ID: 1182278710

View in Genome Browser
Species Human (GRCh38)
Location 22:29206080-29206102
Sequence CAGCGCCGCCTCCCGGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 790
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 747}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182278710_1182278714 -10 Left 1182278710 22:29206080-29206102 CCTGCTCCCGGGAGGCGGCGCTG 0: 1
1: 0
2: 2
3: 40
4: 747
Right 1182278714 22:29206093-29206115 GGCGGCGCTGCGTGGAGCATCGG 0: 1
1: 0
2: 0
3: 4
4: 78
1182278710_1182278717 8 Left 1182278710 22:29206080-29206102 CCTGCTCCCGGGAGGCGGCGCTG 0: 1
1: 0
2: 2
3: 40
4: 747
Right 1182278717 22:29206111-29206133 ATCGGGGCAGCTCCGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1182278710_1182278716 -8 Left 1182278710 22:29206080-29206102 CCTGCTCCCGGGAGGCGGCGCTG 0: 1
1: 0
2: 2
3: 40
4: 747
Right 1182278716 22:29206095-29206117 CGGCGCTGCGTGGAGCATCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1182278710_1182278721 28 Left 1182278710 22:29206080-29206102 CCTGCTCCCGGGAGGCGGCGCTG 0: 1
1: 0
2: 2
3: 40
4: 747
Right 1182278721 22:29206131-29206153 CGGACGCAGGTAAGAGCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 49
1182278710_1182278715 -9 Left 1182278710 22:29206080-29206102 CCTGCTCCCGGGAGGCGGCGCTG 0: 1
1: 0
2: 2
3: 40
4: 747
Right 1182278715 22:29206094-29206116 GCGGCGCTGCGTGGAGCATCGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1182278710_1182278718 15 Left 1182278710 22:29206080-29206102 CCTGCTCCCGGGAGGCGGCGCTG 0: 1
1: 0
2: 2
3: 40
4: 747
Right 1182278718 22:29206118-29206140 CAGCTCCGTTCTCCGGACGCAGG 0: 1
1: 0
2: 1
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182278710 Original CRISPR CAGCGCCGCCTCCCGGGAGC AGG (reversed) Exonic
900110785 1:1004673-1004695 AAGCAGCGCCTGCCGGGAGCAGG - Intergenic
900223363 1:1521215-1521237 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
901157877 1:7152674-7152696 CAGAGGCGCCTCCTGGGAGGTGG - Intronic
901498789 1:9638648-9638670 AAGCTCCGCCTCCCGGGTTCTGG - Intergenic
901605442 1:10455575-10455597 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
901683865 1:10932713-10932735 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
901793236 1:11665304-11665326 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
902331333 1:15732487-15732509 CAGCGCCGTCTCCACCGAGCCGG + Exonic
902506465 1:16941648-16941670 CAGCTCCGCCTCCCGGGTTCAGG - Intronic
902856551 1:19210295-19210317 CAGCGCCGCCTCCCAGGAGGGGG + Intergenic
902864573 1:19269649-19269671 CAGCGCCACCACCCGGCAGGTGG - Intergenic
903455436 1:23484017-23484039 CAGCGCCGCCCCTCGGTACCGGG + Exonic
903875863 1:26472677-26472699 CGCCGCCGCCTCCCTGGTGCAGG + Intronic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
903981403 1:27191291-27191313 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
904502352 1:30921838-30921860 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
904745551 1:32708440-32708462 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
904787672 1:32994983-32995005 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
904830081 1:33300709-33300731 CACCACCGCCACCCGGGTGCAGG - Exonic
905177441 1:36146376-36146398 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
905308052 1:37032776-37032798 CTGGGCGGCCGCCCGGGAGCCGG - Intronic
905453844 1:38074193-38074215 CTGCGGCCCCTCCCAGGAGCTGG - Intergenic
906163426 1:43668205-43668227 AAGCCCCGCCTCCCGGGTTCAGG + Intronic
906193436 1:43913896-43913918 CAGGGCCTCCTCCTTGGAGCAGG - Intronic
906380140 1:45327412-45327434 CGGCGCTGCAACCCGGGAGCTGG + Exonic
906495841 1:46303227-46303249 TGGCGCCGCCTCCCGGGACGTGG + Exonic
906950751 1:50333167-50333189 CAGCGCCCCCTGCCGGGCTCCGG + Intergenic
907272434 1:53298773-53298795 CAGCTCCGCCTCCCTTGGGCAGG + Intronic
907722952 1:56990540-56990562 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
908132052 1:61083348-61083370 CAGCGCAGGCTGCGGGGAGCGGG - Intronic
908240988 1:62188895-62188917 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
909150332 1:71994444-71994466 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
911208696 1:95117782-95117804 CCGGGCCGCCTCCCGCGCGCCGG - Intronic
912794116 1:112680572-112680594 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
912837133 1:113006639-113006661 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
913644386 1:120842927-120842949 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
914022823 1:143885087-143885109 CCGCGCCGGGGCCCGGGAGCAGG - Intergenic
914082352 1:144420652-144420674 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
914098752 1:144566163-144566185 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
914177253 1:145289162-145289184 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
914263032 1:146015394-146015416 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
914300232 1:146371488-146371510 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
914531981 1:148530653-148530675 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
914661310 1:149793031-149793053 CCGCGCCGGGGCCCGGGAGCTGG - Intronic
915407337 1:155670754-155670776 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
915425334 1:155821182-155821204 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
915884598 1:159709335-159709357 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
917413503 1:174784099-174784121 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
917817328 1:178724872-178724894 GAGGGCCGCGTTCCGGGAGCGGG + Intergenic
918010730 1:180584137-180584159 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
918714838 1:187772885-187772907 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
919207345 1:194435128-194435150 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
919238593 1:194880294-194880316 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
920168168 1:204051136-204051158 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
920394102 1:205631566-205631588 CAGCCCCACCGGCCGGGAGCGGG - Intronic
920435396 1:205943730-205943752 CAGGGCCGCCTTGGGGGAGCCGG - Intergenic
921148564 1:212382118-212382140 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
921793335 1:219314524-219314546 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
921869673 1:220126023-220126045 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
922538341 1:226400215-226400237 CACCTCCGCCTCCCGGGTTCAGG - Intronic
923164089 1:231342814-231342836 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
924127121 1:240866427-240866449 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
924167727 1:241302465-241302487 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1062801143 10:381486-381508 CAGAGCCACCTCCCTGGAGCTGG - Intronic
1062884209 10:1004363-1004385 CAGCACCTGCTCCCTGGAGCTGG - Intronic
1063037082 10:2297071-2297093 AAGCTCCGCCTCCCGGGTTCTGG + Intergenic
1063340862 10:5262046-5262068 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1063504089 10:6580395-6580417 CAGCCCGGCCTCCCGGGACCCGG + Intergenic
1063664848 10:8055104-8055126 CAGCCCCGGCTCCCGCGAGCCGG + Intronic
1063834487 10:9996810-9996832 AAGCTCCGCCTCCCGGGTTCGGG + Intergenic
1063890472 10:10623002-10623024 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1064032918 10:11894461-11894483 CAGTGCGACCTCCCGGGAGCAGG - Intergenic
1064057042 10:12106506-12106528 CGGCGGCGCCTCCAGGGAGTTGG + Intronic
1064058082 10:12114875-12114897 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1064059981 10:12129496-12129518 CAGCCCCGCCTCCCGGGTCCCGG + Intergenic
1064306734 10:14174153-14174175 CAGAGGCGCCACCCGGGAGAGGG - Intronic
1064670415 10:17707970-17707992 CAGCTCCGCCTCCTGGGTTCAGG + Intronic
1065119726 10:22516588-22516610 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1065244821 10:23746503-23746525 TAGCTCCGCCTCCCGGGTTCAGG + Intronic
1065433496 10:25683529-25683551 CACCTCAGCCTCCCGGTAGCTGG - Intergenic
1065526086 10:26622535-26622557 CTGCGGCGGCTCCCGGGAGGCGG - Intergenic
1066180485 10:32957582-32957604 CAGGGCCGCCTCCTGGCAGCCGG + Intronic
1066460344 10:35607843-35607865 CTGCCCCGACCCCCGGGAGCCGG + Exonic
1066624077 10:37388839-37388861 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1067119028 10:43457938-43457960 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1067837294 10:49649557-49649579 CACCGCAGCCTCCGGGGGGCGGG - Exonic
1068511762 10:57974993-57975015 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1068667596 10:59694017-59694039 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1069478897 10:68762245-68762267 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1070088005 10:73255311-73255333 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1070835589 10:79445281-79445303 CGGCGCCGCACCCCCGGAGCTGG - Exonic
1070946870 10:80399472-80399494 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1071559214 10:86632325-86632347 CAGCGCCGCCTCCCGGGCAAGGG + Intergenic
1073270908 10:102263119-102263141 CAGTGCCGGCTCCCAGGAGCAGG + Intronic
1073330733 10:102668533-102668555 CGCCGCCTCCTCCCTGGAGCCGG - Intergenic
1073851768 10:107628646-107628668 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1075107911 10:119554500-119554522 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1075755488 10:124808255-124808277 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1075767512 10:124905399-124905421 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1075836569 10:125458562-125458584 CAGCCCAGCATCCCTGGAGCCGG - Intergenic
1076555950 10:131321498-131321520 CAGAGGAGCCTCCCAGGAGCAGG - Intergenic
1077028143 11:450776-450798 CAGCACCGCCCCCCGGGTCCCGG + Intronic
1077214671 11:1390398-1390420 CAGCGCGGCCTCCCCGGCCCCGG - Intronic
1077562410 11:3272054-3272076 CAGCGCCTCCTCCCTGCAGGTGG - Intergenic
1077568304 11:3317874-3317896 CAGCGCCTCCTCCCTGCAGGTGG - Intergenic
1078041561 11:7868383-7868405 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1080449956 11:32370589-32370611 CACCTCAGCCTCCCGGTAGCTGG + Intergenic
1081234886 11:40635716-40635738 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1081399033 11:42621328-42621350 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1081810268 11:45910425-45910447 CAGTGCTGCCTCCTGGGGGCAGG - Intronic
1081865063 11:46355188-46355210 CAGCTCTGCCTCCCGGGTTCAGG + Intronic
1082697449 11:56386903-56386925 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1082836638 11:57655905-57655927 AAGCTCCGCCTCCCGGGGTCAGG + Intronic
1083106873 11:60366673-60366695 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1083260157 11:61518416-61518438 CAGAGCCCCTTCCCCGGAGCTGG + Exonic
1083745380 11:64733311-64733333 CAGCACCGGCTCCCAGGACCAGG - Intronic
1083837793 11:65283549-65283571 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1083886490 11:65575935-65575957 TCGCGCCGCGACCCGGGAGCGGG - Intergenic
1084035491 11:66507383-66507405 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1084319914 11:68367465-68367487 CACCCCCTCCTCCAGGGAGCAGG - Intronic
1084515758 11:69637323-69637345 CGGCGGCGGCTCGCGGGAGCCGG - Intergenic
1084922294 11:72480982-72481004 AAGCTCCGCCTCCCGGGTGCAGG + Intergenic
1085302893 11:75468681-75468703 CAGCTCCACCTCCCGGGGGGGGG - Intronic
1085519184 11:77128197-77128219 CGGCTCCGCCTCCTGGGAGAAGG + Intergenic
1085643762 11:78209607-78209629 CAACGTCTCCTCCCGGGAGGAGG + Exonic
1086006350 11:82043007-82043029 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1087705876 11:101491350-101491372 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1089046325 11:115504320-115504342 CGGCGGCGCCTCCCGGGCTCCGG - Exonic
1089799610 11:121014770-121014792 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1090004731 11:122991298-122991320 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1092819240 12:12337477-12337499 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1093035193 12:14326251-14326273 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1095194376 12:39296148-39296170 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1095542633 12:43328858-43328880 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1096015667 12:48271992-48272014 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1096287002 12:50309068-50309090 AAGCTCCGCCTCCCGGGTTCCGG + Intergenic
1096345967 12:50847138-50847160 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1096698871 12:53369136-53369158 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1097166018 12:57087282-57087304 CAGCGCCGCCCCAAGGGGGCCGG + Intronic
1097933094 12:65212453-65212475 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1098403411 12:70098195-70098217 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1100486871 12:95037811-95037833 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1100525867 12:95418991-95419013 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1100974948 12:100112776-100112798 CACCTCCGCCTCCCGGGTTCAGG - Intronic
1101394091 12:104328675-104328697 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1101604460 12:106237443-106237465 AAGCTCCGCCTCCCGGGTTCTGG - Intergenic
1101789220 12:107912492-107912514 CAGCGCCCCCTGCAGGGGGCTGG - Intergenic
1101892765 12:108731333-108731355 CTGCGCCGCCTGACAGGAGCCGG - Intronic
1102077244 12:110069356-110069378 AAGCTCCGCCTCCCGGGTTCCGG - Intronic
1102156354 12:110732313-110732335 AACCTCCGCCTCCCGGGTGCAGG - Intronic
1102475834 12:113187641-113187663 CACCTCAGCCTCCCGGGAGCTGG - Intronic
1103645381 12:122388299-122388321 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1103646205 12:122394769-122394791 AACCTCCGCCTCCTGGGAGCTGG - Intronic
1103801667 12:123541891-123541913 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1104104378 12:125645134-125645156 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1104196831 12:126548394-126548416 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1104326323 12:127802133-127802155 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1104623933 12:130337918-130337940 GAACACCGCCTCCCGGGCGCCGG - Exonic
1105775810 13:23659092-23659114 CAGCGCCGTGTCCCGTGGGCTGG - Exonic
1106208349 13:27620262-27620284 CAGCGCCGCGCCCCGGGAGGCGG - Intronic
1106246869 13:27957699-27957721 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1107002101 13:35559847-35559869 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1107120579 13:36791095-36791117 TTGCTCCGCCTCCCGGGAGGTGG + Intergenic
1107467842 13:40665931-40665953 CACCGCCGCCGCCACGGAGCCGG + Exonic
1108695417 13:52898632-52898654 AACCTCCGCCTCCCGGGATCAGG + Intergenic
1109531265 13:63651146-63651168 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1109632312 13:65066044-65066066 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1109871037 13:68334036-68334058 AAGCTCCGCCTCCCGGGATCGGG - Intergenic
1110546492 13:76761679-76761701 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1110807259 13:79770748-79770770 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1110869954 13:80439077-80439099 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1111156294 13:84331441-84331463 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1111231248 13:85346783-85346805 AAGCTCCGCCTCCCGGATGCAGG - Intergenic
1111558951 13:89918934-89918956 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1112325272 13:98439574-98439596 CAGCGCCCGCTCCCTGGAGCTGG + Intronic
1113843331 13:113372193-113372215 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1113901508 13:113800739-113800761 CAGGGCTGCCTCATGGGAGCTGG - Intronic
1114260968 14:21035856-21035878 CAGGACCGCCTCCCCGTAGCTGG - Intronic
1114460996 14:22886205-22886227 CAGTGATACCTCCCGGGAGCGGG - Exonic
1115152089 14:30297562-30297584 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1115242733 14:31265531-31265553 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1115567779 14:34639463-34639485 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1116850214 14:49901419-49901441 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1116921903 14:50587522-50587544 CACCCCCGCCTCCTGAGAGCTGG + Intronic
1117364433 14:55011440-55011462 AACCGCCGCCTCCCGGGTTCAGG - Intronic
1117478301 14:56118753-56118775 CCGCGCCGCTGCCCGGGACCAGG - Intronic
1117978812 14:61322065-61322087 CAGCGCGGCCCCCCGGGGCCGGG + Exonic
1118208968 14:63749308-63749330 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1119349824 14:73955031-73955053 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1119734543 14:76973600-76973622 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1120170338 14:81242763-81242785 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1120398610 14:84000480-84000502 GAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1120580411 14:86240840-86240862 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1121016736 14:90553475-90553497 CAGCACCCCCTCCAGGGACCAGG + Intronic
1121069539 14:91004884-91004906 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1121209246 14:92194844-92194866 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1121516567 14:94556209-94556231 AAGCGCCACCTCCCGGCAGGAGG - Intergenic
1121517272 14:94561027-94561049 CAGCGCCGCCTTCCTAGATCAGG - Intergenic
1122581396 14:102774001-102774023 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1122725365 14:103747068-103747090 CAGCGCTGCCTTCAGGGAACTGG - Intronic
1122946544 14:105013306-105013328 CAGTGCCGCCTGCGGGGAGCTGG + Intronic
1122964274 14:105114156-105114178 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1123029236 14:105443316-105443338 CTGCACAGCCTGCCGGGAGCCGG - Intronic
1202872566 14_GL000225v1_random:177696-177718 CAGCGGCGCCTCCCGAGTCCCGG - Intergenic
1123902300 15:24889382-24889404 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1124038954 15:26082556-26082578 TGGTGCCGCCTCCCGCGAGCCGG - Intergenic
1124074239 15:26427838-26427860 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1124640718 15:31394403-31394425 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1124925001 15:34062471-34062493 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1125448170 15:39780441-39780463 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1125462473 15:39920183-39920205 CCTCCCCGCCTCCCGGGCGCCGG - Exonic
1125503347 15:40252830-40252852 GAGCTCCGCGTCCCTGGAGCGGG + Exonic
1125535903 15:40441130-40441152 CAGCGCCTCCTCCTGGGGGCCGG - Intronic
1125541191 15:40471042-40471064 CGGCGCCGCAGCCCGGGAGCCGG + Exonic
1125571221 15:40719748-40719770 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1126297363 15:47155246-47155268 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1126786201 15:52179637-52179659 CCGCGCCACCGCCCGGGAGCAGG - Intronic
1127222695 15:56896841-56896863 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1127446785 15:59071215-59071237 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1127674874 15:61229126-61229148 CAGCGGGGTCTCCCTGGAGCCGG + Intronic
1128323127 15:66706311-66706333 CAGCGCCTCCTTCTGGGAGAAGG - Intronic
1128394906 15:67214720-67214742 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1128987137 15:72230237-72230259 CCGCCCTGCCTCCCGGCAGCGGG + Intronic
1129223468 15:74149811-74149833 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1129322266 15:74781989-74782011 CGGCGCCCCCTGCCGGGCGCCGG - Intergenic
1129351996 15:74960905-74960927 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1129758595 15:78113610-78113632 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1130115466 15:81001587-81001609 CGGCGCCGCTTCCCAAGAGCTGG + Exonic
1130339171 15:82984700-82984722 CAGCTCAGCCTCCGGAGAGCTGG - Intronic
1131091649 15:89628653-89628675 CCGCGTCTCCTCCCGGGTGCGGG + Exonic
1131182680 15:90251193-90251215 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1131830892 15:96354044-96354066 CAGCGCCTCCTCCCGGGGACTGG - Intergenic
1132203679 15:99972167-99972189 AAGCTCCGCCTCCCGGGTTCAGG - Exonic
1132413095 15:101600300-101600322 CACCTCTGCCTCACGGGAGCTGG + Intergenic
1132724615 16:1333461-1333483 CAGCCCCGCATCCCGGGGGAGGG + Intergenic
1132728741 16:1350299-1350321 GAGCGCCGCCATCCGGCAGCAGG - Intronic
1132839069 16:1969560-1969582 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1132889462 16:2196689-2196711 TGGCGCCGCCTCCCGGACGCCGG + Intergenic
1132974542 16:2704848-2704870 TAGCGCCGCCTGCCAGGAGTGGG + Intronic
1132978573 16:2722561-2722583 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1133049131 16:3106701-3106723 CACCGGCGCCTCCCGTGGGCGGG + Intergenic
1133136422 16:3715354-3715376 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1133311307 16:4848133-4848155 CTGCGCCGCCGCCCGGGGACCGG + Intronic
1133493704 16:6296500-6296522 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1133825516 16:9274935-9274957 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1134190776 16:12119673-12119695 GTGCGCTGCCTCCCAGGAGCCGG + Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136283892 16:29230285-29230307 CAGCGTCGCCACCTGGGAGTTGG + Intergenic
1136367662 16:29816366-29816388 GAGCGCCCCCTCCCGGGGACGGG + Exonic
1136593262 16:31230642-31230664 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1136603998 16:31319892-31319914 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1139032823 16:62906001-62906023 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1139520717 16:67481247-67481269 CCGCGCAGCCACCCGGAAGCCGG - Intergenic
1139602857 16:67997436-67997458 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1139688873 16:68626214-68626236 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1139739343 16:69021965-69021987 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1139902139 16:70336336-70336358 AAGCTCCGCCTCCCGGGTTCTGG - Intronic
1140391570 16:74591544-74591566 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1140608671 16:76571558-76571580 AAGCTCCGCCTCCCGGGCTCAGG - Intronic
1140612636 16:76619407-76619429 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1140749275 16:78008612-78008634 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1140797931 16:78457832-78457854 AAGCTCCGCCTCCCGGGATCAGG - Intronic
1141474235 16:84261704-84261726 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1141720081 16:85751110-85751132 CAGCGCCGCCCTCTAGGAGCGGG - Intronic
1141989451 16:87602153-87602175 CTCGGCCCCCTCCCGGGAGCTGG - Intronic
1142331659 16:89458304-89458326 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1142559648 17:802614-802636 CCGCGCAGCCTCCCTGGGGCTGG + Intronic
1142596419 17:1031970-1031992 GAGCGCCGCCTCCCAGGCCCAGG + Intronic
1142610826 17:1108637-1108659 CCTCGCCGCCTCCCTGGAGCGGG - Intronic
1142654507 17:1382436-1382458 AAGCTCCGCCTCCCGGGTTCTGG + Intronic
1142888312 17:2927233-2927255 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1143144833 17:4768084-4768106 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1143197421 17:5086807-5086829 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1143209818 17:5177112-5177134 AAGCGCCGCCTCCCTGGTTCAGG - Intergenic
1143730129 17:8877190-8877212 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1143745489 17:8991034-8991056 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1144601143 17:16615177-16615199 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1144910053 17:18673023-18673045 CGGCGGCGGCGCCCGGGAGCCGG - Exonic
1145771245 17:27494881-27494903 CAGGGCCGCCTCCCAGGCACAGG - Intronic
1146166857 17:30596388-30596410 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1146370967 17:32265680-32265702 GAGCGGCGCGGCCCGGGAGCGGG - Intergenic
1146398760 17:32487646-32487668 CAGCGTGGCCTTCCGGTAGCTGG - Exonic
1146793128 17:35764223-35764245 CAGCGCCACCTGCTGGGTGCTGG - Exonic
1147239543 17:39081543-39081565 AAGCTCCGCCTCCCGGGTTCTGG - Intronic
1147734373 17:42625804-42625826 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1147804575 17:43121291-43121313 CAGCTCCGCCTCCCGGGTTCAGG - Intronic
1147879825 17:43646299-43646321 CCGCGCCCCCTCCTGGCAGCGGG + Intronic
1148116916 17:45181229-45181251 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1148442959 17:47721214-47721236 GAGTGCCGCCTCCCGGTGGCTGG + Intergenic
1149658880 17:58324379-58324401 CACCGCCGCCCCCGGGTAGCTGG + Intronic
1149817427 17:59739640-59739662 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1149885371 17:60334608-60334630 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1150185489 17:63176722-63176744 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1150255781 17:63742846-63742868 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1150502424 17:65663962-65663984 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1150840230 17:68600501-68600523 CCGCGCCTCCTCCCTGGCGCGGG - Exonic
1151189018 17:72384380-72384402 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1151309647 17:73285516-73285538 CAGCCCTGCCTTCCGGGGGCCGG - Exonic
1151370790 17:73645049-73645071 GGGCGCCGCGTCCCCGGAGCCGG - Intergenic
1151677322 17:75605353-75605375 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1151768454 17:76144387-76144409 AAGCTCCGCCTCCCGGGTTCAGG + Exonic
1152242135 17:79166258-79166280 CAGCGCAGCCTCCCGTGGGAGGG + Intronic
1152354650 17:79800958-79800980 TAGGGCGGGCTCCCGGGAGCAGG - Intronic
1152396289 17:80035709-80035731 CAGCGCCCCCTCGGCGGAGCTGG - Intronic
1152432447 17:80256707-80256729 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1152433075 17:80260432-80260454 CCGAGGCGCCTCCCGGGGGCTGG + Intergenic
1152552214 17:81035444-81035466 CGGCGCGGCCACCCGGGACCCGG + Intronic
1152648579 17:81481654-81481676 GAGCGCCCCCGCCCCGGAGCAGG + Intergenic
1152736732 17:82000910-82000932 CAACTCGGCCTCCCGGCAGCTGG + Intronic
1152814442 17:82399083-82399105 CACCTCAGCCTCCCGGGTGCTGG + Intronic
1152851909 17:82641814-82641836 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1153814911 18:8783711-8783733 CAGCTCGGCCTCCCGGGTGCTGG - Exonic
1154063644 18:11086435-11086457 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1154064417 18:11093666-11093688 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1154155647 18:11942198-11942220 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1154168030 18:12030382-12030404 CATCGCCATCTCCCGGGTGCTGG - Exonic
1154394018 18:13970630-13970652 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1155054544 18:22171960-22171982 CAACGGCGCCGCGCGGGAGCCGG + Exonic
1155158901 18:23179998-23180020 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1155220938 18:23685310-23685332 AAGCTCCGCCTCCCGGGTTCTGG + Intergenic
1156098960 18:33570335-33570357 CAGCTCCGTCTCCCGGGTTCAGG - Intergenic
1158263185 18:55632118-55632140 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1158277097 18:55780402-55780424 CAGCCCCGCCTCGCGGCCGCGGG + Intergenic
1158784496 18:60693122-60693144 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1159016071 18:63102482-63102504 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1159040540 18:63319919-63319941 CAGCGCCGCCGCGCAGGACCAGG - Exonic
1159189935 18:65028243-65028265 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1159633630 18:70779253-70779275 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1159763219 18:72454513-72454535 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1160231004 18:77048999-77049021 CAGCTCCGCCTCCCGGGTTCAGG + Intronic
1160282402 18:77503598-77503620 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1160593459 18:79958174-79958196 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1160717863 19:584547-584569 CAGCGCCGCCTGGTGGCAGCCGG - Intergenic
1160791550 19:925885-925907 CAGCGCCGCGGCCCGGGCGCGGG - Intronic
1160813385 19:1023621-1023643 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1160918891 19:1510630-1510652 CGGCGCTGCCTCCGGTGAGCGGG - Exonic
1161019593 19:2002193-2002215 CACCTCAGCCTCCCGGTAGCTGG + Intronic
1161117859 19:2509005-2509027 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1161172429 19:2819758-2819780 CAGCGCCGCCTCCGGGCGGGCGG - Intergenic
1161183333 19:2900202-2900224 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1161222037 19:3122317-3122339 GAGCGCCGCCCCCGGGGAGCGGG + Exonic
1161380218 19:3960902-3960924 CAGCGCCACCTCCCTGCGGCTGG - Intronic
1161473069 19:4470799-4470821 AAGCTCCGCCTCCCGGGGTCAGG + Intergenic
1162022064 19:7872558-7872580 CTGGGCCGCCTCCTGGCAGCCGG + Exonic
1162089732 19:8271206-8271228 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1162144442 19:8605250-8605272 CGGCGCTGCCTCCGGGGAGGAGG + Exonic
1162241514 19:9358598-9358620 CACCTCGGCCTCCCAGGAGCTGG + Intronic
1162302970 19:9854628-9854650 CAGAGGAGCCTCCCGGGCGCCGG - Exonic
1162344058 19:10109672-10109694 CAACCCCGACTCCCAGGAGCTGG + Exonic
1162483185 19:10941522-10941544 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1162484592 19:10951560-10951582 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1162763461 19:12903171-12903193 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1162875761 19:13619788-13619810 CACCTCAGCCTCCCGAGAGCTGG + Intronic
1162996609 19:14339802-14339824 CAGAGCCACTTCTCGGGAGCTGG - Intergenic
1163030004 19:14537825-14537847 CACCTCCGCCTCCCGGGTTCAGG + Intronic
1163100265 19:15091575-15091597 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1163377770 19:16944332-16944354 CAGAGCTGCCTCCAGGAAGCCGG + Intronic
1163593549 19:18207671-18207693 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1163706703 19:18818541-18818563 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1163789709 19:19299452-19299474 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1164048206 19:21561162-21561184 AACCTCCGCCTCCCGGGTGCCGG + Intergenic
1164229473 19:23274908-23274930 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1164492528 19:28727750-28727772 AAGCGCCCCCTCCCGGCAGGCGG + Intergenic
1165213814 19:34254960-34254982 CAGCGCGACCTCCCGGGCCCCGG - Intronic
1165233153 19:34400087-34400109 CAGTGCCGGCTCCGGGGAGGAGG - Exonic
1165462915 19:35954536-35954558 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1166019923 19:40018053-40018075 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1166195475 19:41203017-41203039 CAACTCCGCCTCCCGGGTTCAGG - Intronic
1166317880 19:41998885-41998907 CCCCGCCGGCCCCCGGGAGCTGG - Exonic
1166378819 19:42343989-42344011 CAGCGTCTGCTCCCGGGACCCGG + Exonic
1166789148 19:45387634-45387656 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1167302606 19:48687502-48687524 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1167447328 19:49545376-49545398 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1167722085 19:51185976-51185998 CAGAGCCCCCTCCCTGGGGCTGG + Intergenic
1167825569 19:51969972-51969994 AACCTCCGCCTCCCAGGAGCAGG + Intronic
1167869697 19:52357561-52357583 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1168039218 19:53744565-53744587 AAGCTCCGCCTCCCGGGCTCAGG - Intergenic
1168221922 19:54966625-54966647 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1168263889 19:55210644-55210666 CACCTCAGCCTCCCGGTAGCTGG - Intergenic
1168529484 19:57116593-57116615 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1168544683 19:57240645-57240667 CACCGCCCCCTCCCTAGAGCCGG - Intergenic
925142233 2:1558344-1558366 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
925180553 2:1814375-1814397 GAGCGCAGCCTCCCGGGACGTGG + Intronic
925820062 2:7791377-7791399 AAGCTCCGCCTCCCGGGTTCGGG - Intergenic
926056565 2:9777319-9777341 CAGGGCGTCCCCCCGGGAGCTGG + Intergenic
926190056 2:10721632-10721654 AGCCGCTGCCTCCCGGGAGCCGG + Exonic
926718558 2:15942505-15942527 CGGCGCCGGCTCCCGGGGACTGG - Exonic
927202402 2:20586146-20586168 CACCTCCTCCTCCCAGGAGCCGG + Intronic
927625953 2:24718785-24718807 CAGCTCTGCCTCCCGGGTTCAGG - Intronic
928153847 2:28858120-28858142 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
928421225 2:31138760-31138782 CAGCGCCGCCTGGCGAGGGCCGG - Intronic
929203473 2:39263352-39263374 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
929556961 2:42931632-42931654 CAGCGCCCCCACCAGGAAGCAGG - Intergenic
930029849 2:47051765-47051787 CATCGCCGCCTCCCGGCTGGAGG + Exonic
930085370 2:47493555-47493577 CAGCTCTGCCTCCAGCGAGCTGG - Intronic
930464574 2:51731456-51731478 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
931272530 2:60715466-60715488 CAACTCCGCCTCCCGGGTTCAGG - Intergenic
931349552 2:61475115-61475137 CAGCTCCGCCTCCCGGGTTCAGG + Intergenic
931547913 2:63409063-63409085 AAGCGCCACCTCCCGGCAGGAGG + Intronic
931681698 2:64755033-64755055 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
932232932 2:70097180-70097202 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
933191693 2:79340750-79340772 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
934217957 2:90051520-90051542 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
934638042 2:96009163-96009185 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
936278564 2:111120178-111120200 CTTCGCCGCCTCCCGGGTGAGGG - Intronic
937598733 2:123703497-123703519 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
937778028 2:125804569-125804591 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
938191458 2:129285534-129285556 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
938515045 2:131995785-131995807 AAGCTCCGCCTCCCGGGTTCTGG - Intergenic
939298378 2:140300493-140300515 CAGCGATGCATCCAGGGAGCTGG + Intronic
939323545 2:140655859-140655881 AAGCTCCGCCTCCCGGGTACAGG - Intronic
939432604 2:142130529-142130551 CAGCTCCGCTCCCCGGGACCGGG - Intronic
939627371 2:144494068-144494090 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
939921984 2:148127055-148127077 AAGCTCCGCCTCCCGGGTTCGGG + Intronic
940119094 2:150242834-150242856 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
940646131 2:156394513-156394535 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
941209374 2:162617395-162617417 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
941278917 2:163525811-163525833 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
941808585 2:169734059-169734081 CAGCGCCGCGTCCCGAGCCCCGG + Exonic
941953894 2:171184918-171184940 AAGCTCCGCCTCCCAGGATCAGG + Intronic
942086151 2:172445565-172445587 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
942098922 2:172559028-172559050 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
943071258 2:183143072-183143094 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
943507483 2:188779808-188779830 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
943580119 2:189674582-189674604 CACTGCCGCCGCCCGGGCGCGGG - Intronic
944599264 2:201286695-201286717 AAGCTCCGCCTCCCGGGTTCAGG + Exonic
945260835 2:207842017-207842039 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
945473025 2:210249325-210249347 AACCTCCGCCTCCCGGGTGCAGG + Intergenic
945528850 2:210925457-210925479 CAGCTGCGCCTCCCGGGTTCAGG + Intergenic
945601160 2:211866167-211866189 AAGCCCCGCCTCCCGGGTACAGG - Intronic
946287722 2:218717878-218717900 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
946889793 2:224263233-224263255 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
947255808 2:228162778-228162800 CACCTCCGCCTCCCGGGTTCAGG + Intronic
947637490 2:231687509-231687531 CACAGCCGCCTCCCGGGAGTTGG - Intergenic
948352346 2:237351180-237351202 CACCTCCGCTTCCCTGGAGCAGG + Exonic
948473750 2:238203486-238203508 CAACGCCGCTTACCGGCAGCCGG + Exonic
1169078654 20:2779630-2779652 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1169278193 20:4247482-4247504 CAGATCCCCCTCCCGGGAGGTGG - Intronic
1169383209 20:5126827-5126849 GAGCTCCCTCTCCCGGGAGCAGG - Exonic
1169694316 20:8370082-8370104 CAGTGCCTCCTTCCGGGAGAAGG + Intronic
1170933581 20:20791280-20791302 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1171486670 20:25490782-25490804 CAGCCTCTCCTCCCGGGAGGTGG + Intronic
1172305295 20:33876301-33876323 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1172971486 20:38876052-38876074 CAACTCCGCCTCCCGGGTTCGGG + Intronic
1173240855 20:41295767-41295789 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1173475512 20:43356331-43356353 AAGCTCCGCCTCCCGGGTTCGGG - Intergenic
1173896485 20:46554893-46554915 CAGGTCCACCTCCCGGGTGCAGG - Intergenic
1174402211 20:50282209-50282231 CATCGCCTCCTCCAGGCAGCAGG - Intergenic
1174636771 20:52007746-52007768 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1175535259 20:59706540-59706562 CAGCACTGGCTCCTGGGAGCTGG - Intronic
1175777771 20:61663848-61663870 CAGGGCGGCCTCGAGGGAGCTGG - Intronic
1175845487 20:62056153-62056175 AACCTCCGCCTCCCGGGATCAGG - Intronic
1175893130 20:62324048-62324070 CAGGGCCTCGTCCCGGGAGGAGG + Intronic
1175933049 20:62502451-62502473 CAGGGTCGGCTCTCGGGAGCTGG + Intergenic
1176059482 20:63166144-63166166 CAGGGCCTCCTCCTGGAAGCCGG + Intergenic
1176261908 20:64186270-64186292 CAGCGCCGCCCTCTGGGTGCCGG + Intronic
1176380629 21:6110802-6110824 GGGCGCCCCCTCCCGGGCGCTGG - Intergenic
1176549076 21:8213727-8213749 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176556970 21:8257947-8257969 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176568008 21:8396765-8396787 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1176575912 21:8440984-8441006 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1177238393 21:18423488-18423510 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1178309983 21:31521951-31521973 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1178357820 21:31923324-31923346 CACCTCAGCCTCCCAGGAGCTGG - Intronic
1178992690 21:37367854-37367876 GGCCGCGGCCTCCCGGGAGCCGG + Intronic
1179742843 21:43427438-43427460 GGGCGCCCCCTCCCGGGCGCTGG + Intergenic
1180285533 22:10741780-10741802 CAGCGGCGCCTCCCGAGTCCCGG + Intergenic
1180376960 22:12102628-12102650 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1180626049 22:17194256-17194278 AAGAGCCGACTCCCGGGAGGAGG - Intronic
1181012480 22:20050127-20050149 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1181905298 22:26190013-26190035 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1181934648 22:26429693-26429715 AAGCGCCGCCGCCTCGGAGCCGG + Intronic
1182278710 22:29206080-29206102 CAGCGCCGCCTCCCGGGAGCAGG - Exonic
1182531523 22:30963051-30963073 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1182763545 22:32742192-32742214 CAGCTCCGCTTCCCGGGTTCAGG - Intronic
1183586363 22:38755499-38755521 CCGGGCAGCCTCCCGGGAGGAGG - Intronic
1183601562 22:38843341-38843363 CCGCGCGGCCTCCAGGGCGCCGG - Exonic
1183983199 22:41554623-41554645 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1184029131 22:41880936-41880958 CAGAGCCGCATCCCGGGCGCTGG - Exonic
1184074633 22:42168552-42168574 CAACGACGCCTGCTGGGAGCCGG + Intronic
1184281977 22:43442521-43442543 CAGCTCCACCTCCCGGAGGCAGG - Intronic
1184571797 22:45329658-45329680 CAGGGCCGCCTGAGGGGAGCGGG + Intronic
1184662614 22:45972323-45972345 CAGCGCCGCCGCCCTGCATCGGG - Intronic
1184999678 22:48237753-48237775 CAGCGCCCCCTCCCCAGCGCAGG + Intergenic
1185221781 22:49632697-49632719 CAGCGCCACCTGCCGGGACGCGG + Intronic
1185238394 22:49727634-49727656 CAGCGGTGCCTCCTGAGAGCTGG - Intergenic
1185333313 22:50261130-50261152 CCGCGGCGCCTTCCCGGAGCGGG + Intronic
1203253963 22_KI270733v1_random:130042-130064 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203262019 22_KI270733v1_random:175121-175143 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
949286277 3:2409327-2409349 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
950044971 3:9943625-9943647 CAGTGCAGCCTCCAGGGGGCTGG - Intronic
950067846 3:10127508-10127530 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
950074228 3:10175806-10175828 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
950284633 3:11734965-11734987 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
950415165 3:12864977-12864999 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
950415453 3:12866636-12866658 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
951055455 3:18141997-18142019 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
951212426 3:19990257-19990279 CACCTCAGCCTCCCGAGAGCTGG + Intronic
951855676 3:27194205-27194227 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
954454807 3:50592017-50592039 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
956139548 3:66131845-66131867 CAACTCCGCCTCCCGGGTTCAGG + Intergenic
956810203 3:72857143-72857165 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
957834434 3:85568682-85568704 AACCTCCGCCTCCTGGGAGCAGG + Intronic
958412180 3:93831836-93831858 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
958500944 3:94908000-94908022 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
958528098 3:95288778-95288800 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
958708952 3:97693724-97693746 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
958773316 3:98452004-98452026 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
958917123 3:100062191-100062213 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
959403275 3:105929529-105929551 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
959405873 3:105961297-105961319 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
959660711 3:108864698-108864720 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
959821185 3:110737257-110737279 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
959932494 3:111999343-111999365 CAGCCCCGTCTGCAGGGAGCCGG + Exonic
959974551 3:112443971-112443993 CAGCTCCGCCTCCCGGGTTCAGG - Intergenic
960103706 3:113771517-113771539 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
960383375 3:116991431-116991453 AAGCTCCGCCTCCCGGGTTCTGG - Intronic
960391032 3:117078020-117078042 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
961144770 3:124584723-124584745 CAGCGCCGCCGCCCGAGAGCCGG - Intronic
961430344 3:126877471-126877493 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
962605697 3:137031211-137031233 CAGCTCAGCCTCCAGGTAGCTGG + Intergenic
963053635 3:141164622-141164644 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
963236675 3:142963376-142963398 TGGCGCCGGCTCCCGGGCGCTGG + Exonic
963797210 3:149642691-149642713 AAGCTCCGCCTCCCGGGTTCCGG - Intronic
963885926 3:150582394-150582416 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
963886285 3:150586291-150586313 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
963988328 3:151624132-151624154 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
964143450 3:153430606-153430628 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
964743148 3:159988294-159988316 CAGCAAAGGCTCCCGGGAGCAGG - Intergenic
964765586 3:160175716-160175738 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
965707584 3:171524747-171524769 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
966614295 3:181897422-181897444 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
966720156 3:183054265-183054287 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
966808739 3:183825569-183825591 GAGCGCCGCGCGCCGGGAGCGGG - Exonic
966868585 3:184276087-184276109 CGGGGCCGCGGCCCGGGAGCGGG + Intronic
967313672 3:188130412-188130434 CACCTCAGCCTCCCGAGAGCTGG + Intergenic
967347627 3:188475819-188475841 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
968225915 3:196972001-196972023 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
968694581 4:2017052-2017074 AAGCTCCGCCTCCCGGGTTCTGG + Intronic
970092730 4:12428530-12428552 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
970460620 4:16271120-16271142 CAGAGTCGCCTCCTGGGGGCAGG - Intergenic
970755567 4:19422005-19422027 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
970944169 4:21670735-21670757 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
971306125 4:25483118-25483140 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
971444526 4:26728931-26728953 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
972514567 4:39800048-39800070 CAGCTCCGCCTCCCGGATTCAGG + Intergenic
974281141 4:59795501-59795523 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
978250680 4:106627986-106628008 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
978495378 4:109353986-109354008 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
979559964 4:122090533-122090555 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
982731815 4:158964071-158964093 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
982803501 4:159733773-159733795 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
983227324 4:165097410-165097432 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
983244692 4:165274525-165274547 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
983422880 4:167542580-167542602 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
983433997 4:167688509-167688531 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
984298905 4:177890048-177890070 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
984801335 4:183719642-183719664 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
985006170 4:185537200-185537222 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
985217712 4:187671714-187671736 AAGCGCCCCCTCCCGGCAGGAGG - Intergenic
985269095 4:188177329-188177351 AAGCTCCGCCTCCCGGGTTCCGG - Intergenic
985287970 4:188356535-188356557 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
985320793 4:188708591-188708613 AAGCTCCGCCTCCCGGGTTCTGG - Intergenic
1202758558 4_GL000008v2_random:88060-88082 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
985589694 5:758095-758117 CAGCTCAGCCTGCAGGGAGCGGG - Intronic
985841410 5:2308590-2308612 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
986381224 5:7188325-7188347 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
986497929 5:8365263-8365285 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
986505765 5:8449541-8449563 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
987132476 5:14872041-14872063 CAGCGCCGCCGCCCCCGGGCCGG - Intergenic
987319329 5:16753246-16753268 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
987774754 5:22349814-22349836 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
988003053 5:25373811-25373833 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
989582000 5:43042116-43042138 CAGCGCCGCCGCACGGGTTCCGG - Intronic
990376754 5:55177997-55178019 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
990622094 5:57570852-57570874 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
991100389 5:62785377-62785399 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
991117418 5:62970225-62970247 AAGCGCCACCTCCCGGCAGGAGG + Intergenic
991333161 5:65515283-65515305 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
991984239 5:72266776-72266798 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
993324586 5:86517224-86517246 AAGCTCCGCCTCCCGGGATCAGG + Intergenic
994250268 5:97527893-97527915 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
994273431 5:97808484-97808506 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
994488939 5:100416901-100416923 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
995266332 5:110165989-110166011 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
996361324 5:122650209-122650231 AAGCTCCGCCTCCCGGGTTCCGG - Intergenic
996549584 5:124716059-124716081 CAGCTCCGCCTCCCGGGTTCAGG - Intronic
997044004 5:130291379-130291401 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
997780624 5:136654160-136654182 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
998287560 5:140877643-140877665 CAGCGCCGCCCACCGTGAGCCGG + Exonic
999143499 5:149378060-149378082 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
999334118 5:150700631-150700653 CAGCGCCCCCTCCCGCGATCGGG - Intronic
999344191 5:150800764-150800786 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1000711975 5:164591531-164591553 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1000753614 5:165129219-165129241 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1000844043 5:166256946-166256968 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1001496046 5:172188282-172188304 CAGGGCCGCCTCCCTTGTGCCGG + Exonic
1001624070 5:173115717-173115739 AAGCTCCGCCTCCCAGTAGCTGG + Intronic
1001906930 5:175480317-175480339 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1001926305 5:175639683-175639705 CAGCTCTGCCTCTCGGTAGCAGG + Intergenic
1002071324 5:176680356-176680378 CTGGGCCGGCTCCCGGGCGCGGG + Intergenic
1002927949 6:1615436-1615458 CAGGGCCCCCAGCCGGGAGCGGG - Intergenic
1003077232 6:2993224-2993246 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1003325316 6:5086057-5086079 CAGCGCCGCCTTCCCGGCTCCGG + Exonic
1003808537 6:9753899-9753921 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1003871291 6:10404931-10404953 CAGGGCCGCCTCCCGGCCGCCGG - Intronic
1003886258 6:10523889-10523911 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1005612434 6:27539274-27539296 AAGCTCCGCCTCCCGGGTTCTGG - Intergenic
1006057892 6:31399449-31399471 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1006428749 6:33982442-33982464 CAGCGCCCCCGCCAAGGAGCTGG + Intergenic
1006637201 6:35469148-35469170 CAGCCGCGCCTGCCCGGAGCAGG - Intronic
1006891599 6:37433534-37433556 CAGCTCGGGCTCCAGGGAGCCGG - Intronic
1007470080 6:42084097-42084119 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1008308912 6:49940722-49940744 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1008338218 6:50332320-50332342 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1009320232 6:62279010-62279032 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1009590503 6:65663761-65663783 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1009971397 6:70628655-70628677 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1010565110 6:77401052-77401074 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1010792924 6:80085414-80085436 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1010966401 6:82214035-82214057 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1011042681 6:83047998-83048020 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1011510915 6:88099696-88099718 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1011636407 6:89378537-89378559 CAGCAGCGCCTACCTGGAGCTGG + Intronic
1012272048 6:97225652-97225674 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1013242766 6:108261153-108261175 CGGCCGGGCCTCCCGGGAGCCGG - Exonic
1013273259 6:108561090-108561112 CGGCGGCGGCGCCCGGGAGCCGG + Exonic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1013832806 6:114294525-114294547 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1014137654 6:117907606-117907628 CAGCACCGCCTCCCGGGCCGCGG + Exonic
1015533191 6:134241700-134241722 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1015625872 6:135181001-135181023 CGCCGCCGCGACCCGGGAGCGGG + Intergenic
1016036792 6:139391355-139391377 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1016037396 6:139397109-139397131 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1016713990 6:147203711-147203733 CAGCAGGGCCTCCCAGGAGCCGG - Intergenic
1017040867 6:150307777-150307799 CTGCCCTGCCTCCTGGGAGCTGG + Intergenic
1017190443 6:151648167-151648189 AAGCGCCACCTCCCGGCAGAAGG - Intergenic
1017461520 6:154655363-154655385 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1017665773 6:156719339-156719361 GAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1017877495 6:158536711-158536733 CCGCGCAGCCTCCCGGGTCCCGG - Exonic
1018890035 6:167976719-167976741 CAGCGCTGAGTCCCAGGAGCAGG - Intergenic
1019381652 7:727284-727306 CTGCGCCGCCGCCCTGGCGCAGG + Exonic
1019385832 7:755615-755637 CACCTCAGCCTCCCGGGAGCTGG - Intronic
1019871017 7:3761470-3761492 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1020115628 7:5474787-5474809 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1020148490 7:5663500-5663522 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1020521112 7:9188484-9188506 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1022483273 7:30758228-30758250 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1022551869 7:31248286-31248308 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1022584820 7:31598483-31598505 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1024534400 7:50418261-50418283 CAGCGCCTCCTCCCTGGAAATGG - Intergenic
1024985861 7:55192608-55192630 CGGCGCCTCCTCCCGGCAACAGG - Intronic
1026091537 7:67304540-67304562 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1026203179 7:68232535-68232557 AACCTCCGCCTCCCGGGATCAGG - Intergenic
1026410038 7:70110951-70110973 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1026744607 7:73001264-73001286 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1026796118 7:73367091-73367113 CAGCCCTGCCTCCCGCCAGCTGG + Intergenic
1026948108 7:74328992-74329014 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1027030715 7:74885929-74885951 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1027099130 7:75363828-75363850 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1027470248 7:78564873-78564895 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1027477872 7:78655897-78655919 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1027663708 7:81018343-81018365 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1027783242 7:82546927-82546949 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1028138521 7:87246893-87246915 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1028452246 7:90998805-90998827 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1028610141 7:92701485-92701507 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1029275585 7:99402145-99402167 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1029400230 7:100340608-100340630 CACCTCCGCCTCCCGGGTTCAGG + Intronic
1030262546 7:107580439-107580461 CCGCGGCGCCTTCTGGGAGCGGG + Intronic
1030532739 7:110730604-110730626 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1031425524 7:121600995-121601017 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1031695726 7:124850647-124850669 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1032165827 7:129543913-129543935 CTTCCCAGCCTCCCGGGAGCTGG - Intergenic
1033128550 7:138726069-138726091 AAGCTCCGCCTCCCGGGCTCAGG + Intronic
1033934542 7:146567800-146567822 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1033950718 7:146781144-146781166 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1034224966 7:149474966-149474988 CCGCGGCGCCCCCCGGGGGCCGG - Exonic
1034836082 7:154352379-154352401 AAGCTCCGCCTCCCGGGTTCTGG - Intronic
1035642044 8:1191250-1191272 CAGCTCCACCTCCCGGGTTCAGG + Intergenic
1035866647 8:3090233-3090255 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1036850049 8:12194647-12194669 CGGCCCCGCCTCCCGGGCACTGG - Intergenic
1036871413 8:12436920-12436942 CGGCCCCGCCTCCCGGGCCCTGG - Intergenic
1037154852 8:15686989-15687011 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1038008812 8:23457618-23457640 GAGCGCGGCCTCCAGGAAGCCGG - Exonic
1039585005 8:38699658-38699680 CAGCTCCGCCTCCTGGGTTCAGG + Intergenic
1039623185 8:39020168-39020190 AAGCTCCGCCTCCCGGGTTCTGG - Intronic
1039650480 8:39335708-39335730 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1040000544 8:42572704-42572726 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1040004244 8:42605334-42605356 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1040572469 8:48622973-48622995 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1041109291 8:54470106-54470128 CTGCGCCGCCTCCCGGAGGAAGG - Intergenic
1041443096 8:57919431-57919453 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1042365600 8:67933221-67933243 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1042548579 8:69973207-69973229 AAGCTCCGCCTCCCGGGCTCAGG + Intergenic
1044147020 8:88729286-88729308 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1044343239 8:91071428-91071450 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1045004990 8:97909863-97909885 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1045011679 8:97964146-97964168 CAGGGCCAGCTCCTGGGAGCTGG + Intronic
1045625858 8:104049341-104049363 AAGCTCCGCCTCCCGGGTTCGGG - Intronic
1046787851 8:118287204-118287226 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1047122970 8:121926957-121926979 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1047835467 8:128685451-128685473 CACCTCAGCCTCCCTGGAGCTGG - Intergenic
1048018507 8:130518618-130518640 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1049182647 8:141230943-141230965 CAGCACAGCGTCCCCGGAGCAGG - Intronic
1049442254 8:142614780-142614802 CCACGCCCCCTCCCGGGCGCTGG + Intergenic
1049625712 8:143619064-143619086 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1049689570 8:143952786-143952808 CAGCCCCGCCTCCCCCAAGCCGG + Intronic
1049708234 8:144052442-144052464 CTGCGCCGCCTCCCAGGTGCGGG - Exonic
1049712892 8:144074311-144074333 CAACTCAACCTCCCGGGAGCTGG - Intergenic
1049850427 8:144827452-144827474 CAGCCCCGCCTCCCAGGCTCCGG - Intronic
1049960771 9:736037-736059 AAGCTCCGCCTCCCGGGTTCGGG + Intronic
1050300883 9:4257653-4257675 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1050747282 9:8891213-8891235 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1051912002 9:22163215-22163237 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1052151056 9:25115944-25115966 CAGCTCCGCCTCCCAGGTTCAGG - Intergenic
1052258309 9:26485404-26485426 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1052295301 9:26890861-26890883 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1052517773 9:29505331-29505353 AAGCCCCGCCTCCCGGGTTCAGG + Intergenic
1052535241 9:29737871-29737893 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1053506171 9:38645343-38645365 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1053533635 9:38905253-38905275 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1053835985 9:42136372-42136394 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1054205859 9:62129682-62129704 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1054594646 9:67052272-67052294 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1054632501 9:67458688-67458710 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1055010570 9:71560897-71560919 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1055043553 9:71901068-71901090 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1055308205 9:74952245-74952267 CGCCACCGCCCCCCGGGAGCCGG + Exonic
1055911621 9:81359566-81359588 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1056528761 9:87468465-87468487 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1056530303 9:87480841-87480863 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1057403395 9:94744308-94744330 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1057519934 9:95752316-95752338 GAGCGGCGCCTCCGGGGAGAAGG + Intergenic
1057614777 9:96579502-96579524 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1058106083 9:100973404-100973426 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1058481271 9:105397864-105397886 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1058612943 9:106794527-106794549 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1059565221 9:115377769-115377791 AAGCTCCGCCTCCCGGGGTCAGG + Intronic
1059855288 9:118389587-118389609 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1060264025 9:122099709-122099731 CCACGCCGCCTTCCGGGAACTGG - Intergenic
1060368403 9:123043980-123044002 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1060482137 9:124022835-124022857 CAGCGCTGCCCACGGGGAGCGGG + Intronic
1060986562 9:127823225-127823247 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1061317436 9:129805054-129805076 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1061727473 9:132589605-132589627 CAGGGCCCCCTCCCGGGAAAGGG - Exonic
1062031151 9:134362604-134362626 CAGAGCCTACTCCTGGGAGCTGG + Intronic
1203792811 EBV:160704-160726 CAGCGCCCTGTCCCTGGAGCTGG - Intergenic
1203690168 Un_GL000214v1:35074-35096 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1203731888 Un_GL000216v2:98846-98868 CAGCGACGCCTCCCGAGTCCCGG + Intergenic
1203470363 Un_GL000220v1:113186-113208 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203478184 Un_GL000220v1:157158-157180 CCGCGCCGCCCCGCCGGAGCGGG - Intergenic
1203539346 Un_KI270743v1:72933-72955 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1203646107 Un_KI270751v1:68979-69001 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1185624004 X:1469815-1469837 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1185755783 X:2652014-2652036 CACCTCCGCCTCCCGGGTTCAGG + Intergenic
1185887627 X:3796789-3796811 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1186436381 X:9546430-9546452 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1186452408 X:9684471-9684493 CACCTCAGCCTCCCGAGAGCTGG - Intronic
1186843405 X:13507521-13507543 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1187079140 X:15967604-15967626 CACCTCCGCCTCCCGGGTTCAGG - Intergenic
1187731098 X:22255832-22255854 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1187915768 X:24150560-24150582 CACCGCCGCCGCCCGGACGCCGG + Intronic
1188391966 X:29631711-29631733 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1189377034 X:40474395-40474417 CACAGCCGCCTGCCGGGAGCTGG + Intergenic
1190067317 X:47250354-47250376 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1190118121 X:47638958-47638980 CAGCGCCCCCCTCGGGGAGCAGG - Exonic
1190232874 X:48595799-48595821 TACCTCAGCCTCCCGGGAGCTGG - Intronic
1190575438 X:51832111-51832133 CAGCTCCGCCTTCCGGGCTCAGG + Intronic
1190736270 X:53257362-53257384 CAGCGCTGCAGCCCGGGACCGGG - Intronic
1190954283 X:55176793-55176815 AAGCTCCGCCTCCCGGGTTCAGG + Intronic
1192078466 X:68024052-68024074 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1193092894 X:77513233-77513255 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1194002914 X:88454113-88454135 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1194088022 X:89552676-89552698 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic
1195888967 X:109671390-109671412 CAGCCGCCCCGCCCGGGAGCTGG + Intronic
1196802526 X:119556499-119556521 AAGCTCCGCCTCCCGGGTTCAGG - Intronic
1196973673 X:121136334-121136356 CAGCTCCGCCTCCTGGGTTCAGG - Intergenic
1197224778 X:123945976-123945998 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1198328792 X:135602093-135602115 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1200079709 X:153570164-153570186 CAGGGCCGCCTTCCCGGGGCTGG + Intronic
1200440596 Y:3208112-3208134 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1202267052 Y:23030795-23030817 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1202420044 Y:24664539-24664561 AAGCTCCGCCTCCCGGGTTCAGG + Intergenic
1202450742 Y:25005544-25005566 AAGCTCCGCCTCCCGGGTTCAGG - Intergenic