + Intronic
1084893201 11:72247105-72247127 GGCAATGGAGAGCCATGGGAGGG - Intergenic
1085028828 11:73257615-73257637 GGCAAAGGGGAGCCATGTGGGGG + Intergenic
1085109571 11:73875801-73875823 GGCAATGGGGAATCACAAGAGGG + Intronic
1085458081 11:76676693-76676715 GGCAAGGAGGAGGCAAGAGGGGG + Intergenic
1086970965 11:93080384-93080406 GGCAGTGGGGAGCCAGGACCTGG - Intergenic
1088763037 11:112950075-112950097 GGAAATGGGGAGCCATGACAGGG + Intergenic
1089648117 11:119893666-119893688 TGATATGGGGAGCCAGGAGGAGG - Intergenic
1202815594 11_KI270721v1_random:45230-45252 GCCAATGGGGAGCCCCTCGGGGG + Intergenic
1092190052 12:6512635-6512657 GCCACTGGGGAGCCACAAGCAGG + Intronic
1092217941 12:6695484-6695506 GACCATGAGGAGCCCCGAGGGGG - Exonic
1092923711 12:13255841-13255863 GGCAAGGGGGTGCCAGGAGCTGG - Intergenic
1096528600 12:52229549-52229571 GTCAATGGCCAGCAACGAGGAGG + Intergenic
1096878402 12:54648038-54648060 GGCAATGGAGAGCCAGGCTGGGG + Intronic
1097153194 12:56994574-56994596 GGCTATGGGGAGCTGTGAGGAGG - Exonic
1097697733 12:62790684-62790706 GGAACTGGAGAGCCACGGGGAGG + Intronic
1098196712 12:68009761-68009783 GGGATTGGGGAGCCACCAGATGG - Intergenic
1098367823 12:69723666-69723688 GGCAACGAGGAGCAAAGAGGTGG + Intergenic
1100237240 12:92673035-92673057 AGCAATGGGGAGCCATCAAGCGG + Intergenic
1101824310 12:108208742-108208764 GGCAATGGGGAGCCACTGCAGGG + Intronic
1102212615 12:111138326-111138348 GGCGCTGGGGAGCCAGCAGGGGG + Intronic
1102431131 12:112883432-112883454 GGCAAAGGGGAGACTCGGGGTGG + Intronic
1103727492 12:123005302-123005324 AGCAATGGGGAGCCCCTAGTGGG - Exonic
1104898082 12:132173920-132173942 GGCAATGGGAGGCCACTGGGAGG + Intergenic
1105794514 13:23837536-23837558 GTCACTGGTGAGCCATGAGGAGG - Exonic
1106080562 13:26497203-26497225 GGCAATGGGGAGCCACTGAGGGG - Intergenic
1106114208 13:26802969-26802991 GGGTATCGGGAGCCACCAGGGGG - Intergenic
1106374828 13:29176235-29176257 GCCAATGGGGAGCAAGGAAGAGG - Intronic
1108707674 13:53004771-53004793 GGTAAAGAGGAGCCACCAGGAGG + Intergenic
1108866571 13:54931075-54931097 GGCAATGTGGAGTCAAGGGGTGG - Intergenic
1113802914 13:113095788-113095810 GGGAATGGGGACCCAGGAAGCGG - Intronic
1114655205 14:24311592-24311614 GGCTCTGGGGAGGCCCGAGGGGG + Exonic
1115120090 14:29927927-29927949 GGCACTGGGGAGCCACCACCCGG + Intronic
1117141160 14:52791839-52791861 GGCCTTGGGGAGCGAGGAGGAGG - Intergenic
1117553260 14:56857413-56857435 GGCAATGAAGAGCCATGGGGAGG - Intergenic
1117985063 14:61379015-61379037 GGCAATGGGGAGCCACTGAGGGG - Intronic
1118006738 14:61569990-61570012 TGCAATGGGGAACCACAGGGAGG + Intronic
1119600663 14:75974201-75974223 GGCAGTGGGAAGCCAGGAGATGG + Intronic
1120224822 14:81778880-81778902 GGCAATGGGGAGCCACTGAAGGG - Intergenic
1121645704 14:95516241-95516263 GGCAGAGGGAAGCCCCGAGGAGG + Intronic
1121783774 14:96639562-96639584 GGGAATGGTGAGCCACCAAGGGG + Intergenic
1122812871 14:104297650-104297672 GGCCTTGGGGAGCCTCTAGGAGG + Intergenic
1122899917 14:104778175-104778197 GGCATTGGGAAGGAACGAGGTGG - Intronic
1123132410 14:105999488-105999510 GGCACTGAGGAACCACCAGGGGG - Intergenic
1123582626 15:21730601-21730623 GGCACTGAGGAACCACCAGGGGG - Intergenic
1123619276 15:22173197-22173219 GGCACTGAGGAACCACCAGGGGG - Intergenic
1124347332 15:28931350-28931372 GGGAATGGGAGGCCACAAGGAGG + Intronic
1124421684 15:29528409-29528431 GGGAGTGGGGAGCCAAGAGGAGG - Intronic
1127726877 15:61758979-61759001 GGCAATGAGGACCCAAGAGATGG + Intergenic
1128218662 15:65952326-65952348 GGCAGTGGGGAGCCACAGAGAGG + Intronic
1128357693 15:66939731-66939753 TGCACTGGGGAGCAACCAGGAGG - Intergenic
1128768938 15:70267531-70267553 GGCAGTGGGGAGCCATGGAGGGG - Intergenic
1129164851 15:73771110-73771132 GGCAATGGGGAGCCACTAAAGGG - Intergenic
1129684456 15:77677256-77677278 GGCAATGGGGATCCACTGTGGGG - Intronic
1130920103 15:88336593-88336615 GGCAATGGGGAGCCACAGAAGGG + Intergenic
1132507605 16:319521-319543 GGAAATGAGAAGCCATGAGGCGG + Intronic
1132724956 16:1334436-1334458 GGAAAGGGGGTGCCGCGAGGCGG + Intronic
1133229462 16:4359772-4359794 GTCAATGGGGAACCCAGAGGTGG - Intronic
1136069113 16:27777648-27777670 GGCCATGGTGAGCCACCTGGTGG + Exonic
1136082114 16:27859088-27859110 TGCTATGAGGAGCCACGAGACGG + Intronic
1136585039 16:31179440-31179462 GCCCCTGGGGAGCCACGGGGCGG - Intergenic
1136588863 16:31205018-31205040 GGCACTGGGGAGTCATGAGGGGG - Intergenic
1137940600 16:52680035-52680057 GGCACTGGTGAGTCAGGAGGGGG - Intergenic
1138247009 16:55475202-55475224 GCCACTGTGGAGCCAGGAGGTGG + Intronic
1142965857 17:3580676-3580698 GCCAATGGGGTGACACTAGGTGG + Intronic
1143703063 17:8675808-8675830 GGCAAAGGGGAGCCAGGTGAAGG - Intergenic
1144212155 17:13024668-13024690 GGGAAGGCGGAGCCAGGAGGAGG + Intergenic
1144353321 17:14420337-14420359 TCCAATGGGAAGACACGAGGCGG - Intergenic
1145309468 17:21693474-21693496 GGCCATGGGGAGCCAAGCAGGGG - Intronic
1151772843 17:76176728-76176750 GGCAAAGAGGAGCCCCGAGGCGG + Intronic
1151836463 17:76585734-76585756 GGCAAAGAGGAGCCCCGAGCAGG + Exonic
1152295516 17:79464953-79464975 GCAAGTGGGGAACCACGAGGTGG + Intronic
1155036551 18:22029641-22029663 GGCAATGGGGAGCCACTGAAGGG + Intergenic
1157484212 18:48075574-48075596 GGGAGTGGGGAGGCAGGAGGAGG - Intronic
1157558818 18:48632028-48632050 GGCAAACGGGAGGCAGGAGGTGG + Intronic
1160383875 18:78482096-78482118 GAGAATGGGGAGCCCCGAGGTGG - Intergenic
1160544693 18:79645199-79645221 GGCAATGAGGAGCCAGTAGCAGG - Intergenic
1160730497 19:639782-639804 GCCAATGGGGTGCCTCGGGGCGG - Intergenic
1160982602 19:1823261-1823283 GGGAATGGGGAGCCATGTCGGGG - Intronic
1161204576 19:3034343-3034365 GGCAATAGGGAGCCAGGGGAGGG - Intronic
1161258336 19:3322016-3322038 GACTATGGGGAGCCAGGAGGAGG + Intergenic
1162013322 19:7830698-7830720 GGGGATGGGGAGCCCTGAGGGGG - Intronic
1162494309 19:11014579-11014601 GGCAGAGGGGAGCCAGGAGGTGG - Intronic
1163271696 19:16258511-16258533 GGCTGTGGGGAACCAGGAGGGGG - Intergenic
1163504970 19:17700175-17700197 GGTAATAGGGAGCCACGGGAGGG + Intergenic
1163597669 19:18229814-18229836 GGCAATGGGGGGCCATGGGAGGG - Intronic
1163696881 19:18768650-18768672 GGCAACAGGGGGCCACCAGGGGG - Exonic
1166658416 19:44628911-44628933 GGGAGTGGGGAGCCACGTGAGGG + Intronic
1167253413 19:48413799-48413821 GGCACTGGGCAGCCAAGGGGAGG + Intronic
1167539251 19:50074821-50074843 GCCACTGGGGAGCCACGGGAGGG - Intergenic
1167573410 19:50305087-50305109 GGCAATGGGGAGCCATGGGAAGG + Intronic
1167579746 19:50334458-50334480 GGCACTGGGGAGCCACGGACGGG - Intronic
1167583318 19:50359161-50359183 GGCACTGGGGAGCCACGGAAGGG - Intronic
1167630456 19:50623037-50623059 GCCACTGGGGAGCCACGGGAGGG + Intronic
1167744581 19:51342985-51343007 GGCACTGGGGAGCCAGGGGAGGG - Intergenic
1167799000 19:51728316-51728338 GGCAATGGGGAGCCATGGAAGGG + Intergenic
1168694228 19:58395894-58395916 GGAGATGGGGAGGCCCGAGGCGG - Intergenic
926391586 2:12399520-12399542 GGCAATGCGGAGCCAGGCAGAGG + Intergenic
926880530 2:17539790-17539812 GCCAATGGGGAGCCGGGGGGAGG + Intronic
927199743 2:20570957-20570979 GGCACTAGGGAGCCAGGAGAGGG + Intronic
928331953 2:30364550-30364572 GGAAATGGGGAGGAAAGAGGAGG + Intergenic
928521770 2:32095946-32095968 GGCAATGGGAAGCCACTAAAGGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930781189 2:55225737-55225759 GGAGATGGGGAGCCTGGAGGAGG - Intronic
935194922 2:100807540-100807562 GTCAGTGGGGAGCCAGGGGGTGG + Intergenic
936042146 2:109158261-109158283 GGCAACCGGGAGCCTGGAGGTGG - Intronic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
936665214 2:114586872-114586894 GGCAAAGGGGAGCCAGTACGTGG - Intronic
937161744 2:119769438-119769460 GGGAGTGGGGAGCCAGGAAGTGG + Intronic
937487591 2:122331916-122331938 GGCAAAGAGGAGCAAAGAGGAGG + Intergenic
939889841 2:147723404-147723426 AGCAATGGGGTGCCATAAGGGGG + Intergenic
942362545 2:175187597-175187619 GGTGATGGGGAGACACTAGGAGG - Intergenic
943010206 2:182438799-182438821 GGCAATGGGGAGCCACTAGTGGG + Intronic
944390068 2:199208719-199208741 GACAATAAGGAGCCACGAAGAGG - Intergenic
946172105 2:217901802-217901824 GGCACTGCGGAGCCAGGAGAGGG - Intronic
946327190 2:218990787-218990809 GGCAATGGGGACCAAGGAAGAGG - Intronic
946431727 2:219629978-219630000 GGAAAGGGGGAGCCACGGGATGG + Intronic
948438297 2:237968177-237968199 GGCAAGGGGGAGCATAGAGGTGG + Intronic
948661014 2:239506417-239506439 GACTGTGGGGGGCCACGAGGCGG - Intergenic
1169120990 20:3095415-3095437 GGCAATGGGGAGCCATGGACAGG - Intergenic
1170901335 20:20466105-20466127 AGCACTGGGGAGACACCAGGAGG + Intronic
1172014244 20:31863518-31863540 GGCAGTGGGGAACCCCGAGCTGG - Intronic
1172030062 20:31975380-31975402 GGCAATGGAGAGCAAGGGGGTGG - Intronic
1173363675 20:42366437-42366459 GCCAGTGGGAAGCCACGAGATGG - Intronic
1173433982 20:43016243-43016265 GGCACTGTGGAGCCAAGAGTGGG + Intronic
1173824934 20:46042240-46042262 GGCAATGAGGAGCCACCAAGGGG + Intronic
1173854537 20:46241543-46241565 GGCAATGGGAAGCCACTGGAGGG - Intronic
1173864192 20:46303815-46303837 GGCAATGGGGAGCCATGGAAGGG + Intronic
1174355980 20:49998171-49998193 GGCAATGGGGAGCCATGGGAGGG + Intergenic
1174427041 20:50439190-50439212 GCCAATGAGGAGCAAAGAGGAGG + Intergenic
1174524987 20:51163479-51163501 GGTAATGGGGAGCCAAGGGGGGG + Intergenic
1175578039 20:60077515-60077537 GGCAAAAGGGAGCCTCAAGGGGG - Intergenic
1176073949 20:63240094-63240116 GGCTCTGGGGAGCCCCGAGGCGG - Intronic
1179597536 21:42452810-42452832 GGGCAGGGGGAGCCACGCGGAGG + Intergenic
1179801474 21:43813363-43813385 GGCATTGGGGAGCCAGGCAGGGG + Intergenic
1180903973 22:19395436-19395458 GGCAGTGGGGTCCCATGAGGTGG - Intronic
1180963439 22:19773329-19773351 GGAAATGGGCCGCCAGGAGGTGG + Intronic
1182273793 22:29172030-29172052 GGCAATGGGGAGCCACGAGGAGG + Intergenic
1182423735 22:30260992-30261014 GGCAAGGGGGAGCCCAGTGGGGG + Intergenic
1182713823 22:32339608-32339630 GGAGGTGGGGAGCCACCAGGTGG + Intergenic
1183234462 22:36607040-36607062 AGCAATGGGGAGCCACTGAGGGG + Intronic
1183334094 22:37236836-37236858 GGCAATGGGGAACCAGCAAGGGG + Intronic
1184354726 22:43971391-43971413 GGCCATGGTGGGTCACGAGGTGG + Intronic
950548293 3:13652061-13652083 GGCAATGGGGAGTCATGGTGGGG - Intergenic
952952533 3:38536673-38536695 GGCTCTGGGGACCAACGAGGAGG + Intronic
953191389 3:40691134-40691156 GGGAATGGGGAGGCATGGGGAGG - Intergenic
953452740 3:43017616-43017638 GGCAATGGGAAGTCACAGGGAGG + Intronic
954137579 3:48589150-48589172 GGCAGTGTGGGGCCACCAGGAGG + Intronic
954797275 3:53168051-53168073 GGCCAAGGGGAGCCCTGAGGGGG - Intronic
958001955 3:87761833-87761855 GGAGATGGGGAGCCAGAAGGGGG + Intergenic
958882369 3:99687172-99687194 GGCAATGTGGAGCCACCTAGCGG + Intronic
959572528 3:107900313-107900335 GGCAATGGGGAGCCAGGGATGGG - Intergenic
960510081 3:118539593-118539615 GGCAATGGGGAGGCAGGAGATGG + Intergenic
961316041 3:126036352-126036374 GCCAATGGGGAGCCATTGGGAGG + Intronic
962700323 3:137992137-137992159 GGCAATGAGCATCCATGAGGAGG + Intergenic
963833138 3:150030157-150030179 GGCGATGGGGAGTTACGAGAGGG + Intronic
967948666 3:194823870-194823892 GGGCATGGGGAGCCACTGGGGGG - Intergenic
967977286 3:195042552-195042574 GGAGATGGGGAGCCACGGTGGGG - Intergenic
969411806 4:7033466-7033488 GGCAGTGGGGTGGCATGAGGTGG + Intergenic
969562197 4:7956467-7956489 GGCATTGTGGAGCCCTGAGGAGG + Intergenic
971079730 4:23195684-23195706 GGCCATGGGCAGCCAGGAAGAGG - Intergenic
972042179 4:34616471-34616493 GGCAATGGGGAGTAGAGAGGTGG - Intergenic
974096842 4:57373241-57373263 GGCAATGGGGAGCCATCATGGGG - Intergenic
974532223 4:63123661-63123683 GCCAATGGGAAGCCTCTAGGGGG + Intergenic
977231043 4:94451877-94451899 GGCGAGGGAGAGCCAGGAGGCGG + Exonic
979604387 4:122622491-122622513 GGCAATGTGGAGGCACCAAGTGG - Intergenic
985515719 5:343738-343760 GGCCAGGGGGTCCCACGAGGAGG + Intronic
986137099 5:4990575-4990597 GGCAGTGGGGAGCCAGGAACTGG + Intergenic
991013386 5:61907242-61907264 GGCAATGGAGAGCCTGGAGATGG + Intergenic
991474306 5:67003822-67003844 GGTAATGGTGAGCCCCGATGTGG - Intronic
997197980 5:131992289-131992311 GGTAATGGGGAGCCAGGAAAGGG + Intronic
997666312 5:135632216-135632238 GGCCATGGGGAGCCACTAAAAGG + Intergenic
998131824 5:139655287-139655309 AGCAATGGGGAACCCTGAGGCGG - Intronic
1003379610 6:5611390-5611412 GGCAGTGGGGAGCCACAGGATGG + Intronic
1006079937 6:31559249-31559271 GGCGCTGGGGGGCCATGAGGAGG + Intergenic
1006320371 6:33316204-33316226 GGCAGTGGGGAGCGTCGAGGAGG - Exonic
1006952219 6:37832214-37832236 GGCAGTGGGGAGTGAAGAGGGGG + Intronic
1007926404 6:45653077-45653099 GGCAACGGGGAGCCACCAAAGGG - Intronic
1008420321 6:51291697-51291719 AGCAATGTGGAGACAGGAGGGGG + Intergenic
1008807491 6:55449380-55449402 GGGAGTGGTGAGCCACAAGGTGG + Intronic
1011393538 6:86881076-86881098 GGGTATGGGGAGCAAGGAGGGGG - Intergenic
1012449398 6:99339108-99339130 GGCTATGGGGAGTCAGGAGCTGG + Intronic
1015542861 6:134333518-134333540 GGCAATGGAGAGCCTAGAAGAGG - Intergenic
1016326966 6:142913797-142913819 CACAATGGTGAGCCACGAGATGG - Intronic
1016462445 6:144291127-144291149 AGCAATGGGGAGCCAGTAGATGG - Intronic
1017444593 6:154495898-154495920 GGCAATGGGGAGGGTTGAGGAGG - Intronic
1017818401 6:158031380-158031402 GGCAAAGGGGATTCACGAGGTGG + Intronic
1017841717 6:158227756-158227778 GGCATTTGGGAGCCATTAGGAGG - Intergenic
1019112080 6:169724465-169724487 GGCCGTGGGGAGCCAGGCGGCGG - Intronic
1019346168 7:531760-531782 GGGACAGGGGAGCCACGAGGCGG + Intergenic
1019709210 7:2510686-2510708 GGCAGTGGGGAGCCAAGGGAGGG + Intergenic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1025912723 7:65840926-65840948 GGCCATGGTGAGGCAAGAGGTGG - Intergenic
1025980335 7:66400008-66400030 GGCAATGGGCAGTCACCAGCAGG + Intronic
1026113058 7:67473741-67473763 AGCAATGGAGAGCCATGAAGGGG - Intergenic
1026270299 7:68830746-68830768 AGGAATGGGGAGCCAGAAGGGGG - Intergenic
1027205218 7:76092380-76092402 GGCAATGGGCAGTCACCAGCAGG + Intergenic
1029222711 7:99003087-99003109 GCCCTGGGGGAGCCACGAGGAGG - Intronic
1031965259 7:128023280-128023302 GGGAGTGGGGAGGCACTAGGAGG - Intronic
1033200291 7:139362551-139362573 GGAAATGGGTATCCAGGAGGTGG + Intronic
1033342375 7:140502132-140502154 GGCCATGGGGAGCCCCTGGGTGG + Intergenic
1034462640 7:151206358-151206380 GGCAAGGAGGAGCAAAGAGGAGG + Intergenic
1034546679 7:151794101-151794123 GGGGAAGGGGAGCCCCGAGGCGG - Intronic
1038149336 8:24928312-24928334 GTCCATGGGCAGCCACGAGTGGG - Intergenic
1039514546 8:38120960-38120982 TCCAATGGGTAGCCATGAGGGGG - Exonic
1046773218 8:118137140-118137162 GCCAATGGGAAACCACTAGGGGG - Intergenic
1052900650 9:33791931-33791953 GGCAAGGGGCAGGCAAGAGGAGG + Intronic
1053016612 9:34665632-34665654 GGGAATGAGGAGATACGAGGTGG - Exonic
1053295122 9:36907352-36907374 GACAAGGGGAAGCCACGGGGAGG - Intronic
1055327859 9:75150729-75150751 GGCAACTGGGAGCCACAGGGAGG + Intergenic
1057231548 9:93324539-93324561 AGCAATGGGGAGGCTGGAGGGGG - Intronic
1058825396 9:108771805-108771827 GGCAGTGGCCAGCCACCAGGTGG + Intergenic
1058885723 9:109320328-109320350 CGCGATGGGGGGCCACGGGGGGG - Exonic
1059059070 9:111015885-111015907 GGCAATGGGGAACCATGGGAAGG - Intronic
1059269011 9:113060791-113060813 GGGAGTGGGGGGCCCCGAGGGGG - Intergenic
1059270147 9:113066240-113066262 GGGAGTGGGGGGCCCCGAGGGGG - Intergenic
1059271283 9:113071690-113071712 GGGAGTGGGGGGCCCCGAGGGGG - Intergenic
1059272414 9:113077134-113077156 GGGAGTGGGGGGCCCCGAGGGGG - Intergenic
1059273549 9:113082576-113082598 GGGAGTGGGGGGCCCCGAGGGGG - Intergenic
1059274685 9:113088022-113088044 GGGAGTGGGGGGCCCCGAGGGGG - Intergenic
1059362258 9:113753994-113754016 GTCAATGGGGAGCCATGACAGGG + Intergenic
1059776372 9:117479479-117479501 GGAAATAGGGAGCCACGGAGGGG - Intergenic
1060043844 9:120324868-120324890 GGCAATGGGAAGCCATCAGAGGG + Intergenic
1060271358 9:122144448-122144470 AGCAATGAGGAGACACCAGGAGG - Intronic
1060769067 9:126317715-126317737 GACAGTGGGGAGGCACAAGGGGG + Intergenic
1060807250 9:126585629-126585651 GGAGATGGGGACCCATGAGGAGG + Intergenic
1061221574 9:129255111-129255133 GGCAATGGGGAGCCATGGGAGGG - Intergenic
1061408103 9:130403681-130403703 GGGACTGGGGACCCCCGAGGTGG - Intronic
1061782486 9:133004205-133004227 GGCGCTGGGGAGCCACCGGGAGG - Intergenic
1061961502 9:133991450-133991472 GGCCCTGGGGATCCTCGAGGCGG + Intronic
1062125457 9:134858471-134858493 GGCAATGCAGAGTCACGATGAGG + Intergenic
1185609807 X:1387545-1387567 GGCACTGAGCAGCCACGTGGAGG - Intronic
1186472936 X:9835434-9835456 GGCAATGGGGAGAAACCATGTGG + Intronic
1189301885 X:39958153-39958175 GGAAATGGGGAGCCACGGGAGGG + Intergenic
1190337100 X:49269367-49269389 GCCAATGGAGAGCCACGCGTGGG - Intergenic
1190957374 X:55208740-55208762 GGCAATGATGAGCCTCTAGGAGG - Intronic
1192040190 X:67612352-67612374 GGCAATGAGGAGGCATGAGAGGG - Intronic
1192543532 X:71994677-71994699 GGCAATGGGGAGCCACCTGTGGG + Intergenic
1192754527 X:74033514-74033536 GGCAATAGGGAGGCCCTAGGTGG - Intergenic
1197238144 X:124091452-124091474 GGCAATGGGGAGCCACAGAAAGG - Intronic
1200215976 X:154368471-154368493 GCCTATGGGGAACCAGGAGGAGG + Intronic
1200305762 X:155024666-155024688 GGCAATGGGGAGACACGGCCGGG + Intronic