ID: 1182275792

View in Genome Browser
Species Human (GRCh38)
Location 22:29187929-29187951
Sequence CGGTTCACCCAGTTAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182275784_1182275792 10 Left 1182275784 22:29187896-29187918 CCTGGCAGGGGCCAGCAAACAGG 0: 1
1: 0
2: 3
3: 45
4: 349
Right 1182275792 22:29187929-29187951 CGGTTCACCCAGTTAGGACAGGG 0: 1
1: 0
2: 1
3: 5
4: 70
1182275787_1182275792 -1 Left 1182275787 22:29187907-29187929 CCAGCAAACAGGATCCAGATGGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1182275792 22:29187929-29187951 CGGTTCACCCAGTTAGGACAGGG 0: 1
1: 0
2: 1
3: 5
4: 70
1182275779_1182275792 24 Left 1182275779 22:29187882-29187904 CCCACTCAGATTCTCCTGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1182275792 22:29187929-29187951 CGGTTCACCCAGTTAGGACAGGG 0: 1
1: 0
2: 1
3: 5
4: 70
1182275781_1182275792 23 Left 1182275781 22:29187883-29187905 CCACTCAGATTCTCCTGGCAGGG 0: 1
1: 0
2: 2
3: 24
4: 189
Right 1182275792 22:29187929-29187951 CGGTTCACCCAGTTAGGACAGGG 0: 1
1: 0
2: 1
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182275792 Original CRISPR CGGTTCACCCAGTTAGGACA GGG Intergenic
902741609 1:18442406-18442428 AGGTTCAGCCATTTAGGAGAAGG - Intergenic
903946941 1:26969927-26969949 AAGTTCACACAGTTAGGAAAAGG - Intergenic
912543993 1:110437901-110437923 AGGTTGACCCTGTTAGCACAAGG + Intergenic
919795176 1:201317331-201317353 AGGTTCTCCCAGCTAGGATATGG + Intronic
920740940 1:208580756-208580778 AGGCTCACCCAGCTAGGAAATGG - Intergenic
1062980235 10:1716084-1716106 CGGTGCACCCAGTTAGCAATCGG - Intronic
1063214986 10:3916250-3916272 CAGTTCATCCTGTTAGGCCATGG + Intergenic
1073272870 10:102281079-102281101 TGTTTCAGCCAGTTAGGAAATGG + Intronic
1078751115 11:14164585-14164607 TGGTTAACCCAGTTAGGATTAGG - Intronic
1079363895 11:19792475-19792497 AGGTGCATACAGTTAGGACACGG - Intronic
1080691987 11:34565951-34565973 TTGTCCACCCAGTCAGGACATGG - Intergenic
1081754071 11:45532252-45532274 TGGTGACCCCAGTTAGGACAAGG - Intergenic
1085311182 11:75517834-75517856 CAGTTCTCCCAGGTGGGACAGGG + Intronic
1091725503 12:2843837-2843859 CAGGTCACCCAGCTAGTACAGGG - Intronic
1091833938 12:3570974-3570996 AAGGTTACCCAGTTAGGACATGG - Intronic
1091854187 12:3725588-3725610 CAGTTCTGGCAGTTAGGACATGG + Intronic
1117508662 14:56427162-56427184 CGGCTCACCCTGTCAGTACAAGG - Intergenic
1117969886 14:61241246-61241268 TGGTGCACCCAGAGAGGACATGG - Intronic
1118857219 14:69632974-69632996 AGGTTCACCCTGCTAGAACACGG + Intronic
1121332069 14:93055930-93055952 CGGGGCACCCAGTGAGGTCACGG + Intronic
1121790913 14:96698987-96699009 CGGGTCACCCAAGCAGGACATGG - Intergenic
1128958628 15:71975911-71975933 TGGTACACCCAGGGAGGACATGG + Intronic
1131408460 15:92185879-92185901 TGGAACACCCAGGTAGGACAGGG - Intergenic
1135860265 16:26049931-26049953 CGGTGCACCCAGGGAGGGCACGG - Intronic
1139111204 16:63893157-63893179 AGGGTCACCCAGTGAGGAGATGG - Intergenic
1139153235 16:64410081-64410103 CATTTCATCCAGTTAGGAGAAGG - Intergenic
1140972846 16:80029939-80029961 CGGTTCATTCACTCAGGACATGG - Intergenic
1144263674 17:13547553-13547575 CTGTGCACCCAGAGAGGACATGG + Intronic
1155320849 18:24617547-24617569 CGGGTCACACAGTAAAGACATGG + Intergenic
1166219839 19:41357272-41357294 CGGTGAACCCTGTGAGGACAAGG + Intronic
1168359072 19:55723188-55723210 GAAATCACCCAGTTAGGACAGGG + Intronic
1168504520 19:56921939-56921961 TGGTTCGCCCAGAGAGGACATGG + Intergenic
925410078 2:3634897-3634919 GGGGGCACCCAGTGAGGACAGGG - Intronic
931306520 2:61034506-61034528 CGCTTCACCCAGGAAGCACAAGG + Intronic
939678321 2:145099457-145099479 TGGTTCACTCAGCTAGTACATGG - Intergenic
1170571093 20:17633085-17633107 AAGTTCACCCAGCCAGGACATGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176047398 20:63099982-63100004 CGGCTCCCCCAGTGAGGAAAGGG + Intergenic
1182275792 22:29187929-29187951 CGGTTCACCCAGTTAGGACAGGG + Intergenic
949350526 3:3121071-3121093 CAGTTCAACCCCTTAGGACATGG - Intronic
949452130 3:4197387-4197409 CAGTGCACCCAGTAAGGAGATGG + Intronic
951729915 3:25798948-25798970 GTGTTCACACAATTAGGACAGGG - Intergenic
954751878 3:52818420-52818442 AGGATCCCCCTGTTAGGACAGGG + Exonic
958164570 3:89862995-89863017 CGGTGCACCCAGAGAGGACATGG + Intergenic
962836795 3:139196554-139196576 CGCTTCACCCAGGAAGCACAAGG - Intronic
964538728 3:157755899-157755921 CTGTGCACCCACTTAGGGCACGG - Intergenic
975545821 4:75559492-75559514 GTGTTCACCCAGTTATGAAATGG + Intronic
976698892 4:87947649-87947671 CTCTTCACCAAGTCAGGACACGG - Intergenic
985243348 4:187954617-187954639 AGGTTCTAGCAGTTAGGACATGG - Intergenic
987974704 5:24998500-24998522 AGGTTCACCCAGCTAGGTAAAGG - Intergenic
991966800 5:72100223-72100245 CAGTTCACACAGTTAGGAAAAGG + Intergenic
997298951 5:132788309-132788331 AGGTTAACCCAGTTAGGGTATGG - Intronic
998752154 5:145334040-145334062 CGGTTCACCCAGGAAGGACAAGG - Intergenic
1007338157 6:41170289-41170311 TGGTGCACCCAGAAAGGACATGG - Intergenic
1009580386 6:65526073-65526095 CCCTTCACTAAGTTAGGACACGG - Intronic
1010282273 6:74035639-74035661 CGCTTCACCCAGGAAGGACAAGG - Intergenic
1011730911 6:90262278-90262300 AGATTCCCCCAGTTAGGGCAGGG - Intronic
1011911799 6:92449736-92449758 GGGCTGACACAGTTAGGACAGGG + Intergenic
1013452908 6:110303036-110303058 CGCTTCACCCAGGAAGCACAGGG + Intronic
1019680837 7:2348272-2348294 CGCTCCACCCAGGAAGGACAAGG + Intronic
1029435169 7:100560002-100560024 AGCTTCACCCAGTGAGGACCAGG - Intronic
1032802179 7:135325611-135325633 CAGGGCACCCAGTTTGGACAGGG - Intergenic
1032924998 7:136594075-136594097 TGGTTTGCCCAGTTTGGACATGG + Intergenic
1036512684 8:9415110-9415132 CTGTTCACTCATTGAGGACAGGG - Intergenic
1039964341 8:42272714-42272736 CGGATCACGCAGTCAGGAGATGG + Intronic
1041843057 8:62294171-62294193 CGCTTCACCCAGGAAGCACAAGG - Intronic
1042929348 8:73997880-73997902 TGGTGCACCCAGAGAGGACATGG - Intronic
1051452052 9:17207607-17207629 CGTTTCACCCAGGAAGTACAAGG - Intronic
1053315501 9:37047640-37047662 AGGATCACACAGTTAGGAGATGG + Intergenic
1053320391 9:37093161-37093183 AGGATCACACAGTTAGGAGATGG + Intergenic
1056578721 9:87874812-87874834 TGGTGCACCCAGTGAGGGCATGG - Intergenic
1189066377 X:37813854-37813876 CGGTTGACTCATTTAGAACAAGG - Intronic
1189755896 X:44271013-44271035 AGGTTCACACACTTGGGACAGGG - Intronic
1190466359 X:50728134-50728156 CGGTTCACGAAGTCAGGAGATGG + Intronic
1196440317 X:115714006-115714028 TGGTTCACACAATTAGGACATGG - Intergenic
1196466477 X:115976740-115976762 TGGTTCACACAATTAGTACATGG + Intergenic
1197625712 X:128800177-128800199 AGGATCACCCAGCTAGGACATGG + Intergenic