ID: 1182279767

View in Genome Browser
Species Human (GRCh38)
Location 22:29211171-29211193
Sequence AGACCAAAGCAGGCCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182279767_1182279774 30 Left 1182279767 22:29211171-29211193 CCCCTCTGGGCCTGCTTTGGTCT 0: 1
1: 0
2: 2
3: 32
4: 335
Right 1182279774 22:29211224-29211246 GTGTGTATGTGAATGTGTGAGGG No data
1182279767_1182279773 29 Left 1182279767 22:29211171-29211193 CCCCTCTGGGCCTGCTTTGGTCT 0: 1
1: 0
2: 2
3: 32
4: 335
Right 1182279773 22:29211223-29211245 TGTGTGTATGTGAATGTGTGAGG 0: 3
1: 40
2: 406
3: 5449
4: 9353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182279767 Original CRISPR AGACCAAAGCAGGCCCAGAG GGG (reversed) Intronic
900033591 1:388919-388941 GGACCAAAGCAGGAGGAGAGGGG - Intergenic
900054426 1:618809-618831 GGACCAAAGCAGGAGGAGAGGGG - Intergenic
900265685 1:1755950-1755972 AGCTCAAGGGAGGCCCAGAGGGG + Intronic
900548505 1:3241876-3241898 AGGCCACAGCAGGCCCAGGGTGG + Intronic
900778560 1:4602172-4602194 AGGACAAAGCAGCCCCAGATGGG - Intergenic
900913481 1:5618511-5618533 AGCCCACACCAGGCCCCGAGAGG - Intergenic
901026001 1:6279075-6279097 AGACCAGAGCGGGCCCAGGTGGG + Intronic
902337126 1:15759931-15759953 AGAACAAAGCTGGCCGGGAGCGG + Intronic
903293662 1:22330246-22330268 AGACCAAGAGAGGGCCAGAGGGG - Intergenic
904246942 1:29194532-29194554 AGGCCAGAGGAGGCCCAGAGAGG + Intronic
904292519 1:29497224-29497246 ACACCAAAGTAGGCCTGGAGAGG - Intergenic
904699326 1:32349027-32349049 AAACTCAAGCAGGCCCAGGGAGG - Intergenic
905551910 1:38848692-38848714 ATGCCAAGGCAGGCCAAGAGTGG + Intronic
905647065 1:39632455-39632477 GGAGCAAATCAGGCTCAGAGAGG + Intronic
905884662 1:41485179-41485201 AGAGGGAGGCAGGCCCAGAGAGG - Intergenic
906073616 1:43035880-43035902 AGAACCAGGCAGGCCCAGAGGGG - Intergenic
906912774 1:49972967-49972989 GGAGGAAATCAGGCCCAGAGAGG + Intronic
907307590 1:53521920-53521942 AGGACAAAACAGACCCAGAGAGG + Intronic
908115288 1:60934493-60934515 AGAGCTAAGCATGTCCAGAGTGG + Intronic
908666174 1:66493671-66493693 AGTCTTAAGCAGACCCAGAGAGG + Intergenic
909300882 1:74011603-74011625 AGAGGAAAGCAGTCCCAGTGGGG + Intergenic
910507751 1:87969337-87969359 ATAACAAAACAGGCACAGAGAGG - Intergenic
912233443 1:107822170-107822192 AAACCAAAGCATGCCCACTGTGG - Intronic
912395994 1:109344408-109344430 AGTCCAAAGTGGGGCCAGAGGGG - Intronic
912431600 1:109630971-109630993 ATACCAAGGAAGGCCCTGAGGGG + Exonic
912839726 1:113028380-113028402 AGAGAAACTCAGGCCCAGAGAGG - Intergenic
913107581 1:115628884-115628906 AGACCATAGGAAGCCCAGAGAGG - Intergenic
913225975 1:116698570-116698592 AGACCAAAGGAGGCAAAGAAAGG + Intronic
913557472 1:119982382-119982404 AGTCAAAAGCAGCCACAGAGAGG + Intronic
913579315 1:120210372-120210394 AGACCTTAGGAGGCCAAGAGTGG + Intergenic
913628857 1:120688016-120688038 AGACCTTAGGAGGCCAAGAGTGG - Intergenic
914446888 1:147758108-147758130 GGAACAAAGGAGGCTCAGAGAGG - Exonic
914561250 1:148821799-148821821 AGACCTTAGGAGGCCAAGAGTGG + Intronic
914611584 1:149308409-149308431 AGACCTTAGGAGGCCAAGAGTGG - Intergenic
915187816 1:154122364-154122386 AAAACAAAACAGGCCCAGCGCGG + Intronic
915607210 1:156960102-156960124 AAGCCAACGGAGGCCCAGAGAGG + Intronic
915734723 1:158077539-158077561 AGCCCAAGGCAGGCCCAGGGAGG - Intronic
915932466 1:160068948-160068970 AGCCTAAAGCAGTCCCAGTGGGG + Intronic
916419568 1:164623625-164623647 AGACAAAGGCAAGCACAGAGAGG - Intronic
916604850 1:166330964-166330986 ATCCCAAAGCAGGTCCAGAAAGG + Intergenic
917400429 1:174642938-174642960 AGACCAAAATTAGCCCAGAGTGG - Intronic
918001822 1:180504079-180504101 AAACCAAACCAGGACCAGAATGG - Intergenic
918446995 1:184626396-184626418 AGCCCAAAGGAGGGCCAGTGTGG + Exonic
919741536 1:200984056-200984078 AGAGCAAAACAGGACCAGGGTGG + Intronic
920123105 1:203673431-203673453 AGAATAAAACAGGCGCAGAGGGG + Intronic
920916256 1:210260352-210260374 AGATCACAGCAGGCACAGAATGG - Intergenic
920938266 1:210456317-210456339 AGACCAAACCAGGGAGAGAGGGG - Intronic
922768346 1:228167651-228167673 AGACAAAAGCAGCCCCAGGCCGG - Intronic
923017741 1:230140010-230140032 CGACCACCCCAGGCCCAGAGAGG + Intronic
923472231 1:234302204-234302226 ATACCAAAGAAGGCCTACAGAGG + Intronic
923680292 1:236113325-236113347 TTACCAAAGCAGTCCCACAGTGG + Intergenic
1063615145 10:7594116-7594138 AGATCAGAGGATGCCCAGAGAGG + Intronic
1065105659 10:22381263-22381285 AGGCCGTAGCAGGCCCACAGAGG + Intronic
1066192095 10:33065466-33065488 AAACCAGAGTAGGCTCAGAGAGG - Intergenic
1067284002 10:44894438-44894460 AGACTAAAAGAGGCCCTGAGAGG + Intergenic
1067357732 10:45546489-45546511 AGAATAAAGCAGGCCAGGAGTGG + Intronic
1069637035 10:69931196-69931218 TGGCCAGAGCAGACCCAGAGTGG + Intronic
1069661796 10:70127812-70127834 AGACCAGAGCAGGGCCAGGGAGG + Intronic
1069825393 10:71252209-71252231 ATGGCAAAACAGGCCCAGAGAGG - Intronic
1069844254 10:71359713-71359735 AGGAGGAAGCAGGCCCAGAGAGG + Intronic
1069914976 10:71781842-71781864 TGATCAATGAAGGCCCAGAGAGG + Intronic
1070313979 10:75294063-75294085 AGCCCAAACCAAGTCCAGAGAGG + Intergenic
1070760917 10:79023932-79023954 AGAGGAAACAAGGCCCAGAGAGG + Intergenic
1071508596 10:86247528-86247550 AGACCAAACCAGCCCCATAACGG + Intronic
1072460732 10:95616438-95616460 GCACCAAGTCAGGCCCAGAGGGG - Intronic
1072644775 10:97244970-97244992 AGACCCAAGCAGGCACATAAAGG + Intronic
1074102302 10:110363395-110363417 ATAAGTAAGCAGGCCCAGAGTGG - Intergenic
1074544731 10:114393791-114393813 ACACCAAAGCAGCCTCAGAAGGG + Intronic
1074828410 10:117231248-117231270 ACAGGAAAGCAGACCCAGAGAGG - Intergenic
1079183991 11:18220433-18220455 AGGGCAAACCAGGCACAGAGTGG + Intronic
1079540386 11:21565761-21565783 AGAGGAAACCAAGCCCAGAGAGG - Intronic
1080245193 11:30172195-30172217 AGAAAAAAGCAGGTTCAGAGGGG + Intergenic
1080260691 11:30346765-30346787 AGCCCAATGCAGGCCAGGAGTGG + Intergenic
1080404350 11:31965688-31965710 AGGTCAAAGCAGGTCCAGAAAGG + Intronic
1081989652 11:47330970-47330992 TGATTAAACCAGGCCCAGAGTGG - Intergenic
1083260657 11:61521085-61521107 AGAGCAGGGCAGGCCCACAGTGG - Intronic
1083329213 11:61889703-61889725 AGACTAGAGCAGGCCGGGAGTGG + Intronic
1083656165 11:64230714-64230736 AGACTGAAGCAGGCCCGGAGAGG - Exonic
1084005127 11:66318405-66318427 AGAAAAAAGGAGACCCAGAGAGG - Intergenic
1084381082 11:68813238-68813260 TGACCAAAGCAGGCCAGGTGCGG + Intronic
1085422276 11:76373003-76373025 TGACCAAAGTAGGTACAGAGAGG - Intronic
1088062025 11:105665494-105665516 AGAGCAGTGCAGGACCAGAGAGG + Intronic
1088283875 11:108165733-108165755 AGACTAAAGCAGGAGGAGAGTGG - Intronic
1089195838 11:116693569-116693591 GGGCCAAAGCAGGGCCAGGGTGG + Intergenic
1089514810 11:119025778-119025800 AAAGAAAACCAGGCCCAGAGTGG + Intronic
1090036580 11:123254621-123254643 AGACCAAAGCCAGCCCAGCATGG - Intergenic
1090501710 11:127267300-127267322 AGACCATTGCCAGCCCAGAGGGG - Intergenic
1091974925 12:4816861-4816883 AAGGCAAAGCAGGCCAAGAGGGG - Intronic
1092141419 12:6186277-6186299 AAACCAAAGCGTGCCCAGATTGG + Intergenic
1093897180 12:24587458-24587480 AAACCAAAGCAAGCCCAAAGTGG - Intergenic
1094066635 12:26368507-26368529 AGACAAAATAAGGCTCAGAGAGG + Intronic
1094834222 12:34314707-34314729 AGAGGCAAGAAGGCCCAGAGAGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096434063 12:51573302-51573324 AGACCAAAGAGGGGCCAGGGTGG + Intergenic
1096791654 12:54048656-54048678 AGACCAAAGAAGGCAGAGACTGG - Intronic
1099240683 12:80135146-80135168 AGATGAAAGCAGGGACAGAGGGG - Intergenic
1100649506 12:96569523-96569545 GGACAAAAGTAGCCCCAGAGAGG - Intronic
1100868088 12:98879055-98879077 AGCCTGAAGCAAGCCCAGAGTGG - Intronic
1100891356 12:99129516-99129538 AGACCAAATCAGACCCAAAGTGG - Intronic
1102187995 12:110964847-110964869 AGCCCAAAGCGGACCCCGAGTGG + Intergenic
1102458188 12:113084053-113084075 ACAGCGAAGGAGGCCCAGAGAGG + Intronic
1102534010 12:113567633-113567655 GGACAAACGCAGGCTCAGAGAGG + Intergenic
1102603658 12:114052490-114052512 AGACCACAGCAGTCCCCGATGGG + Intergenic
1103975083 12:124697172-124697194 AGCCCAAAGCAGACCAAAAGAGG + Intergenic
1104860841 12:131922595-131922617 AGACCAAGGGAGGCCCAGGCGGG - Exonic
1104874751 12:132026224-132026246 GGGCCAAGGCAGGCACAGAGCGG - Intronic
1104979723 12:132568409-132568431 ACAGCAAAGCAGGCGCAGATGGG + Intronic
1106014410 13:25854667-25854689 TGAACAATGCAGGCCCAGAGTGG - Intronic
1106032614 13:26016663-26016685 AGAAAAAAGCAGGCCAAAAGAGG + Intronic
1106575553 13:30971043-30971065 AGCCCAAGGCAGCCCCAAAGAGG - Intronic
1107684815 13:42886216-42886238 AGACAGGAGCAGGCCAAGAGAGG - Intergenic
1108582513 13:51839177-51839199 AGACCACAGCAGGTCCACAGGGG - Intergenic
1109661144 13:65462214-65462236 AGACATAAGCAGGACAAGAGAGG - Intergenic
1113037736 13:106069900-106069922 AGAGCAAAGGAGGTCCAAAGTGG - Intergenic
1113847037 13:113398151-113398173 AGAACAAAGGAGGCCAAGCGGGG - Intergenic
1116529099 14:45945570-45945592 AGAAGAAAACAGGCACAGAGAGG - Intergenic
1117450111 14:55841765-55841787 AGGCAAGAGCAGGCCCAGGGGGG - Intergenic
1118167914 14:63356339-63356361 AAACCAAAGGAGGCCAAGACGGG - Intergenic
1118625739 14:67657356-67657378 AGACCAAATCACCCCCAGTGTGG - Intronic
1119670501 14:76514631-76514653 AGACCACTGTTGGCCCAGAGAGG - Intergenic
1119678565 14:76574764-76574786 AGACAAAACCAGGCTCAGCGAGG + Intergenic
1120270286 14:82304195-82304217 AGACAGCAGCAGGCCCAGATAGG - Intergenic
1121084847 14:91138069-91138091 AGACAAAGGCAGGACCAAAGAGG - Intronic
1121541211 14:94728126-94728148 AGCCCAAAGGAGATCCAGAGAGG - Intergenic
1121798571 14:96755152-96755174 AGATCAAAGCAGGCGCAGGCTGG + Intergenic
1122398281 14:101450726-101450748 ACACCAGGCCAGGCCCAGAGGGG - Intergenic
1124119295 15:26875397-26875419 AGAGCAGAGCAGGGGCAGAGTGG + Intronic
1126695413 15:51321507-51321529 AGACGAAATTAGGGCCAGAGGGG - Intronic
1127382890 15:58444993-58445015 AGTCCACACCAGGCCCAGACAGG + Intronic
1129884884 15:79031042-79031064 TGGCCATAGGAGGCCCAGAGGGG - Intronic
1131092141 15:89631309-89631331 AGGCCAAAGCAGGGGCAGAAGGG + Intronic
1132414700 15:101612031-101612053 AGAAGAGAGCAGGCCCACAGTGG - Intergenic
1132925118 16:2425274-2425296 AGAGGAGAGCAGGCCCAGAGAGG + Intergenic
1133088847 16:3387695-3387717 AGACCGTAGAAGGTCCAGAGTGG - Intronic
1135328387 16:21542389-21542411 AGACAAAACCAGGAACAGAGCGG - Intergenic
1136338734 16:29628362-29628384 AGACAAAACCAGGAACAGAGCGG - Intergenic
1136995377 16:35185417-35185439 AGACCACAGCAGGCCCTGAGTGG - Intergenic
1137279764 16:46965931-46965953 AAATAAAAGCAGGCCAAGAGTGG + Intronic
1137438609 16:48479277-48479299 AAACCAAATCAGGCTCAGACTGG - Intergenic
1137816420 16:51402021-51402043 AGACCAAAGCAGGCGGAGAAAGG - Intergenic
1138675164 16:58646069-58646091 GGACCACAGCAGGCCCTGACTGG + Intergenic
1139514846 16:67446896-67446918 AGAGCAGATAAGGCCCAGAGAGG + Intronic
1139922875 16:70470818-70470840 GGGCCAAGGCAGGTCCAGAGAGG + Intronic
1140105015 16:71951987-71952009 AGACTAAAGCAAGGCCAGAGTGG + Intronic
1140700703 16:77579096-77579118 ATACTAAAGGAGGCTCAGAGAGG + Intergenic
1142168562 16:88607183-88607205 AGACCCAGGCACGCCCAGAGAGG - Intronic
1142232861 16:88907864-88907886 AGACTCAGGCATGCCCAGAGAGG - Intronic
1142409942 16:89910886-89910908 AGACCAAGCCAGGCACAGAGTGG - Intronic
1142821821 17:2475026-2475048 AGATGAGAGCAGGCCTAGAGTGG - Intronic
1143181961 17:4988924-4988946 AGACTGAAGAAGGCCCAGTGGGG - Exonic
1143949966 17:10624613-10624635 AAACCAAACCAAGCCCATAGGGG - Intergenic
1145257876 17:21337504-21337526 AGACAAAATCAGAGCCAGAGGGG - Intergenic
1145318757 17:21750502-21750524 AGACAAAATCAGAGCCAGAGGGG + Intergenic
1146657013 17:34640491-34640513 AGCCCAAAGCAGAACCACAGGGG + Intergenic
1146833963 17:36094925-36094947 AGGCCAAAGCTGGGCCAAAGAGG - Intergenic
1146910476 17:36645457-36645479 AGCCCAAAGCAGACACAGAAAGG - Intergenic
1146918886 17:36696612-36696634 AGACCAGAGCAGGGACAGAGGGG - Intergenic
1147215012 17:38893922-38893944 AGGGCAAGGCAGGCCCAGAAGGG - Intronic
1149995982 17:61406087-61406109 GGAAGGAAGCAGGCCCAGAGAGG - Intronic
1150612922 17:66748454-66748476 AGACCAAAGGATGTCCATAGAGG + Intronic
1152650055 17:81488507-81488529 AGACCAAGGCAGGGCCAGAGGGG - Intergenic
1153055277 18:939688-939710 AGAGAAAAGCAGGCCCAGGAAGG + Intergenic
1153444070 18:5152780-5152802 TAACAAAAGCAGGGCCAGAGAGG + Intronic
1155268684 18:24118468-24118490 GGACCAAGCCAGGCCCAGAGGGG - Intronic
1155867231 18:30981055-30981077 AGACCATCTAAGGCCCAGAGAGG + Intergenic
1156303101 18:35852743-35852765 ACACCAAAGCAGTCACAGTGTGG - Intergenic
1157365882 18:47064009-47064031 AAACCTAGGCAGGCTCAGAGGGG + Intronic
1157495157 18:48151845-48151867 TGATCAGAGCAGGCCCAGGGAGG - Intronic
1157682093 18:49615239-49615261 AGACCAAGGCAGGGACAGTGGGG + Intergenic
1161599651 19:5173802-5173824 AGACAAAAACAGGCCAGGAGCGG + Intronic
1161866578 19:6836949-6836971 AGACAAAAACAGGAACAGAGAGG - Intronic
1162567109 19:11450692-11450714 AGCCACAGGCAGGCCCAGAGGGG - Exonic
1163621463 19:18363338-18363360 AGACCAAAACGGGGTCAGAGGGG - Intronic
1164857215 19:31534418-31534440 AGAGCAAAGCAGGCCAGGTGAGG - Intergenic
1165328968 19:35130886-35130908 AGAGGAATGCAGGCCCAGACAGG - Intronic
1165732085 19:38152448-38152470 AGAGCAAGGCAGCCCGAGAGAGG + Intronic
924997657 2:377867-377889 AGCCCAAAGAAGCCCCAAAGAGG + Intergenic
925349097 2:3188716-3188738 AGACCAGGGGAGGCCCAGGGCGG + Intergenic
925740704 2:7003791-7003813 AACCCAAGGAAGGCCCAGAGTGG - Intronic
928244983 2:29619306-29619328 ATACCCAAGGAGGCCTAGAGAGG - Intronic
929310514 2:40418991-40419013 AGGCCAAAGAAGGCACAGAGAGG + Intronic
929570848 2:43022049-43022071 TGGCCAAGGGAGGCCCAGAGGGG - Intergenic
929748580 2:44685604-44685626 GGAAGAAAGCAGGCACAGAGAGG + Intronic
930946597 2:57083977-57083999 AGAACAGAGAAGACCCAGAGAGG + Intergenic
932495096 2:72142229-72142251 AGGCCAAGTCAGGCCCAGGGTGG + Intronic
934027196 2:88010832-88010854 AGACCAAGGCAGGATTAGAGGGG - Intergenic
935082799 2:99814767-99814789 AGCCCAAAGAAGGCCCAAGGTGG + Intronic
935919979 2:108002225-108002247 AGAACAAATGAGGCCCTGAGGGG + Intronic
936837717 2:116727964-116727986 AGACATGAGCAGGGCCAGAGAGG + Intergenic
942208890 2:173650850-173650872 ATAGGAAAACAGGCCCAGAGAGG + Intergenic
942431670 2:175918154-175918176 AGGCCAAGTCTGGCCCAGAGTGG - Intergenic
943254932 2:185583101-185583123 AGACCAGCCCAGGGCCAGAGAGG + Intergenic
946095988 2:217274518-217274540 TGACCAGAGGAGGGCCAGAGTGG - Intergenic
948402645 2:237694705-237694727 AGACAAAAGCAGGATCTGAGTGG + Intronic
948648521 2:239424473-239424495 GGACCCAAGCAGGCCAAGACTGG - Intergenic
948685742 2:239668570-239668592 AGAGAAAAGCTGGTCCAGAGGGG + Intergenic
948764573 2:240212832-240212854 AGAACAAAGCAAGCCCTCAGTGG + Intergenic
1168851887 20:982704-982726 CAACCAAAGTAGGCTCAGAGAGG - Intronic
1169027889 20:2385497-2385519 AGAAGAAAACAGACCCAGAGAGG + Intronic
1169110869 20:3032835-3032857 TGACTAAAGCAGTCCCAGTGGGG - Intronic
1170320757 20:15095363-15095385 AGACCACAGCAGGCCGGGCGTGG - Intronic
1170779473 20:19411261-19411283 AGACCAATTCAGGCCCAAGGTGG - Intronic
1172221118 20:33275895-33275917 AGCCCAGGGCAGGGCCAGAGAGG - Intronic
1172486825 20:35303562-35303584 AGGCCACAGCAGGCCCTGGGGGG + Exonic
1172807648 20:37624136-37624158 AGAACAACCGAGGCCCAGAGAGG + Intergenic
1172848261 20:37943267-37943289 AAACCAAACCAGGCCAAGTGCGG - Intronic
1173564058 20:44026809-44026831 AGAAGGAAGGAGGCCCAGAGAGG - Intronic
1173644482 20:44625208-44625230 AGACCTATTCAGGCCCAGACAGG + Intronic
1175380817 20:58562428-58562450 AATCAAAAGTAGGCCCAGAGTGG + Intergenic
1175975124 20:62707260-62707282 AGTCCAAAGCAGGGCGAGAACGG + Intergenic
1176085330 20:63293205-63293227 TGGCCACAGCAGGACCAGAGTGG + Exonic
1176108368 20:63399952-63399974 GGACCACAGCAGCCCCACAGCGG + Intergenic
1176726630 21:10440897-10440919 ATACCACAGCAGGCCAAGTGGGG - Intergenic
1178375898 21:32067342-32067364 AGACCAAGACAGGCCCCGACTGG - Intergenic
1179816823 21:43911655-43911677 AGAGCACAGCAGCTCCAGAGTGG - Intronic
1179840949 21:44072928-44072950 AAACCACAGCAGGCCTGGAGCGG - Intronic
1180032768 21:45223690-45223712 AAACCAGAGCAGGGGCAGAGGGG + Exonic
1180064849 21:45407040-45407062 AAGCGGAAGCAGGCCCAGAGAGG + Intronic
1180287757 22:10766188-10766210 ATACCACAGCAGGCCAAGTGGGG + Intergenic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1180830919 22:18905772-18905794 CGACCACGGCAGGCCCAGATGGG + Intergenic
1181670968 22:24425265-24425287 CGGCCAAAGCAGGGCCAGTGAGG - Intronic
1181894438 22:26094455-26094477 AGAACAAAGCTTCCCCAGAGTGG + Intergenic
1182167474 22:28190860-28190882 AGAGAAAAAGAGGCCCAGAGTGG - Intronic
1182279767 22:29211171-29211193 AGACCAAAGCAGGCCCAGAGGGG - Intronic
1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG + Intergenic
1182912412 22:33996132-33996154 AGGGCAAAAAAGGCCCAGAGTGG + Intergenic
1183947913 22:41337436-41337458 TGAGTGAAGCAGGCCCAGAGTGG + Intronic
1184531904 22:45061594-45061616 AGCCAGAAGCAGGACCAGAGAGG + Intergenic
1203281006 22_KI270734v1_random:131043-131065 CGACCACGGCAGGCCCAGATGGG + Intergenic
949231534 3:1756527-1756549 AGAACATACCAGACCCAGAGGGG + Intergenic
949534817 3:4987389-4987411 AAATAAAAGCAGGCTCAGAGAGG + Intergenic
949968289 3:9378650-9378672 AGTCCAAAGCAAGCCCACAAGGG + Intronic
950086508 3:10262185-10262207 AGACCAGAGCAGGACAACAGAGG - Intronic
950091322 3:10297139-10297161 AGACCAAGGCAGGCCGGGCGCGG - Intronic
950905896 3:16537475-16537497 AGCTCAAAGCAGACCCACAGAGG - Intergenic
951106999 3:18756290-18756312 GGACTAAAGCAAGTCCAGAGTGG - Intergenic
952558184 3:34557875-34557897 AGACAAATGCAGGCACAAAGGGG - Intergenic
954362286 3:50128439-50128461 AGCCTAAAGGAGGCCCAGGGAGG + Intergenic
954434054 3:50486600-50486622 AGAACAAAGCTGGCCCTGATGGG - Intronic
954684395 3:52362500-52362522 AGGCAAGTGCAGGCCCAGAGTGG + Exonic
954811343 3:53250235-53250257 AAACAGAAACAGGCCCAGAGAGG + Intronic
955101442 3:55853982-55854004 AGCACGAAGCAGGCCCAGCGCGG + Intronic
955779020 3:62463688-62463710 AAAGCAATGAAGGCCCAGAGAGG - Intronic
955865351 3:63376502-63376524 AGACAAAAAGAAGCCCAGAGTGG - Intronic
957900307 3:86481022-86481044 AAACCTAATCAGGCCCAGAGGGG - Intergenic
959306414 3:104671887-104671909 ACACCAAAGAAGGCTTAGAGTGG + Intergenic
960268178 3:115645427-115645449 AGACCAAAGAAGGATCAGAGTGG + Intronic
960687095 3:120306057-120306079 AGCCCAAAGCAGGCCAGGCGCGG + Intergenic
961660897 3:128468321-128468343 CGACCAAGCGAGGCCCAGAGAGG + Intergenic
962278200 3:134031044-134031066 AGGCCAGACCAGGCCCAGAAAGG - Intronic
962937167 3:140091673-140091695 GAACCACAGAAGGCCCAGAGTGG - Intronic
965390198 3:168095407-168095429 ACACAAAAGCCGGCCCGGAGGGG + Exonic
967826517 3:193881796-193881818 AGACCAAAGCAGGGTCCGAAGGG - Intergenic
967847786 3:194057793-194057815 GCACCAAAGAAGGCCCAGAGAGG - Intergenic
967985753 3:195094406-195094428 ACACGCATGCAGGCCCAGAGTGG + Intronic
968426211 4:525093-525115 AGGGCAAAGCTGGCCCACAGAGG - Intronic
968954267 4:3710298-3710320 GCACCAAAGCAGGCTCAGAGAGG - Intergenic
969229567 4:5820579-5820601 AGACCCAAGGAGGCGAAGAGAGG - Intronic
969580758 4:8063510-8063532 TGACCATAACAGGCACAGAGAGG + Intronic
969609529 4:8219279-8219301 AGACCAAATGGGGGCCAGAGCGG - Intronic
969685860 4:8673734-8673756 GGGCCAACGGAGGCCCAGAGGGG - Intergenic
969943446 4:10758585-10758607 AGATGAAATCAGGCTCAGAGAGG + Intergenic
973047769 4:45555892-45555914 GGACAAAAGCAGGCCAAGTGTGG - Intergenic
974521489 4:62986909-62986931 AGGGCAAACCAGGCACAGAGTGG + Intergenic
974929011 4:68339357-68339379 ATATCAAAGCAGACCTAGAGAGG + Intronic
975760300 4:77613511-77613533 AAACAAAAGCAGGGCCAGTGAGG + Intergenic
979864011 4:125730305-125730327 AGACTAAAGTAGTCTCAGAGTGG + Intergenic
980538297 4:134159583-134159605 AGACCAACACTGGGCCAGAGAGG + Intergenic
980750124 4:137077194-137077216 AGATCAGAGCAGGCCCTGGGAGG + Intergenic
982663531 4:158233355-158233377 AGACCATAGGAGGCCAAGAAAGG + Intronic
983830560 4:172321760-172321782 AGACAAAAGCAGGGCAGGAGAGG + Intronic
985085868 4:186311850-186311872 ACACAAAGGCAGGCCAAGAGAGG - Intergenic
987943491 5:24573409-24573431 AGACAAAAGCAGGCCGGGCGCGG + Intronic
989205696 5:38807104-38807126 AGACCAAATCAGTAGCAGAGGGG + Intergenic
989732602 5:44665500-44665522 AGGGCAAGCCAGGCCCAGAGCGG - Intergenic
990331736 5:54733981-54734003 AGACCATAGCAGGCACGAAGGGG - Intergenic
990404934 5:55479585-55479607 AGAACAAAGCAGGTCTACAGAGG + Intronic
994158894 5:96533358-96533380 AGAAAAAAGAAGGCCCACAGAGG + Intronic
994368975 5:98947673-98947695 GGAGGAAAGCAGGCACAGAGCGG - Intergenic
996805279 5:127447465-127447487 ATAACAAAACAGGCCCAGCGAGG - Intronic
996951340 5:129129521-129129543 TTACCATGGCAGGCCCAGAGGGG - Intergenic
998501460 5:142636526-142636548 ATAACAAGGCAGGCACAGAGAGG + Intronic
999873117 5:155772927-155772949 AAACCAAAGCATGCCCACTGTGG + Intergenic
1002740229 5:181429949-181429971 GGACCAAAGCAGGAGGAGAGGGG + Intergenic
1003476986 6:6492427-6492449 AGACCTAAGCAAGCTCAGTGGGG - Intergenic
1006023436 6:31131732-31131754 AGACAGAAACAGGCCTAGAGAGG - Intronic
1006788686 6:36684648-36684670 AGAAGGAAACAGGCCCAGAGAGG + Intronic
1006984575 6:38168229-38168251 GGAGCAAAGCAGGCACAGAGAGG - Intergenic
1007119601 6:39369009-39369031 AGCCCCAAGGAGGCCCAGAGTGG - Intronic
1007607138 6:43125266-43125288 ACATCAAAGCTGGCCCCGAGGGG - Intronic
1007757487 6:44109653-44109675 TGACCAAAGCATGTGCAGAGAGG - Intergenic
1011668944 6:89663642-89663664 TGAAAAAAGCAGGCCCAGTGCGG + Intronic
1012381630 6:98626535-98626557 AGACCAAGGCTGGCCTAGAAGGG + Intergenic
1015185090 6:130406857-130406879 AGATCAAACAAGGCCCAGATGGG - Intronic
1016478965 6:144460787-144460809 AGACAAACCCAGGTCCAGAGTGG - Intronic
1016824184 6:148373322-148373344 AGAGCTGAGCAGGCCGAGAGAGG + Intronic
1018831949 6:167450021-167450043 AGAGCCATGTAGGCCCAGAGTGG - Intergenic
1019245342 6:170705549-170705571 GGACCAAAGCAGGAGGAGAGGGG + Intergenic
1019603534 7:1897322-1897344 AGACCACAGCAGTCCCAGGTGGG + Intronic
1019876144 7:3812682-3812704 AGACCAAAAGATGACCAGAGAGG - Intronic
1019910819 7:4099727-4099749 AGGGCCAAGCAGGCACAGAGTGG + Intronic
1020358827 7:7305320-7305342 AGACCAACGCAGTGACAGAGAGG - Intergenic
1021682747 7:23151139-23151161 AAAACAAAACAGGCCCAGAATGG - Intronic
1023291992 7:38678463-38678485 AGGCCAGAGCTGGCCCACAGTGG + Intergenic
1023747280 7:43333021-43333043 AGACCAAAGTAGGCCAGTAGGGG + Intronic
1024222688 7:47300789-47300811 AGACACAAGCAGGGCCAGGGTGG + Intronic
1025079381 7:55968629-55968651 AGACCAAAGCAGGCCAAGGCGGG - Intronic
1026076836 7:67179361-67179383 TGACCAAAACAGGTCCAGACAGG - Intronic
1026700026 7:72632978-72633000 TGACCAAAACAGGTCCAGACAGG + Intronic
1029438510 7:100575183-100575205 AGACCAGAGGGGGGCCAGAGGGG + Exonic
1029581958 7:101442251-101442273 AGCCGAAAGCAGGCCCAGCTTGG - Intronic
1029803866 7:102976516-102976538 AGAAGAAAGAAGCCCCAGAGGGG - Intronic
1030066973 7:105667214-105667236 TGGCCAAAGGAGACCCAGAGAGG + Intronic
1030172124 7:106613486-106613508 AGATCAAAGCAGGCCGGGCGCGG - Intergenic
1031478689 7:122252447-122252469 ATGCCAAAGTAGGCACAGAGAGG - Intergenic
1032454646 7:132064115-132064137 AAACCAATGCATGCCCACAGAGG + Intergenic
1032951753 7:136922359-136922381 AGAGAAGAGCAGGGCCAGAGAGG - Intronic
1034461316 7:151199517-151199539 AGACGAGAGCAGGCCGAAAGAGG - Intronic
1034553492 7:151835737-151835759 AGACCAATGGAAGCCCAGGGTGG - Intronic
1034929332 7:155149085-155149107 ATATCACAGCAGGTCCAGAGAGG + Intergenic
1034960083 7:155359518-155359540 ACACCAAGGCAGGCCCGGGGAGG + Intronic
1034983820 7:155495577-155495599 AGACCAGAGCAGGCCCAGCCTGG - Intronic
1035184670 7:157116994-157117016 AAACCAAAGCCAGCCCAGAAGGG - Intergenic
1035502785 8:102653-102675 GGACCAAAGCAGGAGGAGAGGGG - Intergenic
1037166265 8:15832668-15832690 AGACCAAAGAAGGCAAAGAAGGG + Intergenic
1037508896 8:19561877-19561899 AGCCCAAGCCAGGCCCAGATGGG + Intronic
1038054877 8:23848907-23848929 AGACCAACCCAGATCCAGAGTGG - Intronic
1040106070 8:43542745-43542767 AGACCAAAGAAGGCTCTGAAAGG - Intergenic
1041135245 8:54750978-54751000 AGAACAAAGCACCCACAGAGTGG - Intergenic
1043019584 8:74984311-74984333 AGCCCAAAGCACGCCCACAAAGG + Intergenic
1043978492 8:86610139-86610161 AGACCAAATCAGTCACTGAGGGG + Intronic
1049215309 8:141405154-141405176 AGCCCTAAACAGTCCCAGAGAGG - Intronic
1049312756 8:141942175-141942197 AGACCAAAGCTGGGCCAGGTTGG + Intergenic
1049407961 8:142460138-142460160 ACACCAAGGCAGGCCCAGGCGGG - Intronic
1049476523 8:142799540-142799562 AGACAGAAGCAGGCACAGTGAGG + Intergenic
1049717614 8:144100377-144100399 GAACCAAAGCAGGCCCTCAGTGG + Intronic
1049905585 9:214014-214036 ATACCAAAGCAGGCCGGGCGCGG - Exonic
1050264325 9:3874141-3874163 AGACCAAGGCAGGATTAGAGGGG + Intronic
1050418586 9:5439109-5439131 AGCCCAAAGCAGGGACAGAGTGG + Intergenic
1051426001 9:16931999-16932021 AGAATAAAGCAAGCACAGAGGGG + Intergenic
1051804752 9:20979627-20979649 AAACAAAAACAGGCCCAGCGTGG - Intronic
1051924859 9:22311621-22311643 AGTCCAAACCAGGTCCAGATAGG + Intergenic
1052339785 9:27353751-27353773 AAACAAAAGCAGACTCAGAGAGG - Intronic
1053446435 9:38156702-38156724 AGACAAACTGAGGCCCAGAGAGG + Intergenic
1054949119 9:70830079-70830101 AGACCAAAGCAGTCTGTGAGAGG + Intronic
1057585722 9:96327076-96327098 AGCCCAACGCAGGGGCAGAGAGG + Intronic
1057867394 9:98692378-98692400 AGACTAAAGGTGGCCCAGGGAGG - Intronic
1059094627 9:111399537-111399559 AGACCAAATCTGGGCCAGAGGGG + Intronic
1059355441 9:113696030-113696052 ATACCAAAGCAGGGACAGATGGG - Intergenic
1059453148 9:114383385-114383407 AGTGCAAAGCTGACCCAGAGTGG + Intronic
1059505270 9:114792979-114793001 AGACAAACAGAGGCCCAGAGAGG - Intronic
1060556534 9:124510814-124510836 AGAAGAGAGAAGGCCCAGAGAGG - Intergenic
1060831356 9:126719734-126719756 AGACCCAACCCAGCCCAGAGTGG + Intergenic
1060953016 9:127616836-127616858 AGACCAATGCTGGCACAAAGTGG + Intronic
1061001592 9:127905781-127905803 ATGACAAAACAGGCCCAGAGAGG + Intergenic
1061922333 9:133788956-133788978 AACCCAAGACAGGCCCAGAGTGG - Intronic
1061961370 9:133990910-133990932 TGACAAAGGCAAGCCCAGAGGGG - Intronic
1062339477 9:136087575-136087597 AGCCCAAGGCAGACCCAGAGAGG - Intronic
1203605538 Un_KI270748v1:54757-54779 GGACCAAAGCAGGAGGAGAGGGG + Intergenic
1192611427 X:72571212-72571234 AGACCAAAGAAGGCCGGGCGTGG - Intronic
1193184470 X:78495933-78495955 AGACAAAAACAGGCACAGTGGGG - Intergenic
1193405605 X:81097465-81097487 AGACAAAAGCAGGCCAAAATTGG + Intergenic
1194689321 X:96963408-96963430 AGACCAAAGCAGGTGCAGTATGG - Intronic
1195038642 X:100993291-100993313 AGGCCAAAGAAGACCCAGGGAGG - Intergenic
1198255280 X:134919067-134919089 AGCCCTAAGTAGGCCCAGAAAGG + Intergenic
1200683766 Y:6243239-6243261 AGACCAAGGAATGCCCAGCGAGG + Intergenic
1201048869 Y:9911147-9911169 AGACCAAGGAATGCCCAGCGAGG - Intergenic
1202018304 Y:20435082-20435104 ACACCAAACCAGGCCCAGTGAGG - Intergenic
1202133863 Y:21639897-21639919 AAAACAAAACAGGCCAAGAGCGG + Intergenic