ID: 1182275885

View in Genome Browser
Species Human (GRCh38)
Location 22:29188348-29188370
Sequence GCCGGAGGCTACCCGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182275885_1182275890 -3 Left 1182275885 22:29188348-29188370 CCTGGCTTCGGGTAGCCTCCGGC 0: 1
1: 0
2: 3
3: 17
4: 130
Right 1182275890 22:29188368-29188390 GGCGCTCTTTGGCTTGTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 111
1182275885_1182275888 -6 Left 1182275885 22:29188348-29188370 CCTGGCTTCGGGTAGCCTCCGGC 0: 1
1: 0
2: 3
3: 17
4: 130
Right 1182275888 22:29188365-29188387 TCCGGCGCTCTTTGGCTTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182275885 Original CRISPR GCCGGAGGCTACCCGAAGCC AGG (reversed) Intergenic
900404578 1:2486846-2486868 GCCTGAGGCTATCCCAGGCCAGG + Intronic
900468106 1:2835575-2835597 GCCGGAGGCCCCCTGAACCCAGG + Intergenic
906961805 1:50423389-50423411 GCCGGACGCTGCGCGCAGCCGGG + Exonic
907013239 1:50985243-50985265 GCCTGAGGCTATCAGAACCCAGG - Intergenic
914924660 1:151873808-151873830 ACCTGAGGCTCCCAGAAGCCAGG + Exonic
920194279 1:204216479-204216501 GCCCAAGGCTTCACGAAGCCAGG - Intergenic
920365073 1:205444010-205444032 GCTGGAGGCTCCCTGAAGTCAGG + Intronic
921122475 1:212148910-212148932 GCCTGAGGCCACCAGAAGCTAGG + Intergenic
921550218 1:216526448-216526470 GCTTGAGGCCACCAGAAGCCAGG + Intronic
922874940 1:228933229-228933251 GCCTGAGGCTACTAGAAGCCAGG - Intergenic
923554547 1:234990443-234990465 GCCCGAGGCTACCAGAAGCCAGG - Intergenic
1064005011 10:11692399-11692421 GCCAGTGGCCACCAGAAGCCAGG - Intergenic
1067232282 10:44420179-44420201 GCTGGAGGCTTCCTGAAGGCTGG + Intergenic
1069296352 10:66849671-66849693 GCCGGAAGCCACCAGAAGCTAGG + Intronic
1070102123 10:73398249-73398271 GCTGGAGGCTACCCTGCGCCTGG - Exonic
1070644728 10:78193913-78193935 GCCTAAGGCTACCAGAAGTCAGG - Intergenic
1075637154 10:124037036-124037058 GCCGGCAGCCACCAGAAGCCAGG - Intronic
1075994411 10:126865470-126865492 GCTGGAGGCCACCAGAAGCTAGG + Intergenic
1076736954 10:132463219-132463241 GCCGGTGGCCACCCGAGGCTGGG + Intergenic
1077525437 11:3061461-3061483 GCCGGTGGCCACCAGAAGCCAGG + Intergenic
1081535904 11:43996086-43996108 GTCTGAGGCTCCCAGAAGCCAGG + Intergenic
1082961127 11:58919739-58919761 GCAGGGGCCTACCCGAACCCCGG - Intronic
1084212253 11:67629666-67629688 GCCGGAGGCTACAGGAGCCCGGG - Intronic
1089479311 11:118791865-118791887 CCCGGAGCCTACCCGCCGCCAGG - Intergenic
1092048921 12:5454198-5454220 GCCAGAGGCTACCAGAGGCTAGG - Intronic
1092878126 12:12866208-12866230 GCCGGCAGCCACCAGAAGCCAGG + Intergenic
1093111161 12:15154009-15154031 GCCTGAGGTTACCAGAAGCTAGG + Intronic
1094292678 12:28869875-28869897 GCCTGATGCTACCAAAAGCCAGG - Intergenic
1100477415 12:94947285-94947307 GCCTGAAGCTACCAGAAGCGAGG + Intronic
1103477555 12:121229758-121229780 ACCGTGGGCTACCAGAAGCCAGG - Intronic
1104381909 12:128314714-128314736 GCCGGCGGCCACCAGAAGCTGGG + Intronic
1112397106 13:99043350-99043372 GCTGTAGGCTGCCTGAAGCCTGG + Intronic
1113693961 13:112330950-112330972 GCGGGAGGCTGCGCGCAGCCCGG - Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1120876915 14:89383572-89383594 GCCGGGGGCCGCCAGAAGCCAGG - Intronic
1121900594 14:97690162-97690184 GTCTGAGGCTACCAGAAGCTAGG - Intergenic
1121972698 14:98373213-98373235 GCCAGAGGCTACCAGAGGCTGGG + Intergenic
1123067399 14:105625566-105625588 GCCTGTGGCTGCCCGGAGCCTGG + Intergenic
1135783659 16:25328444-25328466 GCAGGAGGCTACATGAGGCCAGG + Intergenic
1136542533 16:30936156-30936178 GCCTGAGGCCCCCCAAAGCCTGG + Intronic
1141839773 16:86567186-86567208 CCCGGAGGCTGCCAGGAGCCCGG + Intergenic
1143366994 17:6414946-6414968 GCCTGAAGCTACCGGAAGACAGG + Intronic
1146955788 17:36935825-36935847 GCCGGTGCCAACCCGAAGCCTGG + Intergenic
1147386573 17:40086016-40086038 GCAGGAGGATCCCCTAAGCCTGG + Intronic
1147609425 17:41792924-41792946 GCCAGAGGCTGCCCACAGCCTGG + Intergenic
1147764925 17:42828068-42828090 ACCTGAGGCTACCAAAAGCCAGG + Intronic
1147919711 17:43908227-43908249 GCCGGAGGCTGGGCGAAGGCGGG - Intronic
1151152452 17:72099536-72099558 GACTGAGGCTCCCAGAAGCCAGG - Intergenic
1152579557 17:81160025-81160047 GCAGGATGCTACCCCGAGCCAGG - Intronic
1155036140 18:22026501-22026523 GCTGGACGCTTCCCAAAGCCAGG - Intergenic
1156888994 18:42168165-42168187 GCCTGAGGCTACCAGAAGCTAGG - Intergenic
1158334664 18:56402853-56402875 GCCTGAGACCACCAGAAGCCAGG + Intergenic
1158467680 18:57705637-57705659 GCCAGTGGCCACCAGAAGCCAGG + Intronic
1160164160 18:76495437-76495459 GCCGGAGGCTTCCCCCAGCCTGG + Intergenic
1160606599 18:80055627-80055649 GCCTGAGGCTACCAGAAGCTGGG - Intronic
1161769419 19:6223244-6223266 GCAGTTGGCTTCCCGAAGCCAGG - Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
925111458 2:1341782-1341804 GCAGGTGGCTCCCTGAAGCCTGG - Intronic
925901187 2:8510613-8510635 GCCTGAGGGCACCAGAAGCCAGG + Intergenic
926857093 2:17268786-17268808 GCCTGAGGCTACCAGAAGCCAGG - Intergenic
931102214 2:59015158-59015180 GCCTGGGGCTAAGCGAAGCCCGG - Intergenic
937280413 2:120713702-120713724 GCCGGCAGCCACCAGAAGCCAGG - Intergenic
938722089 2:134076217-134076239 GCCAGAGACAACCTGAAGCCTGG - Intergenic
942859892 2:180596949-180596971 GCCTGGGGCTACCAGAAGCTGGG - Intergenic
945319724 2:208407142-208407164 GCCGGAGGCTCCGCGAAAACAGG - Intronic
945742920 2:213685392-213685414 TCCTGAGGTTACCAGAAGCCAGG + Intronic
1170823407 20:19773109-19773131 GCTTGAGGCTTCCAGAAGCCGGG - Intergenic
1172492191 20:35348745-35348767 GCAGGAGGCTCCCTTAAGCCCGG - Intronic
1176235849 20:64053170-64053192 GCCGGCAGCTATCGGAAGCCCGG - Intronic
1178532859 21:33389724-33389746 GGTGGAGGCTCCCCCAAGCCAGG + Intergenic
1179548677 21:42129012-42129034 GCCCGAGGCCACCAGAAGCTGGG - Intronic
1180198911 21:46213284-46213306 GCGGGAGGCTCCCCGACCCCAGG + Intronic
1180696280 22:17753520-17753542 GCCAGAGGTTACCCGATGCAGGG - Intronic
1182275885 22:29188348-29188370 GCCGGAGGCTACCCGAAGCCAGG - Intergenic
1184243403 22:43223256-43223278 GGCGGAGGCTTCCTGGAGCCAGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1184646444 22:45897826-45897848 GCCTGAGGCCACCTGGAGCCAGG - Intergenic
949230643 3:1745958-1745980 GCCTGAGGCTACCAGAAGCTAGG - Intergenic
949407744 3:3732482-3732504 GCCTGAGGCTTCCAGAAGCTGGG - Intronic
952017589 3:28976530-28976552 ACCTGAGGCTACCAGAAGCTAGG - Intergenic
952889024 3:38029085-38029107 CCCAGAGGCTCCCCAAAGCCTGG - Intronic
955281162 3:57596584-57596606 GCCAGCGGCCACCCGGAGCCTGG - Intronic
955349818 3:58185103-58185125 GCTGGTGGCCACCAGAAGCCAGG - Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
955770287 3:62378476-62378498 CCGGGAGGGTACCCGAAACCTGG - Intergenic
957296537 3:78340440-78340462 GCAGGAGGATACCCTGAGCCCGG - Intergenic
959341697 3:105139444-105139466 CCCTGAGGCTACCAGAAGCTTGG + Intergenic
961008516 3:123420898-123420920 ACCTGAGGCTACCACAAGCCAGG - Intronic
961299287 3:125911940-125911962 GCCAGCGGCCACCAGAAGCCAGG - Intergenic
961626636 3:128268741-128268763 GCCGGAAGCCCCCAGAAGCCAGG + Intronic
968131935 3:196197192-196197214 GCCGGAGGCCACCTGAGGTCAGG - Intergenic
969184830 4:5467344-5467366 GCCGGCCGCCACTCGAAGCCTGG - Intronic
970112827 4:12657909-12657931 GCCGGTGGCCACCAGAAGCTAGG + Intergenic
971112988 4:23609916-23609938 GCCTGAGGCTACCTGAAGCTAGG - Intergenic
971334595 4:25710906-25710928 GCCGGTGGCTAACCCAAGGCTGG - Intergenic
971801264 4:31294750-31294772 GCCTGAGGCTACCAGAAGCCAGG - Intergenic
972857384 4:43122993-43123015 GCCTAAGGCTACCGGAAGCTAGG - Intergenic
973971498 4:56217974-56217996 ACCTAAGGCTACCAGAAGCCAGG - Intronic
974682645 4:65183114-65183136 ACCTGAGGCTACCAGAAGCTAGG + Intergenic
975351621 4:73353460-73353482 GTCTGAGGCTACCAGAAGCCAGG + Intergenic
980138732 4:128889432-128889454 GTCTGAGGCTACCAGAAGCTGGG + Intronic
980925273 4:139130161-139130183 GCCTGAGGCTACCAGAAGCTAGG + Intronic
982388550 4:154838908-154838930 GGCGGTGGCCACCGGAAGCCAGG - Intergenic
984509171 4:180657891-180657913 GACTGAGGCTACATGAAGCCAGG - Intergenic
985921877 5:2983909-2983931 GCCCGAGGATACTCAAAGCCAGG - Intergenic
990792270 5:59495633-59495655 GCAGGAGAGTTCCCGAAGCCAGG + Intronic
992805349 5:80331858-80331880 GGCGGAAGCTCCCCGAAGCCAGG - Intergenic
995106388 5:108381538-108381560 GCCGGCGGCGCCCCGGAGCCGGG - Exonic
997337234 5:133117002-133117024 GCCTGGGACTACCAGAAGCCAGG - Intergenic
997577938 5:134997213-134997235 GCCGGAGGCTGCCCCTCGCCTGG + Intronic
998583221 5:143402738-143402760 GCCGGGGCCTCCCCGGAGCCCGG + Intronic
1001565557 5:172697182-172697204 GCGGGAGGCTCCCCCAAGCCGGG - Intergenic
1001586183 5:172834910-172834932 GCCTGAGGCTCCCCCAGGCCGGG + Intronic
1002183028 5:177441284-177441306 GCCCGTGGCTCCCCGAGGCCAGG - Intronic
1004524309 6:16391909-16391931 ACCGTAGGCCACCAGAAGCCAGG - Intronic
1007071621 6:39042260-39042282 GTCTGAGGCTACCAGAAGCTGGG + Intergenic
1012894811 6:104936567-104936589 GCCCGAGTCTACCAGAAGCCAGG + Intergenic
1014137747 6:117907948-117907970 GACGGAGGGGACCCGGAGCCGGG - Intronic
1014254734 6:119149511-119149533 GCCGGGGGCAACCTGAATCCTGG + Intergenic
1016963354 6:149694401-149694423 GCGGGAGGCTTACCTAAGCCCGG - Intronic
1017373029 6:153735694-153735716 GCCAGAGACAACCTGAAGCCTGG - Intergenic
1018842028 6:167524264-167524286 GCCAGATGCTCCCCAAAGCCAGG - Intergenic
1019299451 7:296086-296108 GCCGGAGGCTGCCTGCGGCCTGG + Intergenic
1019560695 7:1655271-1655293 GGCGGAGCCTACCCCACGCCTGG + Intergenic
1025729999 7:64100474-64100496 GCGGGAGGCGCCCGGAAGCCCGG + Intronic
1026187284 7:68091787-68091809 ACCTGAGGCTGCCAGAAGCCAGG - Intergenic
1028653133 7:93172520-93172542 GCCTTAGGCTACCAGAAGCTAGG - Intergenic
1029884657 7:103855745-103855767 GCCTGAGGCTGCCAGAAGCTAGG - Intronic
1033208157 7:139440014-139440036 GCCTGATGCTACCAGTAGCCAGG - Intergenic
1034447438 7:151120824-151120846 GCCAGAGGCCACCCTCAGCCGGG - Intronic
1034469023 7:151245881-151245903 GCAGGAAGCTAACTGAAGCCAGG + Intronic
1035030037 7:155850888-155850910 GCTGTAGGCTACTCGAGGCCAGG - Intergenic
1035580699 8:737835-737857 GCCGGGGGCTGCCGGGAGCCGGG + Intronic
1036765604 8:11547719-11547741 GCCTGAGGCCACCAGCAGCCCGG + Intronic
1038681258 8:29670551-29670573 GCTTTAGGCTACCAGAAGCCAGG - Intergenic
1044774131 8:95669954-95669976 GCCTGAGGCTACCAGAAGCTAGG - Intergenic
1047626900 8:126665747-126665769 GCTGGAAGCCACCAGAAGCCAGG + Intergenic
1047909380 8:129510671-129510693 GCCTGAGGCTACCAGAAGCTAGG - Intergenic
1048368160 8:133756588-133756610 GTGGGAGATTACCCGAAGCCTGG - Intergenic
1051660536 9:19422205-19422227 GCAGGAGGCTCCCTTAAGCCTGG + Intronic
1057231371 9:93323626-93323648 GTCGAAGGCTGCCCGAGGCCAGG + Intronic
1061275887 9:129569198-129569220 GCCGGGGGCTACGCGGGGCCGGG + Intergenic
1061544854 9:131298750-131298772 GCTGGAGGCTCCCAGAGGCCAGG - Intronic
1061890035 9:133614334-133614356 GCCCAAGGCTGCCCGAGGCCAGG + Intergenic
1062177802 9:135173882-135173904 GCTGGTGGCTACCAGAAGCCGGG - Intergenic
1188593064 X:31863016-31863038 GCCTGAGGCTGCCCGCACCCAGG + Intronic
1189085303 X:38016935-38016957 GCAGGAGACCACCTGAAGCCTGG - Intronic
1189739856 X:44106495-44106517 GCCTGAAGCTACCAGAAGCTGGG + Intergenic
1191077661 X:56472640-56472662 GCCTGAGGCTACCAGAAGCTAGG - Intergenic
1195196620 X:102503323-102503345 GCCCGAGGCTACCAGGAGCTAGG + Intergenic
1198530659 X:137547659-137547681 GCCTGTGGCTACCCGAACACAGG - Intergenic