ID: 1182281222

View in Genome Browser
Species Human (GRCh38)
Location 22:29218722-29218744
Sequence GGGCCTGACCCCTGAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182281211_1182281222 25 Left 1182281211 22:29218674-29218696 CCATGTCAGGAGGGCGGGCCGAG No data
Right 1182281222 22:29218722-29218744 GGGCCTGACCCCTGAGTGCCTGG No data
1182281217_1182281222 0 Left 1182281217 22:29218699-29218721 CCACAATCACCTTTTCTGGGCCT No data
Right 1182281222 22:29218722-29218744 GGGCCTGACCCCTGAGTGCCTGG No data
1182281215_1182281222 2 Left 1182281215 22:29218697-29218719 CCCCACAATCACCTTTTCTGGGC No data
Right 1182281222 22:29218722-29218744 GGGCCTGACCCCTGAGTGCCTGG No data
1182281220_1182281222 -9 Left 1182281220 22:29218708-29218730 CCTTTTCTGGGCCTGGGCCTGAC No data
Right 1182281222 22:29218722-29218744 GGGCCTGACCCCTGAGTGCCTGG No data
1182281212_1182281222 7 Left 1182281212 22:29218692-29218714 CCGAGCCCCACAATCACCTTTTC No data
Right 1182281222 22:29218722-29218744 GGGCCTGACCCCTGAGTGCCTGG No data
1182281216_1182281222 1 Left 1182281216 22:29218698-29218720 CCCACAATCACCTTTTCTGGGCC No data
Right 1182281222 22:29218722-29218744 GGGCCTGACCCCTGAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182281222 Original CRISPR GGGCCTGACCCCTGAGTGCC TGG Intronic