ID: 1182283451

View in Genome Browser
Species Human (GRCh38)
Location 22:29231163-29231185
Sequence AACCCACTGCTCATTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182283451_1182283458 -5 Left 1182283451 22:29231163-29231185 CCTGTGGGAATGAGCAGTGGGTT 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1182283458 22:29231181-29231203 GGGTTGGGAATCGGGGAAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 310
1182283451_1182283457 -6 Left 1182283451 22:29231163-29231185 CCTGTGGGAATGAGCAGTGGGTT 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1182283457 22:29231180-29231202 TGGGTTGGGAATCGGGGAAGTGG 0: 1
1: 0
2: 2
3: 40
4: 381
1182283451_1182283459 2 Left 1182283451 22:29231163-29231185 CCTGTGGGAATGAGCAGTGGGTT 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1182283459 22:29231188-29231210 GAATCGGGGAAGTGGGATTCTGG 0: 1
1: 0
2: 3
3: 5
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182283451 Original CRISPR AACCCACTGCTCATTCCCAC AGG (reversed) Intronic
900140655 1:1138160-1138182 CGCCCCCTGCTCATTCCCACCGG - Intergenic
900406227 1:2494213-2494235 ACCCCAAAGCTCATTCCCAATGG - Intronic
900411142 1:2513254-2513276 CACCCACTGCTCAGTCACATGGG - Intronic
900665733 1:3814342-3814364 AACCCCCAGCTCACTCCCACAGG + Exonic
901036455 1:6338883-6338905 AACCCCCTTCCCCTTCCCACTGG - Intronic
901194779 1:7434206-7434228 AACTCTCTGCTCTTTCCCAAGGG + Intronic
903022117 1:20401753-20401775 AACCCACTGCTGCTTCCTTCTGG + Intergenic
903382998 1:22909663-22909685 CACACACTGTTCTTTCCCACTGG - Intronic
903942540 1:26941698-26941720 ACCCCACTGCTCAGTGCCAGGGG - Intronic
906180025 1:43810272-43810294 CACCCCCCTCTCATTCCCACAGG + Intronic
906508787 1:46399159-46399181 AACCCGCTTATCAATCCCACTGG + Intronic
906679913 1:47719523-47719545 AACCCAGAGCTCATTCCCAATGG - Intergenic
908775175 1:67632627-67632649 AAACCGCAGCTCATTGCCACTGG - Intergenic
909163456 1:72184531-72184553 AACCCTCTGCTCATTTACTCTGG - Intronic
914389628 1:147208299-147208321 AACCCTTTTCTCATTCCCCCAGG - Intronic
915576448 1:156781795-156781817 AACACACCACTCAATCCCACTGG + Intronic
918097747 1:181348829-181348851 AACTCACTGCTGCTCCCCACAGG - Intergenic
924616687 1:245617899-245617921 TCCCCCCTGCTCCTTCCCACAGG + Intronic
1062860059 10:803792-803814 AACCCTGTGTTCACTCCCACTGG - Intergenic
1063367689 10:5500988-5501010 GACCCACAGCTCAGTCCCCCAGG + Intergenic
1065122547 10:22543530-22543552 AAGCCACTGCTCATCCCCCCTGG + Intronic
1069950230 10:72013684-72013706 ATCCCCCTGCCCATTCCCAAGGG + Intergenic
1070411926 10:76149895-76149917 AACCAGGTGCCCATTCCCACAGG - Intronic
1070515214 10:77198957-77198979 AGTGCACTGCTCATTCACACTGG - Intronic
1070754523 10:78983583-78983605 ATCCCACAGCTCATTCCTTCAGG - Intergenic
1075464657 10:122642517-122642539 AACCCCCTCCTCATTCCCTGGGG - Intronic
1077278643 11:1730787-1730809 AAGCCACTGCCCATTCCTGCAGG - Intergenic
1077319230 11:1933699-1933721 CACCCACTGCCCCTGCCCACAGG + Exonic
1077536044 11:3124746-3124768 ACCCTACTGCCCATTCACACCGG + Intronic
1079400731 11:20104406-20104428 GACCCCCGGCTCATTTCCACTGG + Intronic
1083248513 11:61449298-61449320 ACACCACTCCTCATTCCCAGAGG - Intronic
1085273563 11:75284143-75284165 AACTCCCTGCCCATCCCCACTGG - Intronic
1087551090 11:99649920-99649942 ATACCACTTCTCATTCCCACAGG + Intronic
1090437243 11:126697041-126697063 AACCCACTGTTCTTTCGCTCAGG + Intronic
1091058859 11:132443349-132443371 CACCCTCTGCCCACTCCCACTGG - Intronic
1092954281 12:13535152-13535174 AACCCTCTGTGCATTCCCTCTGG + Intergenic
1095193373 12:39284525-39284547 AACCCACTGCACACTCCCACTGG - Intergenic
1096210687 12:49763311-49763333 AACTCACGGCCCAGTCCCACAGG - Exonic
1097225319 12:57473773-57473795 AATGCACTGCTCTTTCCCACAGG + Intronic
1097388488 12:58979812-58979834 AGACCACTGCTCAATCCAACTGG - Intergenic
1098032281 12:66267050-66267072 ATCCACCTCCTCATTCCCACAGG - Intergenic
1098176891 12:67802101-67802123 AAAACACTTCTCATTCCCAGGGG + Intergenic
1099085708 12:78243816-78243838 AACCATCTGCTCATGCCCAAGGG - Intergenic
1099879475 12:88450371-88450393 AACCCCCAGCTGATCCCCACTGG + Intergenic
1101051606 12:100869381-100869403 AACCTGCTGGTCATTCCCTCAGG - Intronic
1101406532 12:104433819-104433841 AACCCCCTCCTCCTTCCCAAAGG + Intergenic
1101568333 12:105930672-105930694 CTCACACTTCTCATTCCCACTGG - Intergenic
1102031232 12:109741223-109741245 AACTCACTGCCCATTCTCCCAGG - Intronic
1102548438 12:113673640-113673662 AACCCAGTGCTGCTCCCCACTGG - Intergenic
1104043767 12:125147209-125147231 AGCCCAGTGCCCATTCCGACAGG + Intergenic
1104623203 12:130333627-130333649 CACCCATTGCTCTTTCCCTCTGG + Intergenic
1105932302 13:25063939-25063961 AACACACTGATCAGTGCCACTGG - Intergenic
1106078895 13:26484422-26484444 CACCCTCTGCTCCCTCCCACTGG + Intergenic
1107020513 13:35746350-35746372 AACAGACTGCCCATTCCCATCGG + Intergenic
1107068044 13:36238140-36238162 AACTAACTGCTCATTCATACAGG + Intronic
1107339907 13:39395021-39395043 TCCCCACTGCTCCTTCCCACGGG + Intronic
1108362522 13:49680124-49680146 AACTCATGGCTCATGCCCACTGG - Intronic
1113673887 13:112195194-112195216 AACCCACTACTAATTCACTCAGG + Intergenic
1113869874 13:113552885-113552907 AACCACGTGCTCATCCCCACAGG + Intronic
1116975784 14:51114313-51114335 AACAGACAGCTCATTGCCACTGG + Intergenic
1120926649 14:89803803-89803825 AGCCCGCTGCTTCTTCCCACTGG + Intronic
1121123399 14:91390617-91390639 AGCCCACTGCACCTTCCCAGTGG + Intronic
1122256614 14:100482846-100482868 AGCCCACTGCTCAGTCCCATGGG + Intronic
1124007204 15:25803714-25803736 AATCCACTGTTCAGTTCCACAGG - Intronic
1124551927 15:30689115-30689137 TCCCCACTGCACATTCTCACGGG + Intronic
1124679319 15:31716556-31716578 TCCCCACTGCACATTCTCACGGG - Intronic
1125443849 15:39732215-39732237 AGCCCACCGCTCATCCCCTCCGG + Intronic
1125509625 15:40285971-40285993 AACCAACTGCTCCTTCCAAAGGG - Intronic
1126211193 15:46103100-46103122 AAACCTTTGCCCATTCCCACTGG + Intergenic
1127132976 15:55886884-55886906 AACCCACTGTTCATTCATTCAGG - Intronic
1127271239 15:57403769-57403791 AACCCACTGGACACTCCCTCGGG - Intronic
1131392600 15:92061638-92061660 CACCCACTGTCCATCCCCACTGG + Intronic
1131745919 15:95447103-95447125 AACCCTCTCCTCATTACCACAGG + Intergenic
1132877257 16:2145568-2145590 AACCCACTGCAGCATCCCACTGG + Intronic
1132909742 16:2303216-2303238 AATCTATAGCTCATTCCCACTGG - Intronic
1133816241 16:9199497-9199519 CACCCTCTGCTCCCTCCCACCGG + Intergenic
1133920680 16:10150327-10150349 AACCCACTGCTATTTCCTAGTGG - Intronic
1135189835 16:20345778-20345800 AACCCAATGCTGATGCCTACTGG + Intronic
1139490722 16:67284622-67284644 TACCCACTCCCCATCCCCACAGG - Intronic
1143015522 17:3889359-3889381 AAGCCAGTGCCCATGCCCACAGG - Intronic
1144323530 17:14154998-14155020 CTCACACTGCTCATTCCCAATGG - Intronic
1146220707 17:31017140-31017162 AAACCAAAGCACATTCCCACTGG - Intergenic
1146630985 17:34469121-34469143 AACCCAGTGCTCTTTCCCTGAGG - Intergenic
1146647817 17:34586952-34586974 AACCAGCTGCTCATTCTCACAGG - Intronic
1147862732 17:43533149-43533171 AACCCACTGCTCATGGGCCCAGG - Intronic
1150367066 17:64598224-64598246 AAGCCAAAGCACATTCCCACTGG + Intronic
1151515556 17:74592734-74592756 GACCCACTGCCCCTTCCCCCAGG + Exonic
1151527499 17:74681055-74681077 AACCCACTCTTCATTCCCCAAGG + Intronic
1153540327 18:6146843-6146865 GCCCCACTGCTCATCCTCACTGG - Intronic
1154215861 18:12415696-12415718 CACCCACTGCTCCTTCCCCTGGG + Intronic
1159042044 18:63333509-63333531 AACCCCCTGCTCAGGCCCCCTGG - Intronic
1159842516 18:73416059-73416081 ATCACCCTGCCCATTCCCACTGG + Intergenic
1162319580 19:9963173-9963195 GACCCAGAGCTCAATCCCACTGG - Intronic
1162440582 19:10689749-10689771 AACCCCCCACTCTTTCCCACTGG - Exonic
1162901803 19:13799698-13799720 AACCCACTGGCCCTTCCTACAGG + Exonic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1167265431 19:48480728-48480750 TCCCCACTTCTCTTTCCCACAGG + Intronic
926143517 2:10383017-10383039 AAACCACGCCTCATTCCCAGAGG - Intronic
929583586 2:43100319-43100341 ACCCCACTGCTCATCCCCCCAGG - Intergenic
930601499 2:53448869-53448891 AACTTACTGCACATTCACACGGG + Intergenic
931149962 2:59561813-59561835 AAACCTCTGCTCTTTCCCATGGG - Intergenic
934168772 2:89321568-89321590 AACCCCCTGCTCCTTTCCAGGGG + Intergenic
934198518 2:89861015-89861037 AACCCCCTGCTCCTTTCCAGGGG - Intergenic
935534141 2:104273697-104273719 AAGTCACTGCACATTTCCACAGG + Intergenic
938227692 2:129630136-129630158 AAACCACTGTTCATACTCACTGG - Intergenic
940780094 2:157924241-157924263 AACCACCTTCACATTCCCACTGG - Intronic
943816139 2:192258272-192258294 ACTCCACTGCTCCTCCCCACTGG + Intergenic
945505804 2:210638724-210638746 ATCCCACCGCTCAGTGCCACAGG + Intronic
947950949 2:234146792-234146814 AACTCACTGCTCATTCTCCCTGG - Intergenic
1168753615 20:300669-300691 AAACCACCTCTCTTTCCCACAGG - Intergenic
1178384271 21:32136815-32136837 AACCCAGTGATGCTTCCCACCGG - Intergenic
1179356136 21:40662049-40662071 CACCCAGTGCTGATGCCCACGGG - Intronic
1180009019 21:45037502-45037524 AGCCCACCACTCATTCCCCCTGG - Intergenic
1181466171 22:23111845-23111867 AGCCCACTGCCCACTGCCACCGG - Intronic
1182283451 22:29231163-29231185 AACCCACTGCTCATTCCCACAGG - Intronic
1183356421 22:37362177-37362199 AGCCCCCTGCTCTTCCCCACGGG - Intergenic
1183613561 22:38927447-38927469 ATCCCGCTGCTCATTCCCCGGGG - Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
951194095 3:19804442-19804464 AACTCCCTGCTCAGTCCCAGGGG - Intergenic
952984156 3:38762713-38762735 AACTCTCTGCCAATTCCCACTGG - Intronic
953043869 3:39278372-39278394 AGCCCATTTCTCATTCCCAGGGG + Intronic
955190143 3:56754121-56754143 AAACCACTTCTCAGCCCCACAGG + Intronic
959480356 3:106865098-106865120 ATCCCATTGCTCTTTGCCACAGG - Intergenic
959936539 3:112035329-112035351 AACCCAGTCCTCATTCCTGCAGG + Intronic
962733944 3:138307283-138307305 AGTCCACTGCTTAGTCCCACAGG + Intronic
965295679 3:166942910-166942932 CTCCAACTGATCATTCCCACTGG + Intergenic
968091501 3:195901020-195901042 GATACACTGCTCATTCCCTCAGG + Intronic
968992167 4:3921851-3921873 GTCCCACTGCTCATTTCCCCAGG + Intergenic
969823177 4:9735825-9735847 GTCCCACTGCTCATTTCCCCGGG - Intergenic
972356226 4:38281439-38281461 AACCCACAGCTCACTTTCACAGG - Intergenic
972838972 4:42908872-42908894 ACACCACTGCCAATTCCCACAGG - Intronic
975194665 4:71509796-71509818 AACCCATTGCTCAAACCCATGGG - Intronic
976661046 4:87540776-87540798 AACCCATTGCTCCTTCACAAGGG - Intergenic
984577026 4:181462699-181462721 AACTCACGTGTCATTCCCACTGG + Intergenic
985848995 5:2374821-2374843 AACCCCCTGCTCATCTCTACAGG + Intergenic
990361133 5:55021065-55021087 AACACATTGGTCTTTCCCACAGG - Intronic
992013125 5:72550544-72550566 GAACCACTGCTCACTCCCAGAGG - Intergenic
995765756 5:115616606-115616628 ACCCCCCTGCTCATTTTCACTGG + Intronic
995925412 5:117368148-117368170 AAACTACAGCTCAATCCCACTGG - Intergenic
996559857 5:124817148-124817170 AAACCTCCCCTCATTCCCACTGG + Intergenic
998059269 5:139106271-139106293 CAGCCACTTCTCCTTCCCACTGG + Intronic
999610834 5:153367773-153367795 AACACACTGGGCATTCCCAAAGG + Intergenic
1000393091 5:160745810-160745832 AACCCACAGCTCATGACCAAAGG + Intronic
1000905231 5:166958139-166958161 AAAGCACTGCTCATTCCTAAAGG + Intergenic
1003974605 6:11330429-11330451 TACCCCCTGGTCATTCTCACGGG - Intronic
1005905494 6:30259490-30259512 ATCCCACTTCTCACTCCCATTGG + Intergenic
1006002450 6:30976073-30976095 CACCAACCGCTCCTTCCCACAGG + Intergenic
1006020398 6:31114507-31114529 AAGCGACTCCTCTTTCCCACTGG + Intergenic
1019732165 7:2634361-2634383 CACCCACTGCCCATTCTCCCAGG - Intronic
1028187651 7:87806585-87806607 AACCAACTGATCATTGTCACAGG - Intronic
1028980615 7:96964046-96964068 AATCCAATGATCATTCCCAGAGG + Intergenic
1033036906 7:137883843-137883865 AACCCCATGCTCATTCCTATAGG + Intronic
1035200968 7:157265789-157265811 TACCCAGTTCCCATTCCCACTGG - Intronic
1039941762 8:42097638-42097660 AGCCCACTGCTCCTGCCCCCTGG + Intergenic
1041421995 8:57677471-57677493 ATTCCAATGCTCATTCCCCCAGG + Intergenic
1041694318 8:60719766-60719788 AACCAACTTCTCATCCCCACAGG + Intronic
1042362897 8:67902527-67902549 AACCTACAGTTCATTCCAACGGG - Intergenic
1042746919 8:72118668-72118690 GACCCACTGCTCTGACCCACAGG + Intergenic
1046273656 8:111928354-111928376 AAGCCTCTACTCATTCTCACAGG + Intergenic
1047703416 8:127473197-127473219 AACCCACTCCTTATTCCCAGAGG + Intergenic
1049415917 8:142495056-142495078 AAACCACTGTTGATTCTCACTGG - Intronic
1050599458 9:7235532-7235554 AACCAACTTCTCTTTCCAACAGG - Intergenic
1053784531 9:41644802-41644824 AACACACTGCAGAATCCCACAGG + Intergenic
1058850909 9:109012028-109012050 ATCCCAGTGCCCCTTCCCACTGG + Intronic
1060072935 9:120565907-120565929 AATCCACTGCAGATTCCCCCTGG + Intronic
1060806208 9:126578929-126578951 AACTGGCTGCTCAGTCCCACAGG - Intergenic
1061169564 9:128944401-128944423 AGCCCTCTGCTCTTTCCCTCAGG + Intronic
1185431278 X:13470-13492 GACCCCCTGCTCCTCCCCACGGG + Intergenic
1185431332 X:13629-13651 AACCCCCTGCTCCTCCCCACAGG + Intergenic
1185440622 X:226090-226112 AACCCCCTGCTCCTCCCCACAGG + Intergenic
1185721745 X:2388011-2388033 AAGCCACTGCTCATAGCTACAGG + Intronic
1187339712 X:18410220-18410242 AACACACTGCTGCCTCCCACAGG - Intergenic
1189289954 X:39877982-39878004 AAGCCAATCCTCATTCCCGCAGG + Intergenic
1194893877 X:99415369-99415391 AACCCACAGCTCAGTACCCCTGG + Intergenic
1195129097 X:101837345-101837367 CCCCCACTGCTCCCTCCCACTGG - Intronic
1195201031 X:102550216-102550238 CCCCCACTGCTCCTTCCCCCTGG + Intergenic
1197895050 X:131303822-131303844 AACACACTGGTGATTGCCACTGG + Intronic
1198660493 X:138963228-138963250 GACCCTCTGACCATTCCCACAGG + Intronic
1198731665 X:139737284-139737306 AAATAACTTCTCATTCCCACAGG + Intronic
1200235100 X:154464302-154464324 AACCCACTGACCATGCCCCCTGG - Exonic