ID: 1182281150

View in Genome Browser
Species Human (GRCh38)
Location 22:29218398-29218420
Sequence CTGTGGAGAAGGGGCTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 402}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182281150 Original CRISPR CTGTGGAGAAGGGGCTAGAA TGG Intronic
901774754 1:11552758-11552780 CTGTGGAGAAGAGACTAGGGAGG + Intergenic
901803610 1:11724042-11724064 CTTTGGGGAAGGAGCTTGAATGG - Exonic
902610866 1:17596476-17596498 CTTTGGGGATGGGACTAGAAAGG - Intronic
902956873 1:19931401-19931423 CTATGGAGAAGGGGCCATACAGG - Intergenic
903371205 1:22837278-22837300 CTGTGGAAATGGCCCTAGAAAGG - Intronic
903576867 1:24344752-24344774 CTGAGCAGAATGGGCTAGAAAGG + Intronic
904045657 1:27606760-27606782 ATGTGGAGCAGGAGCTAGACAGG + Intergenic
904581405 1:31546837-31546859 CTGAGGAGAAGAGACTTGAAGGG + Intergenic
904977947 1:34472838-34472860 CTGGGTAGAAGGGGCTGGCATGG - Intergenic
905483592 1:38279573-38279595 CTGTGGAGGAGGGGCCACAGGGG - Intergenic
905522974 1:38614344-38614366 CTGTGGAGAAAGGGCTTGCTGGG - Intergenic
906110204 1:43317504-43317526 CTCTGGAGAAAGGGCTGGCAAGG - Intronic
906265392 1:44424911-44424933 CTGCCGAGAAGGGGCTGGAGAGG + Intronic
906766932 1:48442120-48442142 TTGTGGAGAATGGGATACAAAGG + Intronic
907143390 1:52209925-52209947 GTGTGGAGAATAGGCTAGATGGG + Intronic
907651750 1:56302029-56302051 CAGAGGAAAAGGGGCAAGAATGG - Intergenic
909427883 1:75548579-75548601 CTGTCTAAAAGGGGCTAAAAAGG + Intronic
910432704 1:87174748-87174770 CTGTGGAGGAGGTGCTAGTGGGG + Intergenic
910938782 1:92510349-92510371 CTTTGGAGAAGGAGAAAGAAAGG - Exonic
912021671 1:105114076-105114098 TTGTGGAGAATGGGCTACAAAGG + Intergenic
912439398 1:109687287-109687309 CTGTGTAGGCGGGGCTAGAGGGG + Intronic
912442706 1:109711727-109711749 CTGTGTAGGCGGGGCTAGAGGGG + Intergenic
913116225 1:115699906-115699928 CAGAGGAAGAGGGGCTAGAAAGG + Intergenic
913342536 1:117773062-117773084 GTGTGGAGAAGCGGCTGAAAGGG - Intergenic
913469923 1:119177366-119177388 TTGTGGAGAATGGGATACAAAGG + Intergenic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
914801574 1:150966289-150966311 CTGTGGAAAAGGGACAAGAAGGG + Intronic
914848022 1:151293463-151293485 CTGTGGGGTAGGGGCAGGAATGG + Intronic
915526745 1:156480778-156480800 CTGGGGGGAAGGGGCCGGAAGGG + Intronic
916087899 1:161284521-161284543 GTGTGGAGAAGGGGAGAGAAGGG - Exonic
917710645 1:177680848-177680870 GTGTGAAGAAGGGGCTTGATGGG - Intergenic
918017464 1:180649952-180649974 CTGGGGTTTAGGGGCTAGAATGG + Intronic
919002691 1:191853724-191853746 CTGTGGAGAAGGAGTTACAGTGG + Intergenic
919169775 1:193939033-193939055 CTGTGAACTAGGGCCTAGAATGG - Intergenic
919759941 1:201091594-201091616 CTGTGGGGCAGGGCCTAGGATGG - Intronic
920376906 1:205513726-205513748 CTGTGGGGAAGGGGTTCGGAGGG - Intronic
921001574 1:211049653-211049675 GTGTGGAGGAGGGCCTGGAAGGG + Intronic
921116959 1:212100916-212100938 TTGTGGAGAAGGGTCTGAAATGG + Exonic
923130165 1:231068061-231068083 CTGTGGATTAGGGTCTAGACAGG + Intergenic
923439908 1:234007413-234007435 CTGCGGAGAAGGGCCTAGTGTGG + Intronic
923459704 1:234197585-234197607 ATGTGGAGAGGGAGCAAGAAGGG + Intronic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924853257 1:247852134-247852156 CCTTGGAGAAGTGGCTAGAGAGG + Intergenic
924946562 1:248850640-248850662 CTGAGGGCCAGGGGCTAGAAGGG - Intronic
1063982196 10:11463215-11463237 CCGTGGAGGAGGCGCTGGAAAGG - Exonic
1064753985 10:18558440-18558462 GTGTGGAGAATGGAATAGAATGG + Intronic
1064755601 10:18569705-18569727 GTGTGGAGAATGGAATAGAATGG - Intronic
1065062078 10:21912821-21912843 CAGAAGCGAAGGGGCTAGAAAGG + Intronic
1065095593 10:22277825-22277847 CTGTAGAGAAAGGGAGAGAATGG + Intergenic
1065735998 10:28753016-28753038 ATGTTGAGAATGGGCTAAAAGGG + Intergenic
1066472322 10:35711236-35711258 CTGTGGAGAGGTGGCTGGGAAGG - Intergenic
1067085117 10:43234070-43234092 CCCTGGGGAAGGGGCTGGAAGGG + Intronic
1067462564 10:46468470-46468492 CTCTGGGGAAGGGGCTAGGTAGG + Intergenic
1067624631 10:47916167-47916189 CTCTGGGGAAGGGGCTAGGTAGG - Intergenic
1068500691 10:57837739-57837761 TTGTGGAGAATGGGATAGAAAGG + Intergenic
1068706197 10:60078699-60078721 CTGGGGGGAAGGGGTTGGAAAGG + Intronic
1069968769 10:72146293-72146315 CTGGGGAAAGGGGACTAGAAAGG + Intronic
1070885488 10:79893143-79893165 CTGAGGAGGAGAGGCTAGCAGGG - Intergenic
1071175576 10:82923072-82923094 CTGTGGAGAATGGATTGGAAGGG - Intronic
1071524225 10:86348944-86348966 CTGGTGAGCAGGGGCTAGAAGGG - Intronic
1071562504 10:86655161-86655183 CTGAGGACAAGGGGCTGGAATGG + Intronic
1072074232 10:91952693-91952715 CTGCAGACAAGGGGGTAGAAAGG + Intronic
1072800966 10:98392236-98392258 GTGGGGAGAAGGGGCCAGAGAGG - Intronic
1073290675 10:102411818-102411840 CCCTGGAGAAGGGGCAAGAGAGG + Exonic
1074542724 10:114378823-114378845 CTGTGGTGGAGGAGCTAGACAGG - Intronic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1074925932 10:118070645-118070667 GTGTGGAGAATGGATTAGAAGGG + Intergenic
1076377632 10:130002343-130002365 CGGTGGAGAAGGGGCCAGTCTGG - Intergenic
1078058111 11:8023950-8023972 CTGAAGAGAAGGGTCTAGAATGG - Intronic
1078156822 11:8806943-8806965 AAGTGGAGAAGGGGCCAGGAGGG - Intronic
1078620081 11:12899176-12899198 CCTTGCAGAAGGCGCTAGAATGG + Intronic
1079009631 11:16817323-16817345 CTGAGGAGAAAGGGTAAGAACGG + Intronic
1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG + Intronic
1079620837 11:22552103-22552125 CTGTAGAGAAGAGTCTAGCAGGG + Intergenic
1080742907 11:35082442-35082464 CAGTGGAGCAGGGGCTGGACTGG + Intergenic
1081988548 11:47325128-47325150 CTGTGGAGCAGGGGACAGAGTGG - Intronic
1082668399 11:56004413-56004435 CTGTGGAGTGAGGGCTATAACGG - Intergenic
1083403483 11:62440733-62440755 TTGTGGAGACGGGGCTGGGATGG - Intronic
1083467960 11:62861573-62861595 GTGTGGAGAATGAACTAGAAGGG - Intronic
1083695713 11:64440864-64440886 GTGGGGAGAAGGGCCTAGCAGGG + Intergenic
1083740501 11:64708402-64708424 GTGTGGAGAAGGGGCTAAAAAGG - Intronic
1083875810 11:65524127-65524149 CTGTGTAGGAGGGGCTGGACAGG - Intergenic
1083931289 11:65847187-65847209 TTGTGGAGATGGGGGTCGAAGGG + Intronic
1085802927 11:79608227-79608249 GTGTGTAGAATGGACTAGAAGGG - Intergenic
1086476481 11:87180359-87180381 TTGGGGAGAAGTGGCAAGAAAGG - Intronic
1087551368 11:99654469-99654491 CTGTGGAACAGGGGGTAGTATGG + Intronic
1087988038 11:104709257-104709279 TAGTGGAGAAGGGGCTAGAAAGG - Intergenic
1089069008 11:115684267-115684289 GTGTGGAGAATGTTCTAGAAGGG + Intergenic
1089202844 11:116735120-116735142 CTTTGTGGCAGGGGCTAGAAGGG - Intergenic
1090077416 11:123588012-123588034 CTATGGAGAAGGGTAGAGAAGGG - Intronic
1090251648 11:125255872-125255894 CTGTGGGCAAGGGGCTGGGAAGG - Intronic
1090745840 11:129704198-129704220 CTGCGGAGGAGGGGCGAAAAGGG + Intergenic
1091573521 12:1712096-1712118 CTGTGAAGAATGGGATACAAAGG - Intronic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1091750346 12:3018331-3018353 CTGTGGAGGAGGGGCTCCATGGG - Intronic
1092080612 12:5713059-5713081 GTGTGGAGAATGGACTGGAAGGG + Intronic
1092277533 12:7073109-7073131 CAGCCCAGAAGGGGCTAGAAGGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093223078 12:16447014-16447036 CTGTGGAGAAAGGAATAGAGAGG - Intronic
1093625314 12:21339742-21339764 TTGTGGAGAAGGGGAAAGCAAGG - Intronic
1094242723 12:28247582-28247604 GAGTGGAGAATGGACTAGAAAGG + Intronic
1094307676 12:29038951-29038973 CTGTAGAGAAGTGGCTAAGATGG - Intergenic
1096198744 12:49665979-49666001 CTGTGGCCAAGGGCCTGGAATGG - Intronic
1096220384 12:49825376-49825398 CTGAGAAGCAGGGGCTAGAAAGG + Intronic
1096555076 12:52398862-52398884 CTGTGGAGATCGGGCTGGAGGGG - Intronic
1096823667 12:54257567-54257589 TTGTGGAGAAGGTGCTAGACAGG - Exonic
1098939281 12:76516340-76516362 TTGTGGAGAAGAGGCTAGGAAGG - Intronic
1099006283 12:77238183-77238205 TTGTGGACAAGGGATTAGAAGGG - Intergenic
1099061752 12:77919473-77919495 CTGTGGACATGGGGCTAGAAAGG + Intronic
1099096943 12:78386148-78386170 CTGTGGAGAAGTCAGTAGAATGG - Intergenic
1099946293 12:89248317-89248339 ATGAGGAGACGGGGCTAGAGAGG + Intergenic
1100143657 12:91650486-91650508 TTGTGGAGAAGTGACTGGAAAGG - Intergenic
1100653988 12:96620702-96620724 CTGTAGAGAAGGGTCAAAAAAGG - Intronic
1100872186 12:98921630-98921652 GTGTGAAGAATGGACTAGAAGGG + Intronic
1101707887 12:107237587-107237609 ATATGGAGAAGGGGCCAGCATGG + Intergenic
1101766825 12:107708691-107708713 CTGTGGTGAATGGTCTGGAATGG - Intronic
1104898149 12:132174172-132174194 CCGTGGAGAAGGGGCTCGGCTGG + Intergenic
1105357115 13:19668926-19668948 CTGTCGAGCAGAGGCTAGAGAGG - Intronic
1106498892 13:30307900-30307922 CTCTGGGGAGGGGGATAGAAGGG + Intergenic
1107521151 13:41183165-41183187 CTGTGGAGGTGGGGCTTTAACGG - Intergenic
1108145958 13:47477337-47477359 GTGTGGAGAATGGATTAGAATGG + Intergenic
1108158186 13:47610141-47610163 CTAGGGAGAAGGGGTAAGAAAGG + Intergenic
1109189903 13:59311633-59311655 ATGTGGAGAATGGACCAGAAAGG + Intergenic
1110015267 13:70392348-70392370 CTGTGGAGAAGCTGGTAAAATGG - Intergenic
1110764012 13:79262400-79262422 CTGTGGAGGACAAGCTAGAATGG + Intergenic
1110868155 13:80420467-80420489 GTGGGGAGAAGGGGGGAGAAGGG - Intergenic
1110950055 13:81474672-81474694 GTGTGGAGAAGGGGATACAGGGG + Intergenic
1112478526 13:99753351-99753373 GTGTGGAGAAGGGACTGGAGAGG + Intronic
1115072492 14:29341280-29341302 CTGTGGAAAATGCACTAGAATGG + Intergenic
1117043703 14:51791261-51791283 CTGTGGAGATGAGACTACAAAGG + Intergenic
1117625622 14:57634765-57634787 GTGTGGAGAACGGACTAGGATGG + Intronic
1118835314 14:69473746-69473768 CAGTGGAGAAGGGGATCGAGGGG + Intergenic
1119170345 14:72530233-72530255 CTTTGGAGAAGGGTCTGGAGAGG + Intronic
1119757228 14:77127724-77127746 ATGTGGAGGAGGGGCTGGGAGGG + Intronic
1119941809 14:78649243-78649265 TTGCGGAGAAGGGGGAAGAAAGG - Intronic
1120358270 14:83461181-83461203 GTGTGAAGAAGGGGCTATATTGG - Intergenic
1121048448 14:90804569-90804591 CGGTGGAGCAGAGGCTAGGAAGG + Intronic
1121454588 14:94030155-94030177 TTGTGGAGAATGGGCTGGGATGG + Intronic
1122155657 14:99748813-99748835 CTGTGGGGAGGAAGCTAGAAGGG - Intronic
1123192726 14:106586531-106586553 CTCCGGAGAAGGGGCTGGAGTGG - Intergenic
1123689662 15:22827388-22827410 CTGTGGAGAAGGTGCTGGGGAGG + Exonic
1123818441 15:24002545-24002567 CTGTGGAGTGAGGGCTAGTAAGG - Intergenic
1123847105 15:24313871-24313893 CTGTGGAGTGGGCGCTAGTATGG - Intergenic
1123866104 15:24520938-24520960 CTGTGGAGTGGGCGCTAGTATGG - Intergenic
1123873071 15:24595977-24595999 CTGTGGAGTGAGGGCTAGTATGG - Intergenic
1125777984 15:42235440-42235462 GTGTGGAGCAGGGGCAAGATTGG - Intronic
1125807219 15:42503970-42503992 TTGTGTAGAAGGAGATAGAAAGG + Intronic
1126071026 15:44864835-44864857 TTGTGGAGAATGGGATACAAAGG - Intergenic
1126697907 15:51341451-51341473 CTGCGGAGGAGGGGCTGGCAGGG - Intergenic
1127301356 15:57656921-57656943 CTGGGGAGAAGGAGCTGGACAGG - Intronic
1127360395 15:58240136-58240158 CAGTTGAGAAGGAGCCAGAAAGG - Intronic
1127521265 15:59745341-59745363 ATGGGGAGAAGGGGTTGGAATGG + Intergenic
1128270665 15:66306492-66306514 CTTTGAAGAAGGGGCTAGGCAGG + Intronic
1128495847 15:68198100-68198122 CCGTGGAGGAGGGGCTGGGATGG - Intronic
1129795407 15:78372708-78372730 TTGTGGAGAAGGGACTGGATGGG + Intergenic
1130067673 15:80618259-80618281 ATGTGGAGGATGAGCTAGAAGGG - Intergenic
1130399165 15:83533180-83533202 CTGAGGAGTATGGACTAGAAAGG + Intronic
1130449113 15:84033205-84033227 CTGTGGAGACTGGGTTGGAAAGG - Intronic
1131059507 15:89395929-89395951 CTTTGGAGAGGGGGCTAGGCAGG - Intergenic
1132909330 16:2300267-2300289 CTGTGGAGAAGGCGCTACTCAGG + Intronic
1134070451 16:11256693-11256715 GGGTGGAGCAGGGGCTAGGAGGG - Intronic
1135183172 16:20292381-20292403 CTGGGGAGCAGGGGAGAGAATGG - Intergenic
1135339268 16:21632405-21632427 TTGTGGAGAATGGGATACAAAGG - Intronic
1136714060 16:32262820-32262842 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1136753844 16:32666599-32666621 CTGTGAGGATGGGGCCAGAAGGG - Intergenic
1136814269 16:33203766-33203788 CTGTGAGGATGGGGCCAGAAGGG + Intronic
1136820745 16:33313846-33313868 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1136827308 16:33370385-33370407 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1136832374 16:33469156-33469178 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1136985778 16:35103019-35103041 CAGTGGGGAAGGGGCAGGAAGGG - Intergenic
1137028397 16:35500536-35500558 CTGTGAGGATGGGGCTAGAAGGG - Intergenic
1137484258 16:48878435-48878457 CTGTGGAAAAGGGACTCAAAGGG + Intergenic
1138222125 16:55260834-55260856 CTTTGGAGCAGGGGATGGAAAGG - Intergenic
1140763164 16:78130288-78130310 CTGATGAGAAGAGGATAGAAAGG + Intronic
1141611540 16:85183883-85183905 CTGTGAAGAAAGTTCTAGAAAGG - Intronic
1202992845 16_KI270728v1_random:26740-26762 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1203055996 16_KI270728v1_random:926949-926971 CTGTGAGGATGGGGCCAGAAGGG - Intergenic
1143033483 17:3981285-3981307 CAGTGGAGATGGGGCAGGAATGG + Intergenic
1143132272 17:4686475-4686497 CTGTGGATAATGGATTAGAAAGG - Intronic
1144008489 17:11123032-11123054 TTGTGGAGGAGGTGCTACAAAGG + Intergenic
1145006847 17:19343127-19343149 CTGTGGGGGAGGGGCTAAACAGG + Intronic
1146310896 17:31767526-31767548 TTGTGGAGAATGGGATACAAAGG + Intergenic
1146481325 17:33207130-33207152 CTGAGGAGAAGGGCTTATAAAGG + Intronic
1146742572 17:35299335-35299357 ATGTGGAGAAAGGGCATGAATGG - Intergenic
1146838185 17:36129163-36129185 CTGAGGAGAAGGGGAGAGATGGG - Intergenic
1147436232 17:40417861-40417883 CTGTGGAGAAGCGGCTTGGTCGG - Exonic
1147783398 17:42960294-42960316 ATGTGGAGAATGGGCTACAGAGG + Intronic
1148012426 17:44494134-44494156 CTGTAGGGAATGAGCTAGAAAGG - Intronic
1148814659 17:50318913-50318935 CCCAGGAGAAGGTGCTAGAATGG + Intergenic
1149213629 17:54330198-54330220 TTGTGGAGAACGGGATATAAAGG + Intergenic
1149329095 17:55563076-55563098 CTGTGGAAAAGGGGTAAGATGGG + Intergenic
1149739197 17:59027633-59027655 GTGTGGAGAAGGGTCTGAAAAGG - Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150235695 17:63591198-63591220 CTGTGGAGAAGGGTCTGAAATGG + Exonic
1151349642 17:73524289-73524311 CTCTGGGGAAGGGGTTGGAAAGG - Intronic
1151576203 17:74953696-74953718 GGGTGGAGGAAGGGCTAGAAGGG - Intronic
1152355106 17:79803099-79803121 CTGGGGAGAAGGGGCTCAGACGG + Intergenic
1152938251 17:83152893-83152915 CCGTGGAGATGGGCCGAGAATGG + Intergenic
1153360551 18:4191549-4191571 CTGGAGAGAATGGACTAGAAAGG - Intronic
1154009086 18:10560183-10560205 CTGTGGAGAAGCAGCCACAAGGG + Intergenic
1155326399 18:24669286-24669308 CAGAGGAGAAGAGGCTATAATGG - Intergenic
1155475736 18:26234601-26234623 TTGTGGAGAATGGGATACAAAGG - Intronic
1155718336 18:28975474-28975496 CTGTGGAGCAGGGCCAAGGAGGG + Intergenic
1156489722 18:37489037-37489059 TTGTGAAGCAGGGGCTAGAGAGG + Intronic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1157299220 18:46467686-46467708 GTGGGGAGAAGGGTCTGGAAAGG - Intergenic
1157572457 18:48722092-48722114 CTGTCCAGAAGGTTCTAGAAAGG + Intronic
1157634783 18:49141277-49141299 CTGTGGAGAAGTGACTTAAAGGG - Intronic
1160323225 18:77915551-77915573 CTGTGGGGCAGGGGCAAAAAAGG - Intergenic
1160435321 18:78847650-78847672 CTGAGGAGAAGGTTCTAGCAAGG - Intergenic
1160995962 19:1881984-1882006 CTGTGGAGAGGGGGCTGAATTGG - Intronic
1165104168 19:33459136-33459158 CTGTGGAGAAGGGTCTCCAGTGG + Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166539765 19:43597294-43597316 CTGTTGAGAAGGGGCTGTAATGG + Intronic
1167253844 19:48415610-48415632 CAGTGGAGGCGGGGCTAGGAGGG + Intronic
1167752075 19:51387450-51387472 CTGTGGGGAAGGGGAGAGATGGG + Intronic
1168366802 19:55795189-55795211 CTCTGGGAAAGTGGCTAGAAAGG - Intronic
926026359 2:9548366-9548388 GTGTGGAGAATGGGCTAGAGGGG + Intronic
926138208 2:10352355-10352377 CTCTTGAGAAGGGGCTACAAAGG - Intronic
928035645 2:27820253-27820275 CTGGGGAGAAGGTGTTATAAAGG - Intronic
929042290 2:37757041-37757063 CTGTGGGGTAGGGGCTATTAGGG + Intergenic
929127181 2:38532753-38532775 CTGTGGAGAAGAGGATGGGAGGG - Intergenic
929691854 2:44081554-44081576 ATGAGGAGAAGGGGAAAGAAAGG - Intergenic
929769513 2:44879893-44879915 GTGGGGAGAAGGAGTTAGAAAGG - Intergenic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930834969 2:55783377-55783399 CTGGGTAGAAGGGGGCAGAAAGG + Intergenic
933622216 2:84555971-84555993 ATGTGGAAAATGGACTAGAAGGG - Intronic
934071546 2:88389000-88389022 CTGATGATAATGGGCTAGAAGGG + Intergenic
935056567 2:99572827-99572849 CTGTGGGGAAGTGCCTATAAAGG - Intronic
935163452 2:100549055-100549077 TTGTTGGAAAGGGGCTAGAAAGG + Intergenic
936461658 2:112718709-112718731 ATGTGGAAAAGGGGCTTAAAGGG + Intergenic
936532446 2:113285855-113285877 CTGGGGAGAAGGGGCAATGAGGG + Intergenic
936977821 2:118237126-118237148 GTGTGGGGAAAGGGCCAGAAAGG - Intergenic
937374670 2:121327530-121327552 CTTTGGGGAAGAGGATAGAAGGG + Intergenic
937375461 2:121333184-121333206 CTTTGGGGAAGAGGATAGAAGGG + Intergenic
938981377 2:136530487-136530509 GTGTGGATAAGGGACTAGAGAGG - Intergenic
940654494 2:156471639-156471661 TTTTGGAGAAGGGTCTTGAAGGG - Intronic
941243646 2:163070864-163070886 TTGTGGAGAATGGGATACAAAGG + Intergenic
941634783 2:167924837-167924859 ATGGGGAGAAGGAGCTATAAAGG + Intergenic
942266244 2:174228851-174228873 GTATGGAGAAGGGTGTAGAAGGG - Intronic
943306508 2:186269168-186269190 CAGTGGAGAAGGGCATAAAAAGG + Intergenic
944945433 2:204678501-204678523 CAGTGGAAAAGGAGCTAGAGCGG + Intronic
945016671 2:205525797-205525819 CTGTAGCGAAGGGGCTGGAAGGG - Intronic
945253680 2:207785942-207785964 TCGTGGAGAAGGGGACAGAATGG + Intergenic
946397397 2:219449804-219449826 CTGAGGTGAGGAGGCTAGAAGGG - Intronic
946428023 2:219609630-219609652 CTAGGGAGAAGGGGCTAGAGTGG + Intronic
946613146 2:221480764-221480786 GTTTTGAGCAGGGGCTAGAATGG - Intronic
947357430 2:229311487-229311509 CAGTGGATAACGGGCTAAAAGGG + Intergenic
1169626972 20:7582045-7582067 CTGTGGAGGAGGGGATTCAAAGG - Intergenic
1171261734 20:23740022-23740044 CTGTGGAGAATGGGATATGAAGG + Intergenic
1171270876 20:23815913-23815935 CTGTGGAGAATGGGATATGAAGG + Intergenic
1171385206 20:24765152-24765174 CTGTGGAGAGGAGGCAAGACTGG - Intergenic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1174406521 20:50306559-50306581 CAGTGGAGAATGGGCTGGAGGGG + Intergenic
1174421501 20:50401978-50402000 GTGTGGAGGAGGGGACAGAATGG - Intergenic
1175336540 20:58199896-58199918 CTGAGCAGAAGAGGCCAGAAGGG + Intergenic
1175508900 20:59508400-59508422 CAGTGTAGAAGGGGCAGGAATGG - Intergenic
1175883587 20:62274709-62274731 CTGGGGAGAAGGAGCTGGAGGGG + Intronic
1176522401 21:7834233-7834255 CCGTGAAGAAGTGTCTAGAAGGG - Intergenic
1177140488 21:17352903-17352925 CTGTTGGGAAGGGGCAAGATGGG + Intergenic
1178085888 21:29111650-29111672 CTTTGGAGAAGGGGGAAGAAAGG - Intronic
1178553973 21:33569765-33569787 CTGTGGTGAAGGGGATGGGATGG + Intronic
1178656421 21:34464245-34464267 CCGTGAAGAAGTGTCTAGAAGGG - Intergenic
1178787501 21:35667431-35667453 CTATGGAGAAGGGGTTGGAGAGG - Intronic
1180669377 22:17541554-17541576 CTGGGGAGAAACGGCTAAAATGG + Intronic
1180864094 22:19105958-19105980 CGATGGGGAAGGGGCTAGACGGG - Intronic
1181343556 22:22201101-22201123 CTGTGGGGCAGGGGCCAGCAGGG - Intergenic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1183194042 22:36341002-36341024 CTGTGGGGAAGAAGCAAGAAAGG + Intronic
1183730472 22:39615652-39615674 CTGAGCAGAAGAGGATAGAAAGG - Intronic
1184066872 22:42126263-42126285 ATGTGGGGAAGGGGCCAGAATGG - Intergenic
1184069600 22:42139969-42139991 ATGTGGGGAAGGGGCCAGAATGG - Intergenic
949740759 3:7230965-7230987 CTGTGAAGAAGTGGCTGGATGGG - Intronic
950169631 3:10829327-10829349 CTGTAGAGATGAGGCTGGAAGGG - Intronic
950290487 3:11780067-11780089 CTATGGAGAATAGACTAGAAAGG - Intergenic
950884001 3:16347091-16347113 CCCTGGAGAAAGGGCCAGAATGG - Intronic
951698448 3:25469926-25469948 CTGTGGAGAGGGGCTTAAAAAGG + Intronic
951746566 3:25984577-25984599 CGGTGGATTAGGGGATAGAAGGG - Intergenic
953220965 3:40971190-40971212 ATATGGACAAGGGGCTAGATTGG - Intergenic
953791544 3:45951530-45951552 CTGTGGAGTAAGGGCTGGCAGGG - Intronic
954686747 3:52375165-52375187 GTATGGAGAAGGGGCCACAAAGG + Intronic
955723708 3:61910208-61910230 CTGTGGGGAATGGGTAAGAATGG - Intronic
956785035 3:72635331-72635353 ATTTGGAGAAGGGGCTACAAAGG + Intergenic
957248206 3:77739131-77739153 TTTTGGAGATGGGGATAGAATGG - Intergenic
958029875 3:88095891-88095913 CTGTGGAGAAGGTGCTAGACAGG - Intronic
958145704 3:89621947-89621969 CTGTGAAGCAGGGTCTAGATTGG - Intergenic
960056046 3:113277191-113277213 ATGTGGAGAGGGGTCTAGAGAGG + Intronic
962215286 3:133515654-133515676 ATTAGGAGAAGGGGCTTGAATGG - Intergenic
962745698 3:138396088-138396110 CAGTGGAGAAGGGGAGGGAAGGG + Intronic
963046323 3:141105111-141105133 CTGTGAAAAAGAGGCTAAAATGG - Intronic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
967102368 3:186226331-186226353 TTGTGGAGATGGGGCCAGAGGGG + Intronic
967584040 3:191190788-191190810 TTGTGGAGAATGGGATACAAAGG + Intergenic
967980743 3:195063642-195063664 CTGTGGAGAATGCGGGAGAAGGG + Intergenic
969470540 4:7385065-7385087 CTGTGGAGCAGGGGCCAGGGTGG + Intronic
969483197 4:7457799-7457821 CTCTGGGGAAGAGGCCAGAAAGG + Intronic
971159248 4:24116824-24116846 CTGTGGTGTAGGGGATAGACAGG - Intergenic
971213628 4:24643475-24643497 CTCTGGAGAAGGGGAGATAAGGG - Intergenic
971359267 4:25921843-25921865 CTGAGGAGGAGTGGCTAGACAGG + Intronic
972262818 4:37427638-37427660 CCCTTTAGAAGGGGCTAGAATGG - Intronic
975370583 4:73581705-73581727 CTGTGGAGAAAGGGGAGGAATGG - Intronic
975693949 4:76993220-76993242 CTCTGGAGAAGGGGCGAGTTTGG + Intronic
975732790 4:77354049-77354071 CTGTGGAGAAGGAACTGGCAGGG + Intronic
975734380 4:77367145-77367167 CTGTGGAGAAGGAACTGGCAGGG + Intronic
978618614 4:110619107-110619129 ATGAGGAGAAGGGGCTGGAAGGG + Intronic
978978428 4:114910745-114910767 GTTTGGAGAAGGGCCTAGTAAGG - Intronic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
983176164 4:164590320-164590342 CTGGGGAGAGGAGGTTAGAAAGG + Intergenic
983831184 4:172329897-172329919 CTGTGGAAAAGTGGCCAGACTGG - Intronic
984814773 4:183825892-183825914 ATGGGGAGAAGGCGCGAGAAGGG + Intergenic
984842809 4:184083516-184083538 CTGGGGAGAAGGGGCTTGTGGGG + Intergenic
984949572 4:184996922-184996944 CTGTGGGGTCTGGGCTAGAAAGG + Intergenic
985544110 5:500642-500664 GTGTGGACATGGGGCTAGTATGG + Intronic
986369448 5:7065422-7065444 TTGTGGAGAAGGGGATAGAGAGG - Intergenic
986452764 5:7882476-7882498 CTGTGGATAAGTGGCTATATGGG - Intronic
986516780 5:8572937-8572959 ATGTGGAGATGGGGCTTGCAGGG - Intergenic
986623461 5:9701148-9701170 GTGTGGAGAAGGGGAGACAAGGG + Intronic
987930941 5:24398617-24398639 TTGTGGAGAATGGGATACAAAGG + Intergenic
988821578 5:34891474-34891496 CTGTGAAGAAGGGGAAGGAAGGG - Intronic
989957704 5:50375389-50375411 TTGTGGAGAATGGGATACAAAGG + Intergenic
990614452 5:57493194-57493216 CTGTGAAGCAGGGTCAAGAATGG + Intergenic
992051282 5:72943312-72943334 ATGTGGAGAATAGGCTAAAAGGG - Intergenic
992367971 5:76112577-76112599 CTGTGGAGAAGGGACTCTGAGGG + Intronic
994321652 5:98401671-98401693 CTATGGAGAGGGGCCTGGAAGGG - Intergenic
994884992 5:105549067-105549089 CTCTGCAGATGGGGCCAGAAGGG + Intergenic
995026258 5:107426673-107426695 TTGTGAAGAAGTGTCTAGAAGGG - Intronic
996412886 5:123177900-123177922 CTGAATGGAAGGGGCTAGAACGG - Intronic
997428903 5:133823828-133823850 CTGGGGAGAAAGGGCCAGATGGG + Intergenic
997533144 5:134595061-134595083 TAGTGGAGAAGGGGCAAGAGGGG - Intergenic
997772139 5:136565113-136565135 CTGTGGAGAAGAGGGGACAATGG - Intergenic
998052920 5:139051444-139051466 CTGTCGAGGAGGGGCAGGAAGGG - Intronic
998188920 5:140005700-140005722 CTGAGGAGCTGGGGCTAGACTGG - Intronic
998455509 5:142269638-142269660 CTTTTGAGAAGAGGGTAGAATGG - Intergenic
999315700 5:150582554-150582576 CTGAGGAGAAGGAGGTAGAGAGG - Intergenic
1000085600 5:157885109-157885131 TTGTGGAGAATGGGATACAAAGG + Intergenic
1000388743 5:160701124-160701146 CTGTGGAAAAGAGACTAGAGGGG - Intronic
1000832933 5:166126624-166126646 CTATGGAGATGTGGCTAGGAAGG + Intergenic
1001037696 5:168309490-168309512 CTGTGGAGAGGGGGCTGGGTAGG - Intronic
1001584752 5:172826261-172826283 ATGTGGAGAAGGGACTGGAGTGG - Intergenic
1002557647 5:180056357-180056379 CTATAGAGAATGGGCTAGAAGGG + Intronic
1003053567 6:2800506-2800528 CACTGGAGAAAGGTCTAGAAGGG + Intergenic
1003126228 6:3358034-3358056 CAGTGCAGAAGAGGCTAGACAGG + Intronic
1003460338 6:6322689-6322711 CTGTAGAGAATGGACTGGAAAGG - Intergenic
1004200583 6:13544018-13544040 CTGTGGAGAATCAGTTAGAAAGG + Intergenic
1004268984 6:14177073-14177095 CTGGGGAGAAGTGGCTGGCAGGG + Intergenic
1005267624 6:24128725-24128747 CTGTGGAAAAGTGGCTATAATGG + Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1006707937 6:36038097-36038119 CTGTGGAGAAAATGCAAGAAGGG + Intronic
1006866067 6:37209951-37209973 CTGAGGAGAAGGGGCCAGTGCGG + Intergenic
1006878560 6:37319265-37319287 ATGAGGACAAGGGGCTGGAATGG + Intronic
1007358764 6:41340989-41341011 GTGGGGAGAAGGGGAAAGAAGGG - Intronic
1008064247 6:47030738-47030760 AAGTGGAAAAGGGGCTGGAAGGG - Intronic
1009942220 6:70302960-70302982 CTATGAAGAAGGGGTTGGAAGGG + Exonic
1010046232 6:71447308-71447330 CTGGGGAGAAGGGGCAGGGAGGG + Intergenic
1012808260 6:103923496-103923518 CTTTTGAGAAGGGTATAGAAAGG - Intergenic
1013243110 6:108263759-108263781 CAGTGGGGAAGCGGCTAGGAGGG + Intergenic
1015994118 6:138980438-138980460 CTGTGGACAAGAGGGGAGAATGG - Intronic
1018224154 6:161611642-161611664 CTGAGGAGAAGGGGCAAGACAGG - Intronic
1019306869 7:339807-339829 CTGGGGAGGAGGGGCTGGTATGG - Intergenic
1019579414 7:1752888-1752910 CTAGAGAGAAAGGGCTAGAAAGG - Intergenic
1019843192 7:3470069-3470091 CTGTGGAGAAGATACTAGAGAGG + Intronic
1020188196 7:5974553-5974575 GTGGGGAGATGGGGCTGGAAGGG + Intronic
1020294721 7:6750215-6750237 GTGGGGAGATGGGGCTGGAAGGG - Intergenic
1020760248 7:12260480-12260502 CTATGGAGGAGAGGATAGAAAGG - Intergenic
1021926949 7:25543141-25543163 CTGGCGAGGAGGGGATAGAAGGG - Intergenic
1022055848 7:26733634-26733656 TTGTGGAGAAGGGGAGAGCAGGG + Intronic
1022812819 7:33886190-33886212 TTGTGGAGAAGGAGCAAGAGAGG - Intergenic
1023278579 7:38546875-38546897 GTGTGGAGAAGGGTGGAGAATGG - Intronic
1025249316 7:57341485-57341507 GTGTGGAGGAGGGGACAGAATGG + Intergenic
1026849088 7:73713823-73713845 CTCTGGAGAGGGGGCTGGATTGG + Intronic
1027367736 7:77475523-77475545 GTGTGTAGAATGGACTAGAATGG - Intergenic
1028370200 7:90083179-90083201 CAGTAGAGAAGTGGCTAGAAGGG + Intergenic
1028494874 7:91451274-91451296 TTGTGGAGAATGGGATACAAAGG - Intergenic
1031352171 7:120747108-120747130 ATGTGGGGAAGGGGATAAAAGGG - Intronic
1032531316 7:132623022-132623044 CAATGGAGAAGGGGCTGGAAGGG - Intronic
1032691884 7:134295417-134295439 TTCTGGAGGAGGGGATAGAAGGG - Intronic
1032913498 7:136460946-136460968 CTCTGGAGAAGGGATTTGAACGG + Intergenic
1034255446 7:149722375-149722397 GTCTGGAGCTGGGGCTAGAAAGG + Intronic
1036383784 8:8260137-8260159 ATGTGGTGATGTGGCTAGAACGG + Intergenic
1036591813 8:10175084-10175106 TTGTGGGAAAGGGGCTAGACAGG - Intronic
1036711597 8:11082987-11083009 CTGTGCAGAAAGGGCTGGGAAGG - Intronic
1037195253 8:16180899-16180921 CTGTGGAGAAAGGGAATGAAGGG + Intronic
1037746395 8:21648881-21648903 CTGTGTAGCTGGGGCTACAAGGG - Intergenic
1037946602 8:22993477-22993499 AAGTGGAGAAGGAGTTAGAAGGG + Intronic
1038639153 8:29310028-29310050 TTGTGGAGAATGGGATACAAAGG + Intergenic
1038658952 8:29480019-29480041 CTGGGGAGGAGGGGCAGGAAAGG - Intergenic
1039597822 8:38806598-38806620 CAGAGGAGAAGTGGGTAGAAGGG + Intronic
1040568498 8:48587890-48587912 CTGTGGAGTAGTGGCCACAATGG + Intergenic
1040971120 8:53138532-53138554 TTGTGGAGAATGGGATACAAAGG - Intergenic
1041704923 8:60836368-60836390 CTATGATAAAGGGGCTAGAATGG + Intronic
1042018726 8:64346334-64346356 CTTTGGAGAAGAGGCTGGAAAGG + Intergenic
1043188464 8:77185757-77185779 ATGTCTAGAAGGGTCTAGAAGGG - Intergenic
1044341977 8:91056119-91056141 CTGTGGAGAAAGGGTTAGCTTGG + Intergenic
1044456283 8:92395831-92395853 TTGTGGAGAATGGGATACAAAGG - Intergenic
1045031207 8:98138138-98138160 GTGTGGAGAATGGGCTGAAAAGG - Intronic
1046357394 8:113106520-113106542 TTGTGGAGCAGGGGCAAGCATGG + Intronic
1047708390 8:127525358-127525380 AGGTGGAGAAGGGGCAAGAATGG - Intergenic
1047934295 8:129761727-129761749 ATGAGGAGAAGGGGTGAGAATGG - Intronic
1047968150 8:130062566-130062588 CTGAGGTGGTGGGGCTAGAAAGG + Intronic
1048216934 8:132504860-132504882 CTGTGAGGAAGGGACTAGAGGGG - Intergenic
1048722168 8:137337845-137337867 AAGTGGAGAAGGGGATTGAAAGG - Intergenic
1048782195 8:138014522-138014544 CTTTGGAGCAGGGGCCAGATTGG + Intergenic
1049686748 8:143942174-143942196 CTCTAGAGAAGGGGCTGGAGGGG - Intronic
1049927216 9:421032-421054 CCGTGGGGAAGGGGCCAGAGGGG + Exonic
1050262953 9:3860410-3860432 CAATGGAGAAGGGCATAGAAGGG - Intronic
1051516224 9:17933274-17933296 CAGAGGAGAAGGTGCTATAAAGG - Intergenic
1051659866 9:19416026-19416048 CTCTGGGGAAGAGGCTAGAAAGG + Intronic
1051935624 9:22439603-22439625 TTGTGGAGAATGGGATACAAAGG + Intergenic
1052057433 9:23920815-23920837 TTGTGGAGAATGGGATACAAAGG - Intergenic
1052584985 9:30415247-30415269 CTGTGGGACAGAGGCTAGAAAGG + Intergenic
1052915523 9:33922236-33922258 CAGTGGAGAAGGGGCTTGAATGG + Exonic
1055543339 9:77338908-77338930 GTGTGGGGAAGGGACTAGAGGGG + Intronic
1057714738 9:97483109-97483131 CTGTGGAGAAAGCGCTCGTATGG - Exonic
1059268613 9:113059147-113059169 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059269665 9:113063930-113063952 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059270799 9:113069378-113069400 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059271933 9:113074825-113074847 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059273067 9:113080272-113080294 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059274203 9:113085714-113085736 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059762780 9:117354782-117354804 CTGTGGAGTAGGTTCTAGTACGG - Intronic
1060658538 9:125389136-125389158 CTGTGGAGAATGGACCAGAGGGG - Intergenic
1060780642 9:126409711-126409733 CTGCGGAGCTGGGACTAGAATGG + Intronic
1060825531 9:126685540-126685562 CTGTGGCGGAGGGGCTGGACAGG + Intronic
1060883673 9:127135811-127135833 CTGTGGGGAAGGGGCATGCAAGG + Intronic
1062080804 9:134622469-134622491 CAGGGGGGAAGGGGCAAGAAAGG - Intergenic
1186552248 X:10518473-10518495 ATGTGGGGAAGGGGGTAGTAGGG - Intronic
1186610750 X:11135955-11135977 CTCTGGCAAAGGGGCCAGAATGG - Intergenic
1186754904 X:12660379-12660401 TTGTGGAGAATGGGGTAGAGGGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187441857 X:19327972-19327994 GTGGGGAAAGGGGGCTAGAAGGG - Intergenic
1189132811 X:38517969-38517991 TGGTGGAGAAGGGGCTGGCATGG - Intronic
1189266218 X:39718618-39718640 CTGGGGAGAAGGGACAAGCAGGG + Intergenic
1194163067 X:90479596-90479618 CTGTGGAGTAAGGGCTACTATGG - Intergenic
1195235249 X:102890476-102890498 TTGTGGAGAATGGACTGGAAAGG + Intergenic
1195288684 X:103410372-103410394 GTGTGGAGAATGGGCTGGAGAGG + Intergenic
1195850807 X:109279894-109279916 TTGTGGAGAACGGGATACAAAGG - Intergenic
1197422035 X:126249618-126249640 CTATGGAGAAGGGTTAAGAAAGG + Intergenic
1197513749 X:127400072-127400094 TTGTGGAGAATGGGATACAAAGG + Intergenic
1199328050 X:146524645-146524667 GTTTGGAGAGGGGGCTTGAATGG - Intergenic
1200075307 X:153547772-153547794 CTGGGGAGAAGGCGTTATAAGGG - Intronic
1200509342 Y:4057328-4057350 CTGTGGAGTAAGGGCTACTATGG - Intergenic
1201543994 Y:15140523-15140545 CTGTGGAGAAGAGGTGGGAATGG + Intergenic
1201919623 Y:19220437-19220459 TTGTGGAGAATGGGATACAAAGG + Intergenic
1201939856 Y:19448031-19448053 CTTTGGGGAAGTGGCCAGAAAGG + Intergenic