ID: 1182284008

View in Genome Browser
Species Human (GRCh38)
Location 22:29233428-29233450
Sequence CTGGAGGCCCAGTGGGTCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 468}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182284008_1182284024 16 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284024 22:29233467-29233489 GGGTAAGTTGAGTCCAGGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 173
1182284008_1182284015 -5 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284015 22:29233446-29233468 TCCAGGCCCTCCAGGGCCCATGG 0: 1
1: 1
2: 12
3: 67
4: 497
1182284008_1182284022 11 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284022 22:29233462-29233484 CCCATGGGTAAGTTGAGTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 98
1182284008_1182284026 18 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284026 22:29233469-29233491 GTAAGTTGAGTCCAGGCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1182284008_1182284028 25 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284028 22:29233476-29233498 GAGTCCAGGCCAGGGGTAAAGGG 0: 1
1: 0
2: 1
3: 20
4: 201
1182284008_1182284017 -4 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284017 22:29233447-29233469 CCAGGCCCTCCAGGGCCCATGGG 0: 1
1: 0
2: 4
3: 42
4: 410
1182284008_1182284025 17 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284025 22:29233468-29233490 GGTAAGTTGAGTCCAGGCCAGGG 0: 1
1: 0
2: 2
3: 15
4: 146
1182284008_1182284027 24 Left 1182284008 22:29233428-29233450 CCAGGGACCCACTGGGCCTCCAG 0: 1
1: 0
2: 3
3: 49
4: 468
Right 1182284027 22:29233475-29233497 TGAGTCCAGGCCAGGGGTAAAGG 0: 1
1: 0
2: 4
3: 26
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182284008 Original CRISPR CTGGAGGCCCAGTGGGTCCC TGG (reversed) Exonic
900092011 1:924688-924710 CTCGAGGGCCAGCGGGTCCCTGG - Intergenic
900140159 1:1136471-1136493 GTGGAGGCCCTGTGGGTGCTGGG + Intergenic
900291009 1:1923598-1923620 CTGGGGGCCCCGTGGGGCCCTGG + Intronic
900391121 1:2434380-2434402 CCAGAGGCCCTGTGGGTGCCCGG - Intronic
900494852 1:2971781-2971803 CTGGAGCCCCAGGCCGTCCCTGG + Intergenic
900646866 1:3712978-3713000 CTGGGGGCCCTGAGGGTCACAGG - Intronic
901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG + Intronic
901660500 1:10795609-10795631 CTGGAGCCCGCCTGGGTCCCGGG - Intronic
901666977 1:10831647-10831669 CTGTGGGCCCAGTGGGCCCTGGG + Intergenic
901858151 1:12057364-12057386 CAGGAGCCCCAGTGTGGCCCAGG - Intergenic
901907662 1:12428270-12428292 GTGGAGGCGCAGTTGGTCCCTGG + Intronic
905695507 1:39970573-39970595 CTGGAGGCCTGTGGGGTCCCTGG + Intergenic
905880011 1:41457322-41457344 CAGGGGGCCCAGAGGGTTCCGGG + Intergenic
905883460 1:41479190-41479212 CTGGAGGCCGAGGGCTTCCCTGG + Exonic
906317879 1:44800018-44800040 CTGAAGTCCGAGTGGGGCCCGGG - Intergenic
906626181 1:47327731-47327753 GGGGAGGTCCAGTGTGTCCCAGG - Intergenic
907713391 1:56905306-56905328 ATGGAGGCCCAGTGGGATCATGG + Intronic
907780185 1:57559642-57559664 CAGTGGGTCCAGTGGGTCCCCGG + Intronic
907930037 1:58990657-58990679 CTGGAAGCCCAGCAAGTCCCTGG + Intergenic
908440347 1:64147485-64147507 CTGGAGGGCCAGTAGCTCCCAGG + Intronic
909649721 1:77960414-77960436 CTGGAGGCCCAGGAGGTCCATGG + Exonic
910312556 1:85841230-85841252 CTCGAGGCCCAGGTGGTCCTAGG + Exonic
910326714 1:86017159-86017181 CTGGAGGGCCAGATGGTCCTTGG + Exonic
911883407 1:103269268-103269290 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
911980289 1:104558401-104558423 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
912804234 1:112743268-112743290 AGGGAGGTACAGTGGGTCCCGGG + Intergenic
913103994 1:115595194-115595216 CCAGAGGCCCAGTGGCCCCCAGG + Intergenic
913644621 1:120844633-120844655 CTGAACGCCCGGTGGCTCCCGGG + Intergenic
914004106 1:143717638-143717660 CTGAATGCCCAGTGGGCTCCCGG + Intergenic
914082115 1:144418950-144418972 CTGAACGCCCGGTGGCTCCCGGG - Intergenic
914098990 1:144567881-144567903 CTGAACGCCCGGTGGCTCCCGGG + Intergenic
914177018 1:145287450-145287472 CTGAACGCCCGGTGGCTCCCGGG - Intergenic
914299995 1:146369785-146369807 CTGAACGCCCGGTGGCTCCCGGG - Intergenic
914531746 1:148528942-148528964 CTGAACGCCCGGTGGCTCCCGGG - Intergenic
914636644 1:149558787-149558809 CTGAACGCCCGGTGGCTCCCGGG + Intergenic
914748385 1:150515678-150515700 CAGGAGGCCCAGGCGGCCCCGGG - Intergenic
914987128 1:152470767-152470789 GTAGAGGCCCAGTGGGTGTCTGG + Intergenic
915300056 1:154946631-154946653 CTGGAGGCCGACTGTGTCCGGGG - Exonic
915941563 1:160121497-160121519 CTGGAGGCCCTCTGGGGCCTGGG - Intronic
916184003 1:162113341-162113363 CTGGCGGCCCAGTGGGGTCCTGG + Intronic
916285153 1:163098321-163098343 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
916868487 1:168887114-168887136 CTGGAGGGGCTGTGTGTCCCAGG - Intergenic
917537936 1:175888013-175888035 CTGGAGGTTCAGTGGGTCTGGGG - Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
918755886 1:188338981-188339003 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
920172666 1:204081550-204081572 CAGGAGGCCCCATGAGTCCCAGG - Intronic
920252180 1:204629103-204629125 CTTTAGCCCCAGTGGATCCCTGG + Intronic
920420332 1:205828839-205828861 CTGGAGGGCCAGTAGTTTCCGGG - Intronic
920564218 1:206960738-206960760 CTGGTGGCCCAATGGTTCCTAGG + Exonic
921330282 1:214028776-214028798 CTGGAGGGCCTGTTAGTCCCCGG + Intronic
922548277 1:226474698-226474720 CTGGAGGCTGACTGGGGCCCAGG - Intergenic
922738258 1:228001327-228001349 CTGTAGGCCCACTGTGTGCCCGG - Intergenic
922763852 1:228147765-228147787 CTGGGGACCCACAGGGTCCCTGG - Intronic
923772255 1:236947954-236947976 CAGGAGGCCCTGTGGGGCGCAGG + Intergenic
923804273 1:237241510-237241532 CAGGAGGCCAAGTGGGTTCTTGG + Intronic
924739973 1:246789265-246789287 CTGCAGGCCCAGCAGGCCCCTGG + Intergenic
1062768157 10:80828-80850 CTTGTGGCCCAGTGGGTCCTTGG - Intergenic
1062930073 10:1347089-1347111 GTGCAGGCCCAGAGGGGCCCAGG + Intronic
1062938264 10:1403703-1403725 CTGCAGGCCGAGTGGGTCCCAGG - Intronic
1063439581 10:6061934-6061956 CTGGGGTCCCCGTGGGTCACAGG + Intronic
1064007167 10:11707919-11707941 CTGGAGGGCCAGGGGGACCTGGG + Intergenic
1064545861 10:16449327-16449349 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
1065390406 10:25176072-25176094 CTGGAGACCGAGTGGTTCCACGG + Exonic
1067125711 10:43513756-43513778 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1068447040 10:57137407-57137429 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
1068560899 10:58513171-58513193 CTGGCGGCGCAGTCGGACCCCGG + Exonic
1070753657 10:78978264-78978286 CTGGAGGCTCAGTGGGGCACTGG - Intergenic
1070853308 10:79584834-79584856 CTGGAGACCCAATGCATCCCAGG - Intergenic
1070889309 10:79930300-79930322 CTGGTGGCCTGATGGGTCCCAGG - Intergenic
1071248639 10:83791909-83791931 CTGGAGGTCCAGTGGGATCGGGG + Intergenic
1071488867 10:86122549-86122571 CTGGAGCTCCACTGGGTGCCTGG + Intronic
1071559233 10:86632394-86632416 CTGGAGCCCGAGTGCGTCCCAGG + Intergenic
1071876916 10:89852371-89852393 CTGCCAGCCCAGTGGGTCCTAGG + Intergenic
1072687883 10:97549633-97549655 CTAGAGGTACAGTGGGTCCCAGG - Intronic
1073042174 10:100615184-100615206 ATGGAGGCCCAGGGGCTCCAGGG - Intergenic
1073510267 10:104038463-104038485 CCGGAGGCCCAGGGGGCCCAGGG + Exonic
1075090553 10:119441966-119441988 CAGCAGGGTCAGTGGGTCCCTGG - Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1075811273 10:125226872-125226894 CTCCTGGCCCAGTGGGTCCTGGG + Intergenic
1076010638 10:126985459-126985481 TGGTAGGCCCAGTGGATCCCTGG - Intronic
1076582360 10:131520264-131520286 CAGGAGTCCCAGAGGGTCCTTGG + Intergenic
1076606883 10:131695057-131695079 CAGGGTGTCCAGTGGGTCCCTGG + Intergenic
1076733010 10:132447509-132447531 GTGGGGGCGCAGTGGGGCCCTGG + Intronic
1076841783 10:133049481-133049503 ATGAAGGCCCAGTCAGTCCCTGG - Intergenic
1077329745 11:1978979-1979001 CTGGAGGACATGCGGGTCCCCGG - Intronic
1079358364 11:19749238-19749260 TTGAAGGCGCAGTGAGTCCCAGG - Intronic
1079394455 11:20049918-20049940 CTAGAGGCTCGGTTGGTCCCCGG - Intronic
1080727929 11:34916293-34916315 TTGGAGGCCGCGCGGGTCCCTGG - Exonic
1081608889 11:44546662-44546684 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1081667826 11:44926855-44926877 GTGGGGGCCCCTTGGGTCCCAGG - Intronic
1082767579 11:57181436-57181458 CTGGAGTCCAAGGGGGTCCCAGG - Intergenic
1083193544 11:61069340-61069362 CTGGAGACACACTGGGTACCTGG - Intergenic
1083706180 11:64518003-64518025 CTGCCGCCTCAGTGGGTCCCAGG + Intergenic
1083730521 11:64650143-64650165 TTGGAGGCCCAGGAGGTCCTTGG + Intronic
1084154049 11:67303958-67303980 CGGGAGGCCCCGTGGAGCCCCGG - Intronic
1084273996 11:68042718-68042740 CTGGATGCGCAGCAGGTCCCGGG - Exonic
1088191830 11:107235706-107235728 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1088407771 11:109499867-109499889 CAGTAGGTCCAGTGGGTTCCTGG - Intergenic
1088625555 11:111727783-111727805 CTGGAGTCACAGTTGGTCCCAGG + Exonic
1088705195 11:112455829-112455851 CTGGAGGTCCACTGGGCTCCAGG + Intergenic
1089002880 11:115067017-115067039 CTGGAGGAGCAGTGGGTGCCTGG - Intergenic
1090226440 11:125074803-125074825 CTGGGGCCCCAGTGGGGCCTTGG + Intronic
1090478343 11:127045565-127045587 CTCATGGCCCAGTGGGGCCCAGG + Intergenic
1091218293 11:133916850-133916872 GTGGAAGACCAGTGGGTCTCTGG + Intronic
1091348644 11:134874632-134874654 CTGTACGCCAAGTGGGTCCCAGG + Intergenic
1091357192 11:134946188-134946210 CTGCAAGCCCAGAGGGCCCCAGG + Intergenic
1202812723 11_KI270721v1_random:34158-34180 CTGGAGGACATGCGGGTCCCCGG - Intergenic
1091439360 12:500675-500697 ATGAAGGCCTGGTGGGTCCCGGG - Intronic
1091530654 12:1352015-1352037 CTGGAGGCCTAATGGATCCTTGG - Intronic
1091601282 12:1918981-1919003 CTTGAGGCCCGGGGAGTCCCAGG + Intergenic
1091922229 12:4314333-4314355 CTGGAGTCTCACTGTGTCCCAGG - Intergenic
1092534698 12:9376981-9377003 CTGGAGGCACCCTGGGTCCTCGG - Intergenic
1092922700 12:13246595-13246617 CCGCAGGCTCAGTGGGTCTCCGG - Intergenic
1094389036 12:29928948-29928970 CTGGAGGCAGAGTGGGCACCTGG - Intergenic
1095603769 12:44043701-44043723 CTAAAGTCCCAGTGGGCCCCTGG + Intronic
1095981258 12:47975998-47976020 CAGGAGGCCCAATGGGGCCAGGG + Exonic
1097564809 12:61253648-61253670 CAGAGGGTCCAGTGGGTCCCCGG - Intergenic
1098749689 12:74278308-74278330 CGGTGGGTCCAGTGGGTCCCTGG + Intergenic
1098832064 12:75375237-75375259 CAGTGGGGCCAGTGGGTCCCTGG - Intronic
1099183957 12:79497879-79497901 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1101830516 12:108253128-108253150 CTGGAGCCACAGTGAGCCCCAGG - Intergenic
1102217485 12:111171551-111171573 CTAGTGGCTCAGTGGGTCTCCGG + Intronic
1103035247 12:117651333-117651355 CTCAAGTCCCAGAGGGTCCCTGG + Intronic
1103396360 12:120610232-120610254 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1104313723 12:127677774-127677796 CTGCAGGCCCAGTGGGTGGCTGG + Intergenic
1104761453 12:131299568-131299590 TTGGAGGCCACGTGGGTCACAGG - Intergenic
1104818323 12:131661224-131661246 TTGGAGGCCACGTGGGTCACAGG + Intergenic
1104931043 12:132339637-132339659 CCACAGGCCCAGTGGGTCCCGGG - Intergenic
1105895728 13:24716070-24716092 CTAGAGGCCCAGTGACTTCCTGG + Intergenic
1106101843 13:26700384-26700406 CTCGAGGCCCCTTGGTTCCCAGG - Intergenic
1107555390 13:41513231-41513253 CTGGAGGCCCACTCCGTGCCAGG + Intergenic
1107898470 13:44989210-44989232 ATGGAGGCCCAGTCTCTCCCCGG - Exonic
1107983740 13:45757173-45757195 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1108329161 13:49367687-49367709 CTGGAGGCTCAGTTGAACCCAGG + Intronic
1108423697 13:50276713-50276735 CTGGAGGACAAAGGGGTCCCAGG - Intronic
1113533098 13:111043659-111043681 CTGGAGGACGCGTGTGTCCCTGG + Intergenic
1113828057 13:113272226-113272248 CTGAAGGCTCAGTGGGTGGCTGG - Intergenic
1114191912 14:20445962-20445984 CTCCAGGCCCAGTGGGACACTGG + Intergenic
1114758418 14:25285074-25285096 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1115784305 14:36806959-36806981 AGGGAGGTCCAGTGGGTACCAGG + Intronic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1119767245 14:77198012-77198034 TTGCAGGCCCAGTGGATCCAAGG - Intronic
1119926820 14:78502438-78502460 CTCGAGACCTAGTGGCTCCCAGG - Intronic
1121141149 14:91543597-91543619 GTGGAGGCCTAGTGGGTTGCTGG - Intergenic
1121312876 14:92944615-92944637 CTGGAGGGCCAGGGGGGCACAGG - Intronic
1121371220 14:93360084-93360106 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1121562942 14:94887782-94887804 CCGGAGGCCCCATAGGTCCCCGG + Intergenic
1121638300 14:95468422-95468444 CTGGAGGCTCAGCTGGGCCCTGG - Intronic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122137713 14:99644577-99644599 GGGGAGCCCCAGTGGGTCCTGGG + Intergenic
1122150324 14:99722071-99722093 GTGGAGGCCCTGGGGGTCCTGGG + Intronic
1122285659 14:100650796-100650818 CAGTAGGCCCAGTTGGTCCATGG - Intergenic
1122424351 14:101597028-101597050 CAGGAAGCCCAGGGGGTCACAGG + Intergenic
1122488071 14:102094967-102094989 CAGGAGCCCCAGAGGCTCCCGGG + Intronic
1122768163 14:104085545-104085567 CTGGGGGCGGGGTGGGTCCCGGG - Intergenic
1122797356 14:104212680-104212702 CTGGAGGCCCAGAGAGGACCCGG + Intergenic
1122919331 14:104873632-104873654 CTCGAGGCCCAGCGGGTCTGAGG + Intronic
1123035033 14:105468524-105468546 CTGGGGGCCAACTGGGGCCCTGG - Intronic
1123054039 14:105560870-105560892 CTGGGGTCCCAGGTGGTCCCGGG + Intergenic
1123078624 14:105681287-105681309 CTGGGGTCCCAGGTGGTCCCGGG + Intergenic
1124345655 15:28919829-28919851 CTGGAGGCCCCGTTTGTCCGTGG + Intronic
1125511761 15:40296025-40296047 CTGCAGGCTCTGTGGCTCCCAGG - Intronic
1127356743 15:58207978-58208000 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1127699270 15:61481245-61481267 CTGGAGGCTGAGAGGGGCCCAGG + Intergenic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128126488 15:65197067-65197089 GTTGTGGCCCAGTGGGTCCAAGG + Exonic
1128232844 15:66047719-66047741 CAGGAGGCCCAGTGGGCCTGGGG + Intronic
1128656055 15:69462809-69462831 CTGGAGGCCGAGTGTGGCCGAGG + Intergenic
1130334508 15:82947811-82947833 CTGGAGGCCTATTTGGTGCCAGG + Intronic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1132403924 15:101530896-101530918 CTGCAGGGCCACTGTGTCCCCGG + Intergenic
1132625643 16:890272-890294 CTGGAGCCCCAAGGGGCCCCCGG + Intronic
1132694619 16:1196333-1196355 CTGGAGGCCGAGCAGATCCCTGG + Intronic
1132814502 16:1819297-1819319 GAGGAGGCCCAGTAGGGCCCAGG - Intronic
1133247100 16:4456140-4456162 GTAGAGGCCCAGAGAGTCCCTGG + Exonic
1133333520 16:4991331-4991353 TTGGAGGCCCAGTTGAGCCCAGG + Intronic
1133879693 16:9769053-9769075 CTGGAGACCCTGTGGCTCACTGG - Exonic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1134017387 16:10898605-10898627 CTGAAGGCCCACTGTGTGCCAGG - Intronic
1134096859 16:11424055-11424077 CTCGGGGGCCAGTGGGTCCCAGG - Intronic
1134552091 16:15143117-15143139 CTGGGGGCCCCTTGTGTCCCGGG - Intergenic
1137802950 16:51277801-51277823 GTGGAAGCCTCGTGGGTCCCTGG + Intergenic
1138022483 16:53497220-53497242 CTGGAGCCCCCGTGTGTGCCAGG + Intronic
1138608308 16:58103163-58103185 CTGCAGGCCCCCTCGGTCCCCGG + Intergenic
1138868226 16:60849579-60849601 CAGCAGGTCCAGTGGGTCCCTGG + Intergenic
1141801200 16:86310585-86310607 GTGGAGGGCAAGTGGGGCCCTGG - Intergenic
1141868953 16:86771364-86771386 CTGGAGTCCCTGTGGGACACAGG + Intergenic
1142156274 16:88534118-88534140 CGGCCGGCCCAGGGGGTCCCGGG - Exonic
1142235211 16:88918797-88918819 CTGGAGGCCGTGTGGCTCCAAGG - Intronic
1142713161 17:1734254-1734276 CTGGAGGCCTGGTGGGGCGCAGG - Intronic
1143070581 17:4288945-4288967 CTGGAGGACCACTTGGGCCCAGG + Intronic
1144623015 17:16830383-16830405 GAGGACGCCCAGTGAGTCCCAGG - Intergenic
1144662602 17:17080923-17080945 CTGCAGGCCCTGTGGTTGCCTGG - Intronic
1144883415 17:18442333-18442355 GAGGACGCCCAGTGAGTCCCAGG + Intergenic
1145148815 17:20502053-20502075 GAGGACGCCCAGTGAGTCCCAGG - Intergenic
1145248367 17:21284403-21284425 CAGCGGGCTCAGTGGGTCCCGGG + Intergenic
1146057222 17:29587542-29587564 CTGGATGCCCAGTGGGCTCAGGG - Intronic
1146621474 17:34401845-34401867 CTGAGTGCCCAGTGGGTGCCAGG - Intergenic
1146653506 17:34621724-34621746 CTGGGGGCCCAGTGGAGCCAGGG + Intronic
1146836186 17:36112773-36112795 CTAAAGTCCCAGTGGGCCCCTGG + Intergenic
1146850610 17:36218626-36218648 CTAAAGTCCCAGTGGGCCCCTGG + Intronic
1146850775 17:36219823-36219845 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
1147419965 17:40317623-40317645 CTGCAGCTCCAGTGGGTCCTAGG - Intronic
1147577339 17:41610319-41610341 GAGGATGCCCAGTGAGTCCCAGG - Exonic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1147865427 17:43548921-43548943 CTGGAGGGCCCCTGGCTCCCTGG + Intronic
1148187430 17:45654820-45654842 ACAGAGACCCAGTGGGTCCCTGG - Intergenic
1148793827 17:50187875-50187897 CAGGAGGGCCAGGGGGACCCTGG + Exonic
1149684525 17:58527739-58527761 CTGGAGGCCCAGCCTTTCCCAGG - Intronic
1149866706 17:60155060-60155082 CTGGAGGGCCAGTGGCTGCTTGG + Intronic
1150208558 17:63428256-63428278 CTGGAGGCCCACTGCTTCCAGGG + Intergenic
1150235739 17:63591503-63591525 GTGGAGTCCCCCTGGGTCCCCGG - Exonic
1151200689 17:72465746-72465768 CGGGAGGCACAGTGGGTGACAGG - Intergenic
1151745081 17:76007608-76007630 CTGGAGGCCCAGGCGGCCACAGG - Exonic
1151869381 17:76826176-76826198 CTCGACCCCCAGTGGGTCCATGG - Intergenic
1151879274 17:76885439-76885461 CTGAAGGTCCAGTGGACCCCTGG + Intronic
1152336621 17:79702811-79702833 CTAGTGGGCCAGTGGGGCCCTGG + Intergenic
1152898631 17:82927751-82927773 CTGCAGGCCCCGTGACTCCCTGG + Intronic
1153176669 18:2382184-2382206 CTTGAAGCCCAGTGGGTTTCAGG - Intergenic
1153748619 18:8206952-8206974 CTGGTGGCCCAGATGTTCCCTGG - Intronic
1153967123 18:10192097-10192119 CTGGAAGCCCAGTGTGGCTCAGG + Intergenic
1155741917 18:29299203-29299225 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1156994194 18:43447070-43447092 CTGGAGTCCCAGAGGGTCAGGGG - Intergenic
1157489681 18:48114010-48114032 CTAGAGCACCAGTGGCTCCCAGG - Intronic
1157718828 18:49907878-49907900 CTGAAGGCCCAGTGGGTGCATGG - Intronic
1159518203 18:69485205-69485227 CTGGATTCCCAGTGGTTCCATGG + Intronic
1160073160 18:75645799-75645821 CTGGAGGGCGAGTGGGTGCTGGG + Intergenic
1160262851 18:77311429-77311451 CTGGAGCCACAGAGGCTCCCAGG + Intergenic
1160349748 18:78166679-78166701 CTGGGGCCCCGGGGGGTCCCTGG - Intergenic
1160595324 18:79969462-79969484 CTGGAGGTTCAGAGGATCCCTGG - Intronic
1160760347 19:781075-781097 CTGGCCGCCCTGTGGGGCCCCGG + Intergenic
1160803776 19:982621-982643 CTGGAGGCACAGCAGGTCCTTGG + Intergenic
1160886386 19:1350929-1350951 CTGGAGACCCAGGGGCTCCACGG - Intergenic
1161424727 19:4196904-4196926 CCGGAGGAGCCGTGGGTCCCAGG + Intronic
1161592159 19:5133758-5133780 CTGGCTGCCCACAGGGTCCCTGG - Intronic
1161769423 19:6223266-6223288 CTGAGCGCCCACTGGGTCCCTGG + Intronic
1162183627 19:8888043-8888065 CTGGAGTCCCAGATGTTCCCAGG + Exonic
1162985555 19:14267105-14267127 GTGGATGCCCAGGGGGTCTCTGG + Intergenic
1163292086 19:16385485-16385507 ATTGAGACCCAGTGGGACCCAGG - Intronic
1163597874 19:18231020-18231042 CTGGGGACCCAGTGTGTACCAGG + Intronic
1163795498 19:19335505-19335527 ATAGAGCCCCAGTGGGTGCCTGG - Intronic
1163849829 19:19656582-19656604 GTGGAGGCCCAGGGGGTGGCGGG - Intronic
1164983292 19:32630246-32630268 CTGGAGCCAGAGTGGGTCCTGGG - Intronic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1165861456 19:38911533-38911555 GTGGAGGGCAAGTGGGGCCCGGG + Intronic
1166002477 19:39886010-39886032 CTGGAGGCCACGTGGAGCCCTGG - Exonic
1166005262 19:39902262-39902284 CTGGAGGCCACGTGGAGCCCTGG - Exonic
1166344369 19:42156214-42156236 TTCGGGGACCAGTGGGTCCCTGG - Intronic
1167118760 19:47503816-47503838 CTAGGGGCCCACTGGGTCCCAGG + Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1168166557 19:54552227-54552249 CAGGATGTCCAGGGGGTCCCTGG - Intergenic
926106548 2:10155713-10155735 GTGGAGGGCCAGTGTCTCCCAGG - Intronic
927200353 2:20574553-20574575 CTGGAGGGCCAGGGGATCACTGG + Intronic
929667491 2:43844493-43844515 CTGGAGGCCCTGTGGGAGACAGG - Exonic
932163728 2:69486611-69486633 CTGGAGGCCAACTGAGTCACTGG - Intronic
932298590 2:70646821-70646843 CTGGACACCCTGTGAGTCCCTGG - Intronic
932672689 2:73752133-73752155 CTAAGGGACCAGTGGGTCCCAGG - Intergenic
933775911 2:85771043-85771065 GTGGAGGCTCAGTGGCTCTCGGG + Intronic
934518983 2:95007443-95007465 CTGGAGCCCAAGTGGGTCATGGG - Intergenic
935183770 2:100713561-100713583 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
935217835 2:100988748-100988770 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217866 2:100988840-100988862 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935217921 2:100988988-100989010 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
936020692 2:108992821-108992843 CTCGTGGCACAGTGGCTCCCAGG + Intergenic
936059698 2:109286398-109286420 CTGGAGGCCCAGAGGGGCAAAGG + Intronic
936255186 2:110905002-110905024 CTGGAGGGACAGGGGCTCCCAGG - Intronic
937259638 2:120577172-120577194 CTGGGGGTCCCGGGGGTCCCTGG - Intergenic
937785507 2:125890106-125890128 CTAAAGTCCCAGTGGGCCCCTGG - Intergenic
937800178 2:126073534-126073556 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
937852725 2:126649935-126649957 CGGTGGGCCCAGTGGGTCCCCGG - Intergenic
938091792 2:128439378-128439400 CTGCAGGGCCTGTGGGTTCCAGG + Intergenic
939696786 2:145335698-145335720 CTGGAGGCCGTGTGGGTGCTAGG + Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
943517755 2:188908445-188908467 CAGTGGGCCCATTGGGTCCCCGG - Intergenic
944689958 2:202149717-202149739 CTGGTGGCTCTGTGGGACCCAGG + Intronic
945544718 2:211136968-211136990 CAGTAGGTCCAGTGGGTCCCTGG + Intergenic
946001570 2:216486769-216486791 CAGGAGACCCAGTGGTGCCCTGG + Intergenic
946528175 2:220542364-220542386 CTAAAGTCCCAGTGGGCCCCTGG - Intergenic
947151504 2:227121076-227121098 CTGAAAGCCCAATGGGTCCTGGG + Exonic
947360471 2:229340649-229340671 CTGGAGGGCCAGTGGGACAGGGG + Intergenic
947462324 2:230314190-230314212 CTGTAGGCCCAGTGAGTTCAGGG - Intergenic
948247928 2:236502111-236502133 CTGAAGGTCCATTGGGTCACTGG - Intronic
948622305 2:239244052-239244074 CTGGAGTCCCAGTGAGGCCCTGG - Intronic
948668904 2:239553836-239553858 CTGGAGGTGCAGAGGGGCCCGGG - Intergenic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1170038694 20:12017717-12017739 CTGGAGGCCAAGCAGGTGCCTGG + Intergenic
1170645435 20:18193105-18193127 CTGGAGGCCCTGGGAGGCCCAGG + Intergenic
1171515183 20:25725889-25725911 CAGGAGGCCCAGTGATACCCAGG - Intergenic
1172180548 20:33000939-33000961 TTGCTGGCCCAATGGGTCCCTGG + Intronic
1172447760 20:35002063-35002085 CTTGGGGCCCAGGGCGTCCCGGG - Exonic
1173222598 20:41141840-41141862 CTGGAGGTGTTGTGGGTCCCAGG - Intronic
1174153100 20:48499987-48500009 CTGGAGACCCAGGGGGTAGCCGG - Intergenic
1174168939 20:48604438-48604460 CTGGAGGCCCTGTAGGGCTCTGG + Intergenic
1175264854 20:57696302-57696324 CTGGAGCCCCAGGGGCGCCCAGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175899329 20:62353841-62353863 CTGGGGGCTCAGTGGGCCCCTGG - Intronic
1176124853 20:63470867-63470889 CTGGAAGCCCTGTGGCCCCCAGG - Intronic
1176545257 21:8194086-8194108 ATGGAGGCCCATGGGGTCGCCGG - Intergenic
1176564208 21:8377131-8377153 ATGGAGGCCCATGGGGTCGCCGG - Intergenic
1177505734 21:22015423-22015445 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1179351728 21:40617521-40617543 CTGGAGATCCACTGGCTCCCAGG + Intronic
1179639098 21:42735506-42735528 CTGGAGGCTCTGAGGGGCCCTGG + Intronic
1180009422 21:45040032-45040054 CTGGGGGCCTGGGGGGTCCCTGG + Intergenic
1180057605 21:45367001-45367023 CTGGAGGGTCAGTGGGGCCTGGG + Intergenic
1180079435 21:45480099-45480121 CTGGAGGCCCTTGGGGTCCTGGG - Exonic
1180079903 21:45481959-45481981 CCGGAGGGCCTGGGGGTCCCTGG - Exonic
1180080845 21:45486947-45486969 CTGGGGGCCCAGGGGGCCCAGGG - Exonic
1180784323 22:18538502-18538524 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1181091111 22:20473189-20473211 CTGGAGGCCAAGGGTGACCCTGG + Intronic
1181127898 22:20712555-20712577 CTGGCGGCCCAGCTGGTCCCGGG + Exonic
1181164161 22:20974511-20974533 CTGTAGGGCCTGTGGGTGCCAGG - Exonic
1181241226 22:21477859-21477881 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1182064018 22:27417688-27417710 CTGGAGGCCCGCTGGGCTCCAGG + Intergenic
1182108256 22:27704563-27704585 CTGGGGGCCCTGCGGCTCCCAGG - Intergenic
1182284008 22:29233428-29233450 CTGGAGGCCCAGTGGGTCCCTGG - Exonic
1182293320 22:29298736-29298758 CAGGAGGCCCAGGAGGTCCTGGG + Exonic
1182615895 22:31590008-31590030 CTCGAGGCCCCTTGGTTCCCAGG - Intronic
1183458576 22:37936138-37936160 CTAGGGCCCCAGTGGGCCCCTGG + Intronic
1183461563 22:37953983-37954005 CTGGAGGCACAGGAGGGCCCAGG + Intronic
1183543236 22:38441754-38441776 CTGGAGTCCCAGGAGGGCCCAGG - Intronic
1183573464 22:38671671-38671693 CTCTAGGCCCAGTGGGTTGCTGG - Intronic
1183617569 22:38954766-38954788 CTGGGAGCCCTGTGGGTCCAGGG + Intronic
1184168373 22:42743806-42743828 CTGGAGGCCGGGTGGGGCCCTGG + Intergenic
1184172677 22:42769065-42769087 CTGCAGGCCCACTGTGTGCCGGG + Intergenic
1184583855 22:45434643-45434665 CAAGAGGCCCAGTGGGAGCCTGG - Intergenic
1184603727 22:45559603-45559625 CAGTGGGTCCAGTGGGTCCCCGG - Intronic
1185069309 22:48647553-48647575 CCCAAGGCCCAGTGTGTCCCGGG + Intronic
1185145563 22:49133763-49133785 CTGGAGGACCCCTGGGGCCCTGG - Intergenic
1185295168 22:50049584-50049606 CTGGAGGCCCAGGTGTCCCCAGG + Intronic
1203250127 22_KI270733v1_random:110324-110346 ATGGAGGCCCATGGGGTCGCCGG - Intergenic
951970918 3:28443077-28443099 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
954053961 3:48006458-48006480 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
954133412 3:48571118-48571140 CAGGAGGCCCAGGGGAGCCCGGG + Exonic
954134738 3:48576708-48576730 CTGGAGGCCCCTGGGGTCCAAGG + Exonic
954798618 3:53174403-53174425 CTGCAGGGCCAGGGGGTGCCGGG - Intronic
955035273 3:55261690-55261712 CTAAAGTCCCAGTGGGCCCCTGG + Intergenic
957247687 3:77734537-77734559 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
957948083 3:87089563-87089585 CTGCAGGATCAGTGGGTCCTAGG - Intergenic
959377501 3:105604052-105604074 CCGTAGGTCCAGTTGGTCCCTGG - Intergenic
959869157 3:111306745-111306767 CTTGTGGCCAAGGGGGTCCCAGG + Intronic
960057527 3:113285737-113285759 CTGAAGGCCCAGTAGGTCTGTGG + Intronic
960447916 3:117770401-117770423 AGGGAGGCCTAGTAGGTCCCAGG + Intergenic
961380096 3:126491478-126491500 CTGGAAGCCCAGGTGTTCCCGGG - Intronic
961468625 3:127097349-127097371 CTGGAGGACCAGGGGGTTGCAGG - Intergenic
961627843 3:128275967-128275989 CTCGAGACCCTGTGGGCCCCTGG - Intronic
961649157 3:128408830-128408852 CTGAAGGCCCAGAGCGCCCCAGG - Intergenic
962670977 3:137708390-137708412 ATGGAGGCCCACAGAGTCCCAGG + Intergenic
963355824 3:144208051-144208073 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
963630157 3:147722016-147722038 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
964977363 3:162636991-162637013 CAGTAGGTCCAGTGGATCCCTGG - Intergenic
966850166 3:184159867-184159889 CTGAGGGCCCAGTGGGTTTCAGG - Intronic
967550304 3:190786093-190786115 CTGAAGGTACAGTGTGTCCCAGG - Intergenic
967887189 3:194341338-194341360 CTGGAAGCCCAAGTGGTCCCGGG + Exonic
967891037 3:194364847-194364869 TTGGAGGCCCTGTGGAGCCCTGG - Intronic
968467941 4:762356-762378 CTGGTGGCCCAGGGGCTCCCTGG - Intronic
968489690 4:883328-883350 CTGGAGGGCCGGTAGGTCCTCGG + Exonic
968519041 4:1027489-1027511 CGTGAGGCCCACTGCGTCCCCGG + Intergenic
968632477 4:1659196-1659218 CTGGAGGTCGTGTGGTTCCCGGG - Intronic
968906769 4:3456751-3456773 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
969311646 4:6356422-6356444 CTGGAGCCCAACTGAGTCCCAGG - Intronic
969347484 4:6578521-6578543 CTGGAGGTCCTGAGGGACCCTGG - Intronic
969429772 4:7147385-7147407 CTGGAAGCTCAGTGGGTGCAGGG + Intergenic
969520873 4:7677201-7677223 CGGGAGGCCGAGGGGGACCCAGG - Intronic
969648862 4:8451155-8451177 CTGAAGCACCTGTGGGTCCCCGG + Intronic
970089341 4:12387558-12387580 CAGTGGGCCCAGTGGGTCCCTGG - Intergenic
971979445 4:33734071-33734093 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
972201459 4:36718369-36718391 CAGTAGGCCCAGTGATTCCCTGG - Intergenic
975646365 4:76549911-76549933 GTGGAGTCCCAGTAGGTCCAAGG - Intronic
976034344 4:80796973-80796995 CAGTAGGTCCAGTGGGTCCCTGG - Intronic
977022723 4:91776405-91776427 CTGGAGGCCACGTGGATTCCTGG + Intergenic
977430604 4:96927012-96927034 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
977465836 4:97382178-97382200 CAGTGGGTCCAGTGGGTCCCCGG + Intronic
977490241 4:97701280-97701302 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
979438881 4:120727540-120727562 CTTGAGGCCCACTGAGTGCCTGG - Intronic
979766856 4:124473377-124473399 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
980602005 4:135038263-135038285 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
981234754 4:142402123-142402145 CAGGTGGACCAGTGGGTTCCAGG - Intronic
981487460 4:145302207-145302229 CTGGGGCTCCACTGGGTCCCTGG - Intergenic
981727362 4:147861930-147861952 CTGGCAGCCCAGCGGCTCCCAGG + Intronic
983537850 4:168877719-168877741 CTGGAGCTTCAGAGGGTCCCTGG - Intronic
985553193 5:543514-543536 CTGAGGGCTCAGTGGGCCCCAGG + Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
985614760 5:913014-913036 GGGCAGGCCCAGTGGGTCCATGG - Intronic
985626926 5:993913-993935 CTGCAGGGCCAGTGGGTCAGCGG + Intergenic
986037197 5:3951649-3951671 CAGTAGGTCCAATGGGTCCCTGG - Intergenic
986086959 5:4461501-4461523 CTGTGGGTCCAGTGGGTTCCTGG + Intergenic
986372528 5:7094058-7094080 GTGGGGTCCCAGTGGGACCCAGG - Intergenic
987578501 5:19759529-19759551 CAGTGGGCCCAGTGGGTCCCTGG - Intronic
987957607 5:24761583-24761605 CAGGAGGTCCAGTGTTTCCCAGG - Intergenic
988107455 5:26770084-26770106 CTGAAGTCCTAGTGGGCCCCTGG + Intergenic
988233437 5:28508288-28508310 CAGTAGGTTCAGTGGGTCCCTGG - Intergenic
989097670 5:37796122-37796144 CAGCGGGTCCAGTGGGTCCCTGG + Intergenic
991013976 5:61912119-61912141 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
991606718 5:68409541-68409563 ATGGATGCCAAGTGGGTCCAAGG - Intergenic
992242713 5:74788227-74788249 CAGTCGGTCCAGTGGGTCCCCGG + Intronic
992660881 5:78959374-78959396 CTGGAGGGCCAGTGGAACTCAGG + Intronic
994471329 5:100211770-100211792 CTGTAGGCCCAGTGGGTACAGGG - Intergenic
996702703 5:126465930-126465952 CTGGTGGCCTGGTGGGTCCCCGG - Intronic
998146434 5:139731708-139731730 CTGAAGGCCCAGCTGCTCCCAGG - Intergenic
999351227 5:150873641-150873663 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1002197693 5:177510099-177510121 ATGGAGGCCCAGTGGGGCAGTGG - Intronic
1002211431 5:177601762-177601784 TTGCAGTCCCAGTGGCTCCCAGG - Intronic
1002471472 5:179438477-179438499 CTGGGGGTCCTGGGGGTCCCAGG - Intergenic
1003696064 6:8407355-8407377 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1005126399 6:22451228-22451250 CTAGAAGCCCAGTGGATGCCAGG - Intergenic
1006140894 6:31928970-31928992 CTGGATGCACATTGGGCCCCAGG - Intronic
1006295990 6:33170361-33170383 CTGGGGGGCCAGGTGGTCCCTGG + Exonic
1006434319 6:34018432-34018454 CTGGAAGTTAAGTGGGTCCCAGG + Intergenic
1006436509 6:34028439-34028461 CGGGATGCCGGGTGGGTCCCTGG - Intronic
1006577949 6:35059661-35059683 CTGGAGCCCCTGTGGGGCCGTGG - Intronic
1006727990 6:36213908-36213930 GTGCAGGCCCAGTGGGCTCCAGG - Exonic
1006839769 6:37021397-37021419 CTGAAAGCCCACTGGGTACCAGG - Intronic
1007340223 6:41186519-41186541 CTGAAGACCCATTGGCTCCCAGG + Intergenic
1007485162 6:42175821-42175843 CTGGGGGCAGAGAGGGTCCCAGG - Intronic
1009934389 6:70216968-70216990 CGGGAAGCCCAGGAGGTCCCGGG + Exonic
1010108160 6:72192130-72192152 CAGTGGGTCCAGTGGGTCCCCGG - Intronic
1012260913 6:97086438-97086460 CTGAAGGCCTTCTGGGTCCCAGG + Intronic
1012508663 6:99977664-99977686 CTAGAGGTCCTGTGGGTCCTGGG + Intronic
1016714196 6:147204479-147204501 GGGGAGGCACAGGGGGTCCCCGG - Intronic
1018306939 6:162467772-162467794 CTGGAGGACAAGTGGGAGCCAGG - Intronic
1018954692 6:168401003-168401025 CTGGAGACCCAGGAGATCCCAGG + Intergenic
1019380037 7:716487-716509 CTGGAGGGCCCGGGGCTCCCAGG + Intronic
1019424025 7:964725-964747 CTGGAGGCCCAGAGCCCCCCAGG - Intronic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1021202343 7:17741148-17741170 CTGGAGGACCAGAGGGGCCAGGG - Intergenic
1022078729 7:26999110-26999132 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1022643108 7:32206540-32206562 CAGGAGCCACAGTGGGTTCCAGG + Intronic
1023722360 7:43110073-43110095 CTCGAGGCCCAGGAGGACCCAGG - Intergenic
1023834832 7:44062025-44062047 CCGGATGCTCAGTGGGTGCCAGG - Intronic
1024192300 7:47024897-47024919 TTGGATGCCCAGTGGGCTCCAGG + Intergenic
1026848209 7:73709290-73709312 CTGGAGGACCACTGGGGGCCCGG + Intronic
1026894253 7:74000821-74000843 CTGGAGGGACTGTGGGTCCCCGG + Intergenic
1026966899 7:74445983-74446005 CTCCTGGCCCAGTGGGTCTCTGG + Intergenic
1027265104 7:76490447-76490469 CTGGAAGCAAAGTGGGACCCTGG - Intronic
1027316475 7:76988550-76988572 CTGGAAGCAAAGTGGGACCCTGG - Intergenic
1028063505 7:86351231-86351253 CTGAAAGGCCAGTGGGTTCCTGG - Intergenic
1028398855 7:90403350-90403372 CTGGCGGCCCAGTGGATTCTGGG + Intronic
1029597876 7:101547217-101547239 CTGGTGGACCAGGGGGACCCCGG - Exonic
1030084979 7:105808142-105808164 CTGCAGGCCCTGTGTGTCCTGGG - Intronic
1031474608 7:122206552-122206574 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1032027828 7:128457374-128457396 CTGGTGGTCCAGGAGGTCCCAGG - Exonic
1032174179 7:129610768-129610790 CTGGATACCAACTGGGTCCCAGG + Intergenic
1032425141 7:131816537-131816559 CTGGAGGCCTAATTGGTGCCAGG - Intergenic
1032779813 7:135156243-135156265 CAGGAGGCCCAGTGATCCCCAGG - Intronic
1033543774 7:142381375-142381397 TTGGAAGCCCAATGGGTGCCGGG + Intergenic
1033659693 7:143394989-143395011 CGGGAGGACCAGCTGGTCCCTGG - Exonic
1034264901 7:149776145-149776167 CTGATGCCCCAGAGGGTCCCTGG - Intergenic
1034459764 7:151191903-151191925 CTGGAGGGGCAGTGGGCACCAGG + Intronic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035568611 8:658311-658333 CGGGAGGCCCAGTGGAGGCCAGG - Intronic
1035575044 8:699011-699033 CGGGAGGCTCAGTGGAGCCCAGG + Intronic
1035765366 8:2100783-2100805 CCAGAGGAGCAGTGGGTCCCCGG + Intronic
1036556338 8:9863448-9863470 CTGGAGCCGCAGTGGCTTCCAGG + Intergenic
1037677396 8:21063563-21063585 CTGGAGTCCCTGTTAGTCCCTGG + Intergenic
1038316046 8:26485237-26485259 GTGGAGCCCCTGTGGTTCCCAGG + Intronic
1038674982 8:29615281-29615303 CTGGAATCCCATTAGGTCCCAGG - Intergenic
1039954255 8:42195146-42195168 CTGGAGGCACAGGGGCTTCCAGG + Intronic
1040372214 8:46788215-46788237 CTGTAGCCAGAGTGGGTCCCTGG + Intergenic
1041107885 8:54459274-54459296 CTGGAGGCCCAGGCCGTCCATGG - Exonic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1041476869 8:58277058-58277080 CTGGAGGCCTACTGGGGCCCAGG + Intergenic
1041600890 8:59716385-59716407 CAGGAGGTCCTGGGGGTCCCAGG + Intergenic
1042001219 8:64125197-64125219 CAGTAGACCCAGTGGGTCCCTGG - Intergenic
1042360510 8:67877536-67877558 CTGCGGTCCCAGTGGGTCTCTGG + Intergenic
1044368367 8:91377419-91377441 GCAGAGGACCAGTGGGTCCCAGG - Intronic
1044487310 8:92768339-92768361 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1044633583 8:94300996-94301018 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1045430347 8:102108015-102108037 CTGGCGGCCAAGTGGGGACCAGG - Intronic
1048846306 8:138606380-138606402 CCGGAGGCCCACGGGGACCCAGG + Exonic
1048856515 8:138690829-138690851 CTGGAGGGCCACTGGGACCGGGG + Exonic
1048943856 8:139426682-139426704 CCGGAGGCCCTGTGGGCTCCAGG - Intergenic
1049540726 8:143207673-143207695 AGGGAGACACAGTGGGTCCCGGG - Intergenic
1049671126 8:143870342-143870364 CTGGAGGCCCAGGCGGCCACCGG - Exonic
1051226689 9:14906848-14906870 CTTGAGGCTCAGTCGCTCCCTGG + Intronic
1052368487 9:27639617-27639639 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
1053390400 9:37731042-37731064 CAGGAGGTCCAGGGGGTCCTTGG - Exonic
1055303463 9:74905400-74905422 CTGGAGGCCCAGTGGTACTGAGG + Intergenic
1056460841 9:86808355-86808377 CAGAAAGCTCAGTGGGTCCCTGG - Intergenic
1056796054 9:89659697-89659719 CTGGATCTCCAGTGAGTCCCGGG + Intergenic
1057258352 9:93568705-93568727 TTGGATGCCCAGTGGGCTCCAGG + Intergenic
1058019731 9:100074861-100074883 CAGAGGGTCCAGTGGGTCCCCGG + Intronic
1058544334 9:106043965-106043987 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1058644353 9:107116798-107116820 TTGGAGGCCGTGTGGGTCCCTGG + Intergenic
1059434205 9:114266579-114266601 CTGGAGGCCCAATTGGCCCCTGG - Exonic
1059436898 9:114282507-114282529 CTGGAGTGCCAGGGGGTCCAGGG - Exonic
1060596926 9:124854046-124854068 GAGAGGGCCCAGTGGGTCCCGGG + Intronic
1060786336 9:126454271-126454293 GTGGAGGCACGGTGGGACCCTGG - Intronic
1060944075 9:127559726-127559748 CTGGATGCCCAGTTACTCCCTGG + Intronic
1061322600 9:129840402-129840424 CTGGAGGCTCAGTGGGTGCTGGG + Intronic
1061791363 9:133060935-133060957 CTGCAGGTCCACTCGGTCCCTGG + Intergenic
1061795041 9:133081502-133081524 CTGCAGGTCCACTCGGTCCCTGG + Intronic
1061925031 9:133801822-133801844 CTGGAGGCCCCGGGTGTTCCTGG - Intronic
1062076871 9:134594443-134594465 CTGGGGGCAGAGTGGGGCCCTGG - Intergenic
1062113792 9:134796844-134796866 CTTGGGGTCCATTGGGTCCCTGG - Exonic
1062115535 9:134806257-134806279 CTGCCGGCCCTGGGGGTCCCTGG - Exonic
1062365217 9:136205116-136205138 CGCCAGGCCCAGTGGCTCCCGGG - Intergenic
1062380588 9:136284927-136284949 CTGCAGCCCCAGTGAGCCCCAGG - Intronic
1062436951 9:136550603-136550625 CAGGAGGCCCAGTGCCTGCCCGG - Intergenic
1062446327 9:136596904-136596926 CTGGGGGCCCACTGGGACCTGGG - Intergenic
1062468387 9:136691556-136691578 ACGGAGGCCCAGAGGGTGCCTGG + Intergenic
1062722698 9:138052806-138052828 TCGGAGGCCCACTGGGTCCAGGG + Intronic
1062724735 9:138065478-138065500 CTGCAGGCCCAGGCAGTCCCGGG + Intronic
1203466528 Un_GL000220v1:93591-93613 ATGGAGGCCCATGGGGTCGCCGG - Intergenic
1185475138 X:410678-410700 CTGGTGGCCAGGTGGATCCCAGG + Intergenic
1186795588 X:13044237-13044259 CTGGACGCCCAGGGGACCCCTGG + Intronic
1190325700 X:49205656-49205678 CTGGGGTCCGAGTGGGTTCCAGG + Exonic
1190568413 X:51755475-51755497 CCGGAGGTCCAGTTTGTCCCAGG - Intergenic
1191226582 X:58050471-58050493 AAGTAGGTCCAGTGGGTCCCCGG + Intergenic
1194849408 X:98853387-98853409 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1195797504 X:108667152-108667174 CTGGAAGTCCAGGGGGTCCTGGG - Exonic
1195809816 X:108817036-108817058 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1196789614 X:119452087-119452109 GTGAAGGCCCAGGGGGTCCTGGG + Exonic
1197100970 X:122654705-122654727 CTGGATGACCAGTGGGTCAATGG + Intergenic
1197380497 X:125732480-125732502 CACGGGGCCCAGTGGGTCCCTGG - Intergenic
1198242768 X:134801502-134801524 CTGGAGGGCCAAAGGGTCCCTGG - Intronic
1199846190 X:151694645-151694667 CTGAGGGCCCTGTGGATCCCTGG + Intergenic