ID: 1182284194

View in Genome Browser
Species Human (GRCh38)
Location 22:29234327-29234349
Sequence CCGCTGCCCAGCAGAGCCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182284194_1182284198 15 Left 1182284194 22:29234327-29234349 CCCAAGGCTCTGCTGGGCAGCGG 0: 1
1: 0
2: 6
3: 42
4: 276
Right 1182284198 22:29234365-29234387 TGTCCCGCATTCATCCCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182284194 Original CRISPR CCGCTGCCCAGCAGAGCCTT GGG (reversed) Exonic
900913536 1:5618866-5618888 CCCCTCCCCATCAGGGCCTTTGG - Intergenic
901058766 1:6461993-6462015 CAGTTGCCCAGCAGAGCTCTTGG - Exonic
902431699 1:16367931-16367953 GAGCTGCCCCGCAGAGCTTTCGG - Intronic
902703928 1:18191547-18191569 CCCCTGCCCAGCAGACCGTATGG - Intronic
903213587 1:21831471-21831493 CCGCTGCTCAGCCCCGCCTTGGG + Exonic
904279006 1:29405331-29405353 CCGCTGCCCTGCACAGCCTCAGG + Intergenic
905936380 1:41827497-41827519 CCCCTCCCCAGCAGTGCCTCAGG - Intronic
906691261 1:47794265-47794287 CCACTGCCCAGCCCAGCCTCAGG - Intronic
907340546 1:53732312-53732334 CCCCTACCCAGCCCAGCCTTCGG + Intronic
908720450 1:67119959-67119981 CCCCTGCCCAGTGGAGCCATGGG + Intronic
909741651 1:79037027-79037049 CCACTGCCCTGCACAACCTTGGG + Intergenic
912615693 1:111097500-111097522 CTGCTGCCCTGCACAGCCTCAGG - Intergenic
914905088 1:151737440-151737462 CTGCTGCCCTGCGTAGCCTTGGG + Intergenic
915543490 1:156583036-156583058 CCGCTGCCCCACAGAGCCTGAGG - Exonic
917485900 1:175454421-175454443 CTGCAGTCCAGCAGAGCCCTCGG + Intronic
917734623 1:177909141-177909163 ACACTGCCCAGCAGAGCACTTGG + Intergenic
918323088 1:183383241-183383263 CTGCTGCCCTGCACAGCCTCAGG - Intronic
919790672 1:201288865-201288887 ACGCGTCCCAGCAGAGCCTGAGG + Intronic
919812494 1:201417860-201417882 CCCCTGCCCAGCTGGGCCTTGGG + Intronic
920777984 1:208959049-208959071 CCACTGACCTGCACAGCCTTGGG + Intergenic
920891043 1:209985926-209985948 CTGCTGCCCTGCACAGCCTTGGG - Intronic
921128007 1:212195343-212195365 CCACTGCCCTGCATGGCCTTGGG + Intergenic
922069241 1:222174693-222174715 CCGCTGCCCTGCACAGCCTTGGG - Intergenic
922517870 1:226222235-226222257 CAGCTGCCCAGAAGGGCCTCAGG + Intergenic
923511239 1:234655657-234655679 CCCCTGACCAGCAGAGTCCTGGG + Intergenic
924599367 1:245474789-245474811 CCGCTGCCCATCCCAGCCTCTGG + Intronic
924822320 1:247505163-247505185 CAGTGGCCCAGCAGGGCCTTGGG + Intergenic
1062881356 10:980658-980680 CCATTGCCCTGCACAGCCTTGGG - Intergenic
1062995300 10:1860313-1860335 CCCCTGCCCAGCAGAACATGTGG + Intergenic
1064172878 10:13049741-13049763 AGGCTGCCCAGAAGAGCCCTGGG + Intronic
1064672599 10:17731834-17731856 CCACTGCCCAGGAGAGGCCTTGG + Intergenic
1065941012 10:30563958-30563980 AGGCTGCCCAGCAGAGCATGCGG - Intergenic
1067850108 10:49749340-49749362 TGTTTGCCCAGCAGAGCCTTGGG - Intronic
1069689765 10:70342598-70342620 CAGCTGCCTAGCAGAGCTGTTGG + Intronic
1071240718 10:83701758-83701780 CCACTGACCAGAAGAGGCTTGGG - Intergenic
1071563254 10:86658877-86658899 CAGTTGCCCAGGAGATCCTTTGG - Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1073701709 10:105934898-105934920 CCGCTACCCTGCACAGCCTTGGG + Intergenic
1075008761 10:118850625-118850647 CAGATGCCTAGCAGAACCTTGGG + Intergenic
1075223786 10:120607076-120607098 CCACTACCCAGTAGAGCCTGTGG - Intergenic
1075975649 10:126691816-126691838 CCACTGCCCAGTGGAGCCTGGGG + Intergenic
1076178259 10:128385387-128385409 CCCCTCTCCAGCAGCGCCTTGGG - Intergenic
1076677370 10:132154054-132154076 CAGGTGCCCAGCAGTGCCTCAGG + Intronic
1077399864 11:2349571-2349593 CCAGTGCCCTGCACAGCCTTGGG + Intergenic
1077845158 11:6015296-6015318 CTGCTGCCCTGCACAGCCTGGGG + Intergenic
1077937268 11:6801191-6801213 CCACTGCTCTGCACAGCCTTGGG - Intergenic
1078133695 11:8635023-8635045 CCTCTCCCCAGCAAAGCCTCGGG + Intronic
1080689155 11:34541450-34541472 CCACCGCCCAGTAGACCCTTTGG - Intergenic
1081358564 11:42144381-42144403 ACTCTGCCCTGCAGAGCCATAGG - Intergenic
1081794815 11:45811907-45811929 CCACTGCCCAGCAGCCCCTGGGG - Exonic
1082780475 11:57283831-57283853 CTGCTGCCCTGCACAGCCTCAGG + Intergenic
1084358143 11:68652870-68652892 GCTCTGCCCAGCGGAGCCTCTGG - Intergenic
1084453350 11:69252834-69252856 CCTCTGTCCAGCAGCCCCTTGGG + Intergenic
1084769662 11:71334444-71334466 CCTCTGACCAGCAAAGCCTGGGG - Intergenic
1084971972 11:72776991-72777013 CCTGTGGCCAGCAGAGCCTCAGG + Intronic
1086860059 11:91915444-91915466 CCAATGCCTAGCAGAGCCTGGGG - Intergenic
1088731448 11:112687440-112687462 CCGCTGCGCAGCAGTGACCTTGG + Intergenic
1091173285 11:133537507-133537529 CCAATGCTCTGCAGAGCCTTGGG - Intergenic
1091174894 11:133548928-133548950 ACGCTGCTCAGCAGAGCCTGTGG - Intergenic
1091373665 12:12888-12910 CGCCAGCCCAGCAGAGCCCTAGG - Intergenic
1091648299 12:2290336-2290358 CCCCTGCCCAGCTGAGCCCAGGG - Intronic
1091958037 12:4664642-4664664 CCTCTGCCCAGGAGAGCTATTGG + Intronic
1092043048 12:5402565-5402587 AGGCTGCCCAACAGAGCTTTAGG + Intergenic
1092471660 12:8786938-8786960 CCACTGCCCTGCACAGCCTTGGG - Intergenic
1092943107 12:13428753-13428775 CCTCTGCCCACCAGATGCTTGGG + Intergenic
1094002183 12:25707269-25707291 CTGCTGCCCTGCACACCCTTGGG + Intergenic
1094812255 12:34149898-34149920 CAGTAGCCCAGCAGGGCCTTTGG - Intergenic
1096863845 12:54549665-54549687 CCGCTGCCCAGCCGAGCTTTGGG - Exonic
1098325552 12:69298358-69298380 CCATTGCCCTGCACAGCCTTAGG + Intergenic
1101131945 12:101698331-101698353 CCGCTGCCCAGGGGAGGCTTGGG - Intronic
1102453462 12:113057369-113057391 CCCCTTCCCAGGAGAGCATTCGG - Intronic
1103317471 12:120068088-120068110 AAGCTGCCTTGCAGAGCCTTAGG - Intronic
1103825073 12:123731587-123731609 CCTCTGCCCAGCAAAGTGTTGGG + Intronic
1104666900 12:130653901-130653923 CCGCTGCCCTGCACAGCTTCAGG - Intronic
1104672386 12:130689626-130689648 CCCCTCCCCAGCTAAGCCTTGGG - Intronic
1106662158 13:31810933-31810955 GCTCTGCCCAGCAAAGCCTTGGG + Intergenic
1108156715 13:47592509-47592531 GCAGTGCCCAGCAGAGCCCTAGG - Intergenic
1108356248 13:49630935-49630957 CCGAGGCCCTGCAGAGCCTGTGG + Exonic
1108729539 13:53220140-53220162 AGGCTGCCAACCAGAGCCTTGGG - Intergenic
1109303900 13:60618133-60618155 CAGCAGCCCAGCAGAGTCTCTGG - Intergenic
1110189466 13:72714616-72714638 CCGCAGCCCTCCACAGCCTTGGG + Intronic
1110411188 13:75205167-75205189 CTGCTGCCCTGCACAGCCTCAGG - Intergenic
1111494806 13:89034178-89034200 CCACTGCCCTGCACAGCTTTGGG + Intergenic
1113975391 13:114224381-114224403 CTGCTGCACAGGAGAGGCTTCGG - Intergenic
1121596445 14:95167119-95167141 CTTCTGCCCAGCACAGCCTCAGG + Intergenic
1121636394 14:95456647-95456669 TCCCTGGCCAGCAGAGCATTTGG - Intronic
1121911615 14:97797125-97797147 CCTCAGTCCAGCAGAGCCTATGG + Intergenic
1122400594 14:101465116-101465138 CCGCCACCCAGCAGAGGCTCAGG + Intergenic
1123627613 15:22238565-22238587 CCGCTTGCCAGCATCGCCTTTGG + Intergenic
1124716948 15:32072649-32072671 CTGCTGCCCTGCACAGCCTTAGG + Intronic
1125049216 15:35278200-35278222 CTGCTGCCCTGCTCAGCCTTGGG + Intronic
1126386702 15:48100705-48100727 CTGCTCCCCAGCAGTGCCCTGGG - Intergenic
1127931527 15:63600411-63600433 CCCCGGCCCAGCAGAGTCCTGGG - Intronic
1128454905 15:67826954-67826976 CCGGTGCCCAGCAAAGGCTTTGG + Exonic
1129812815 15:78524405-78524427 CTGCTGCCCTACACAGCCTTGGG - Intronic
1131198886 15:90379681-90379703 CTGCTGCCCTGCACAGCCTTGGG - Intergenic
1131722699 15:95188066-95188088 CCACTGCCCTTCACAGCCTTTGG + Intergenic
1132412840 15:101597628-101597650 CTGCTGTCCCACAGAGCCTTCGG + Intergenic
1132596551 16:753621-753643 CCTCTGCCCGGCAGGGCCTTAGG - Intronic
1132947247 16:2538292-2538314 CCGCAGCCAAGCAGCGCCCTCGG - Intronic
1132968468 16:2673164-2673186 CCGCAGCCAAGCAGCGCCCTCGG + Intergenic
1133284532 16:4684413-4684435 CCGCTACCCAGCACAGCGTGTGG - Intronic
1135163308 16:20116472-20116494 CCTCGGCCCTGCAGAGGCTTAGG + Intergenic
1135414239 16:22256920-22256942 CCTCTGCCCACCACAGCCCTTGG + Intronic
1135589681 16:23695918-23695940 CCGCGGCCCAGCACGTCCTTGGG + Exonic
1135669348 16:24361883-24361905 CCCACGCCCAGCACAGCCTTGGG + Exonic
1135989632 16:27210138-27210160 CCACTGCCCCGCAGAGCCCCTGG + Exonic
1137609334 16:49808634-49808656 CCTCTGCCCAGCACTGCCCTTGG - Intronic
1138104104 16:54278025-54278047 CCGCAGCCCTCCAGGGCCTTTGG - Intergenic
1139482273 16:67237055-67237077 CCGCCGCCCACCAGCGCCTGGGG + Exonic
1141667593 16:85473972-85473994 CTGCTGCCCCCCAGGGCCTTCGG - Intergenic
1141976343 16:87518792-87518814 CCGCTTGCCAGCATCGCCTTTGG - Intergenic
1142249169 16:88983292-88983314 CGGCCGCCCAGCGCAGCCTTGGG + Intergenic
1142428083 16:90011351-90011373 CCCCTCCCCAGCAGAGCCAAGGG + Intronic
1143827668 17:9625285-9625307 TAGCTACCCAGCAGAGACTTGGG + Intronic
1143883095 17:10045286-10045308 CCTCTGCCCAGCACAGCCCTTGG - Intronic
1145272557 17:21412607-21412629 CCCCTTCCCAGCACAGCCTCAGG + Intronic
1146158815 17:30548027-30548049 GCAATGCCCAGCAGAGCCGTGGG - Intergenic
1146285963 17:31574353-31574375 GTGCTTCCCAGCAGAGCCTGTGG + Intronic
1146596951 17:34177579-34177601 CCGCAGAGCAGCAGAGGCTTGGG + Intergenic
1146654661 17:34628174-34628196 CTGTTGCCCAGCAGAGCCTGTGG + Intronic
1147037856 17:37695153-37695175 CTGCTGCCCTGCACAGCCTTGGG + Intronic
1149065368 17:52473012-52473034 CTGCTGTCCAGGAGAGTCTTGGG - Intergenic
1149853206 17:60054116-60054138 CCACTTCCCTGCACAGCCTTGGG + Intronic
1151358944 17:73576957-73576979 CCTCTGAACAGCAGAGGCTTCGG + Intronic
1151970328 17:77454378-77454400 CCGGAGCTCAGCAGAGCCTTGGG + Intronic
1154367661 18:13726296-13726318 CCGCTGCCCCACAGAGGCCTGGG + Intronic
1155185422 18:23383139-23383161 CAGCTCCCCTGCAGAGCCCTGGG - Intronic
1156622004 18:38864040-38864062 CTGCTTCCCAGCACAGCCTCAGG + Intergenic
1157914825 18:51654743-51654765 CAGATGCCCAGCAGCACCTTGGG + Intergenic
1159583790 18:70263466-70263488 CCCCTGCTCTGCACAGCCTTGGG + Intergenic
1160396231 18:78574280-78574302 CTGCTGCCCTGCACAGCCTCGGG + Intergenic
1160416058 18:78711776-78711798 GCTCTGTCCAGCAGAGCATTTGG - Intergenic
1160802298 19:975998-976020 CCCCTGCCCAGCACAGCCAGGGG + Intergenic
1161420146 19:4171997-4172019 CCTCTGCCCAGGGGTGCCTTGGG + Exonic
1163056833 19:14726231-14726253 CCGCTGCCCTGTGCAGCCTTTGG - Intronic
1163970934 19:20793977-20793999 CAGCTGCCCAGAAGTTCCTTTGG - Intronic
1164540352 19:29117407-29117429 CCCCTGCCCTTCAGCGCCTTGGG - Intergenic
1165154362 19:33778197-33778219 CCGCTCCCGAGCAGCGGCTTGGG + Intergenic
1167347306 19:48954790-48954812 CCGCTGCCCCGCAGCGCCGCCGG - Intergenic
1168294119 19:55370395-55370417 CCGCGGCCCAGCTGACCCTCGGG - Intronic
925264144 2:2552856-2552878 CTGCTGCACTGCACAGCCTTGGG - Intergenic
925393098 2:3512433-3512455 CCTCTGCCCTACAGAGCCTCAGG + Intronic
925962694 2:9033498-9033520 CTGCTTCCCTGCAGAGCATTGGG + Intergenic
930714202 2:54577331-54577353 CATCTACCCAGAAGAGCCTTGGG - Intronic
931800952 2:65757078-65757100 CTGCTGCCTTGCATAGCCTTGGG - Intergenic
932060831 2:68495938-68495960 CTGCTGCCCTGCATGGCCTTGGG - Intronic
932283232 2:70512666-70512688 CATCTGCCCAGCAGGGCCTAGGG + Intronic
932460020 2:71876019-71876041 CAGCTGCCCAGCCCAGCCTCAGG - Intergenic
933979864 2:87540690-87540712 CCGAGGTCCAGCAGAGCCTTGGG - Intergenic
934855446 2:97726490-97726512 CCCCTGCCCAGCAGATCCCTTGG + Intronic
935165163 2:100563402-100563424 CCTCTGCCCAGGTGTGCCTTAGG - Intronic
935324569 2:101924750-101924772 CTGCTGCCCTGCAGAGCCTTGGG + Intergenic
936313956 2:111410101-111410123 CCAAGGTCCAGCAGAGCCTTGGG + Intergenic
936905717 2:117533809-117533831 CCACTGCCTTGCACAGCCTTGGG + Intergenic
937726707 2:125175632-125175654 CTGCTGCCCTGCACAGTCTTAGG + Intergenic
938669636 2:133574441-133574463 CAGATGGCCAGCAGAGCCCTGGG + Intergenic
938957273 2:136310160-136310182 CCCCTGGGCTGCAGAGCCTTGGG - Intergenic
943876146 2:193070811-193070833 CCACTGCCCTGCACAGCCTCAGG + Intergenic
947747104 2:232513475-232513497 CCTCTGCCCAGCCCTGCCTTGGG - Intergenic
948209853 2:236184933-236184955 CTGCTGCCCTGCACAGCCTCAGG + Intergenic
948644254 2:239393763-239393785 CCTCTGCCCACAAGAGGCTTTGG - Intronic
948658652 2:239492607-239492629 CCGCCCCCCTGCACAGCCTTGGG - Intergenic
1172935300 20:38615911-38615933 GAGCTGCCCAGCAGAGCCTAGGG - Intronic
1173414449 20:42843385-42843407 CAGCTGCCCAGCAGAGGCCGTGG - Intronic
1174035880 20:47667977-47667999 CCCCTCTCCAGCAGAGCCTTGGG + Intronic
1174872297 20:54194246-54194268 CAGCTGCACTCCAGAGCCTTAGG + Intergenic
1175603013 20:60290066-60290088 CCGCTACCCTGCACAGCCTCAGG - Intergenic
1175824144 20:61927579-61927601 GCCCTGCCCAGCAGAGCCCCAGG - Intronic
1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG + Intergenic
1176069877 20:63220661-63220683 CCCCTGCCCAGCAGAGCTCCTGG + Intergenic
1176112708 20:63417846-63417868 CCGATGCCCAGCACAGCCCCAGG + Intronic
1176115574 20:63430550-63430572 ACACTGCCCTGCAGAGCCTGGGG - Intronic
1176412192 21:6455073-6455095 CGGCGGAGCAGCAGAGCCTTTGG + Intergenic
1177169609 21:17640721-17640743 CCACTGCCCTGCACAGCCTCGGG - Intergenic
1177582069 21:23036871-23036893 ACCGTGCCCAGCAGATCCTTAGG + Intergenic
1177998442 21:28131372-28131394 CTGCTGCCCTGCACAGCCTTAGG - Intergenic
1178476147 21:32939052-32939074 CCACTCCACAGCACAGCCTTTGG + Intergenic
1179687686 21:43063395-43063417 CGGCGGAGCAGCAGAGCCTTTGG + Intronic
1180712849 22:17851428-17851450 CCTCTCCCCAGCAGAGCCTCTGG - Intronic
1181317574 22:21980694-21980716 TGGGTGCGCAGCAGAGCCTTGGG - Intronic
1181582067 22:23834057-23834079 TGGCTGCCCTGTAGAGCCTTGGG + Intronic
1182042935 22:27252536-27252558 TTGCTCCCCAGCTGAGCCTTGGG - Intergenic
1182284194 22:29234327-29234349 CCGCTGCCCAGCAGAGCCTTGGG - Exonic
1182299006 22:29327632-29327654 CTCCTGCCCAGAAGAGCCTCGGG + Intergenic
1183453657 22:37909954-37909976 CCTCGTCCCAGCAGAGCCCTGGG - Intronic
1185053929 22:48568179-48568201 TCGCTGACCAGCTGGGCCTTGGG - Intronic
950705516 3:14777526-14777548 CCTTTCCTCAGCAGAGCCTTGGG + Intergenic
950776065 3:15351594-15351616 CCACTGCCCTGCACAGCCTTGGG + Intergenic
951241226 3:20288158-20288180 CTGCTACCCTGCACAGCCTTGGG - Intergenic
953978647 3:47401850-47401872 CCACTTCCCAGCAGTGTCTTGGG - Intronic
954119774 3:48490399-48490421 CCACCACCCAGCAGAGCCATGGG + Intronic
955631594 3:60981082-60981104 CTGCTGCCTTGCAGAGCCCTTGG - Intronic
956489167 3:69753115-69753137 CTGCTGCCCTGCATAGCCTTGGG + Intronic
956725153 3:72150953-72150975 CCTTTGCCCAGCAGAGACCTCGG + Intergenic
958161319 3:89819142-89819164 CAGCTGCCCAGCAGTGGCTCTGG - Intergenic
958582978 3:96050966-96050988 CCACTGCCCTGCTCAGCCTTAGG - Intergenic
959564704 3:107822580-107822602 CCCTTGCCCAGCATAGCCTTGGG + Intergenic
959769185 3:110072244-110072266 TTGCTGCCCTGCATAGCCTTGGG + Intergenic
961314963 3:126028289-126028311 CTGCTGCCCTGCACAGCCTCAGG + Intronic
961735684 3:129001169-129001191 CCGAAGCCCAGGAGGGCCTTGGG - Intronic
962005336 3:131343797-131343819 CCACTGCCCTGCACAGCCTCGGG - Intronic
963074071 3:141330316-141330338 CCTTTGCCCCCCAGAGCCTTGGG + Intronic
965290483 3:166872779-166872801 CCGCTGCCCTGCACAGCCTCAGG + Intergenic
965857269 3:173103610-173103632 CCACTGCCCTGCACAGCCTCAGG - Intronic
965870007 3:173253555-173253577 CTGCTGCCCCACACAGCCTTAGG - Intergenic
966340021 3:178915189-178915211 CTGCTGCCCAGCAGATCCTTTGG + Intergenic
966975310 3:185077650-185077672 CTGCTGCCCGGCAGAGCTTGGGG - Intergenic
967559457 3:190901367-190901389 CCGTTGCCCTGCACAGCCTTGGG + Intergenic
967805930 3:193714754-193714776 CTGCTGCCCTGCACAACCTTGGG + Intergenic
968552883 4:1233048-1233070 CCAGTGCCCAGCTGAGCCTCGGG - Intronic
968613549 4:1567565-1567587 CCTGTGCCCAGCAGAGTCCTGGG + Intergenic
969038385 4:4274455-4274477 CCTCTTCCCTGCAGAGCCATTGG + Exonic
969983415 4:11181962-11181984 CCCCTGCCCAGCAGGTCCATTGG + Intergenic
973131569 4:46654194-46654216 CCACTGCCCTGCACAGCCTTGGG - Intergenic
976297199 4:83484635-83484657 CCGCTGCTCTGCGGAGCCTGCGG - Intronic
976378996 4:84378462-84378484 GCCTTGCCCAGCAGAGCCTATGG + Intergenic
977712710 4:100145892-100145914 CCTGTGCTCAGCAGAGCCATAGG + Intergenic
979180549 4:117721430-117721452 CCACTGCCCTGCACAACCTTAGG + Intergenic
979703078 4:123689533-123689555 CCACTGCCCTGCACAGCCTCAGG - Intergenic
981034366 4:140154043-140154065 CGGCAGCCCAGCCGAGCGTTAGG - Exonic
982834725 4:160109493-160109515 CCACTGCCTTGCACAGCCTTGGG - Intergenic
986739968 5:10697293-10697315 CGGCTGTCCAGCAGGGCCTGAGG + Intronic
988255192 5:28810275-28810297 CCGCGGCCCTGCAGATCCTTGGG - Intergenic
990706200 5:58532337-58532359 CCACTGCCCTACACAGCCTTGGG + Intergenic
991457325 5:66818295-66818317 CAGCTGCTCATCAGAGTCTTAGG + Intronic
993781102 5:92066341-92066363 CTGCTGCCCAGTGCAGCCTTGGG + Intergenic
993946622 5:94123172-94123194 CCGCTGCCCTGCACAGCCTTGGG - Intergenic
994073773 5:95629055-95629077 CCCCTGCCCTGCACAGCCTAAGG - Intergenic
994386728 5:99142001-99142023 ACTGTGCCCAGCAGAGCCCTGGG + Intergenic
1000589732 5:163144107-163144129 CCCTTGCCTAGCACAGCCTTAGG + Intergenic
1001127899 5:169037041-169037063 CCTCTGCTCAGAAGAGCCCTTGG - Intronic
1001496089 5:172188402-172188424 CCGCTCCCCGGCAGAGCCCCGGG + Intergenic
1001822022 5:174718074-174718096 CCAGTGCCCAGAAGAGCCTTTGG - Intergenic
1002285773 5:178161874-178161896 CCGATGCCCAGCACAGTGTTGGG - Intergenic
1002392824 5:178929093-178929115 CCGGTGCCCTGCACAGCCTTGGG - Intronic
1002621640 5:180492605-180492627 CCTCTCCCCAGCACGGCCTTGGG - Intergenic
1004165907 6:13256240-13256262 CCGCTGCCCTGTGCAGCCTTGGG - Intronic
1007361511 6:41360102-41360124 CTGCTGCCCTGCACAGCCTCAGG + Intergenic
1010360426 6:74987021-74987043 CCGCTGCCCTGTGAAGCCTTGGG + Intergenic
1010630506 6:78192134-78192156 CCACTGCCCAGCGCAGCCTCAGG - Intergenic
1010978356 6:82341504-82341526 CCGCTGCTCTGTACAGCCTTGGG - Intergenic
1011160975 6:84390131-84390153 CCACTGTCCATCAGAGCCATAGG + Intergenic
1011348769 6:86399984-86400006 CTGCTGCCCTGCACAACCTTGGG - Intergenic
1016751309 6:147633353-147633375 CCGCAGCCCAAAAGAGCCCTCGG - Intronic
1017583537 6:155894449-155894471 CCTCTGCAGAGCAGAGCTTTGGG + Intergenic
1019127781 6:169852366-169852388 TCGCTGCTCAGCAGAGCCTCTGG + Intergenic
1019217209 6:170451644-170451666 CCGGTGCACAGCAGAGCCCATGG - Intergenic
1019635888 7:2075337-2075359 CCGGTGCCCTGCAGGGCCTGAGG - Intronic
1019669552 7:2270104-2270126 CCTCTGCCCAGCAGCTCCCTGGG - Intronic
1019796976 7:3057356-3057378 GCTGTGCCCAGCAGAACCTTAGG - Intergenic
1020283751 7:6664473-6664495 GCTCTGTCCAGCAGAGCCTAAGG - Intergenic
1020583138 7:10031109-10031131 CCTCTGGCCAGCAGAGCTTAAGG + Intergenic
1020775627 7:12450744-12450766 CTGCTTCCCTGCACAGCCTTGGG + Intergenic
1021843944 7:24745967-24745989 CGGGAGCCCAGGAGAGCCTTGGG - Intronic
1021941742 7:25685591-25685613 CCACTGCCCAGCAGGGCCCAGGG + Intergenic
1024222340 7:47298614-47298636 TCGCTTCCAGGCAGAGCCTTTGG - Intronic
1024229901 7:47355846-47355868 CCACTTCCCAGCAGAGCCTCAGG - Intronic
1024480070 7:49853421-49853443 CCGATGCCCAGCAGAGCTCCTGG - Intronic
1024631787 7:51255256-51255278 ACACTGCCCAGCAGTGCCTCGGG - Intronic
1029099162 7:98114128-98114150 CCTCTGCCCACCTGGGCCTTTGG + Intronic
1029700766 7:102245492-102245514 CCGCTCCCCACCCCAGCCTTAGG + Intronic
1030221456 7:107103467-107103489 CCCCTGCCCAGCAGCACCATTGG + Intronic
1031360704 7:120845172-120845194 CTGCTGCCCTGCAGAACCTTGGG - Intronic
1032099237 7:128959483-128959505 ACTGTGCCCAGCAGAGACTTTGG + Intronic
1033670584 7:143488971-143488993 CCAGTGCCATGCAGAGCCTTGGG + Intergenic
1034365212 7:150540334-150540356 CCACTGCCATGCACAGCCTTGGG - Intergenic
1034421538 7:150993519-150993541 CAGGTGTCCAGCAGAGCCCTGGG - Intronic
1034427854 7:151024001-151024023 CCGCAGCCCAGGAGAGTCCTGGG + Exonic
1034925959 7:155122082-155122104 CCGAAGCCCAGCAGGGCCATGGG - Intergenic
1035128577 7:156629828-156629850 CTGCTGCCCTGCACAGCCTCTGG + Intergenic
1035416740 7:158695662-158695684 CCTCTCCCCAGCATGGCCTTGGG + Intronic
1035456549 7:159013156-159013178 CCTCCTCCCAGCAGAGCCTGGGG - Intergenic
1037188402 8:16092568-16092590 GGGATGCACAGCAGAGCCTTTGG - Intergenic
1039432423 8:37535291-37535313 CCACTGCACTGCAGAGCCTGCGG - Intergenic
1040304527 8:46205158-46205180 AGTCTGCCCAGCACAGCCTTGGG - Intergenic
1040928963 8:52714378-52714400 CCGCGGCCCTGCCGAGCCCTCGG - Exonic
1041720319 8:60969393-60969415 CCCTTGCCTAGCATAGCCTTAGG + Intergenic
1043914655 8:85907383-85907405 CCCCTGCTCTGCAGGGCCTTGGG - Intergenic
1044028889 8:87210536-87210558 CTGCTGCCCTGCATAGCCTCAGG + Intronic
1044945435 8:97384723-97384745 CTGCTGCCCTGCACACCCTTGGG - Intergenic
1047348187 8:124048869-124048891 GCCCTGCCCTGCAGATCCTTTGG + Intronic
1047369938 8:124247806-124247828 CCAGTGCCCAGCAGAGCATCAGG - Intergenic
1047688230 8:127323007-127323029 CCACTGACCTGCACAGCCTTAGG + Intergenic
1047965334 8:130042252-130042274 CCTCTGCCAAGCAGACCCATTGG - Intergenic
1048087658 8:131201575-131201597 CTTCTGCCCTGCACAGCCTTGGG + Intergenic
1048096482 8:131300724-131300746 CTGCAGCCCTGCACAGCCTTGGG - Intergenic
1048300986 8:133251136-133251158 CCACGGCCAACCAGAGCCTTGGG + Intronic
1049480288 8:142819373-142819395 CAGAAGCCCAGCAGAGGCTTGGG - Intergenic
1049819807 8:144626759-144626781 AAGCTGCCCAGCAGAGCCGCGGG - Intergenic
1049831749 8:144705248-144705270 CCCTTGCCCAGCAGACCCTTGGG + Intergenic
1050333597 9:4569851-4569873 CCAATGCCCAGCAGGGCCTGGGG - Intronic
1050358309 9:4804210-4804232 CTGCTGCTCAGCAGTTCCTTGGG + Intronic
1050415140 9:5408807-5408829 CCACTTCCCTGCACAGCCTTGGG + Intronic
1051218898 9:14828074-14828096 GCAATGCCCAGCAGAGCCATGGG + Intronic
1051582749 9:18695099-18695121 CCACTGCCCTGCACAACCTTGGG - Intronic
1051919818 9:22251612-22251634 ATGCTGCCCTGCACAGCCTTCGG - Intergenic
1055942752 9:81665985-81666007 CTGTTGCCAAGCAGAGCATTTGG + Intronic
1056502481 9:87223520-87223542 ACGTTGCCCAGCAGGGCCCTGGG + Intergenic
1057242383 9:93422994-93423016 ACCCTGCCCAGCTGAACCTTGGG + Intergenic
1057371760 9:94480088-94480110 CCGGTGCCCAGCAGTTCCTGTGG + Intergenic
1060930439 9:127486411-127486433 CAGGTGCCCAGCAGAGCCAGTGG + Intronic
1061130809 9:128706729-128706751 CAGCTGCCCAGCAGATGCTGCGG + Exonic
1061841674 9:133362122-133362144 CCCCTGCCCTGCAGAGCCAATGG + Exonic
1061973302 9:134056089-134056111 CTGGTGCCAAGCAGAGCCTGGGG - Intronic
1062075473 9:134586331-134586353 CCCCAGCCCAGCAGAGGCCTGGG - Intergenic
1062431512 9:136528702-136528724 CTGCTCCCCAGCAGAGCCACAGG + Intronic
1062609394 9:137367206-137367228 CACCTGCCCAGCAGTGCCTTGGG + Intronic
1186175938 X:6925907-6925929 CTCTTGCCCAGCACAGCCTTAGG + Intergenic
1187445468 X:19356951-19356973 CAGACTCCCAGCAGAGCCTTGGG + Intronic
1189899428 X:45690587-45690609 CTGCTGCCCTGCACAGCCTCAGG + Intergenic
1190434949 X:50415066-50415088 CCAATGCCCAGCAGAGCTGTGGG + Intronic
1191873311 X:65768962-65768984 CCGCTGCCCTGCTCAGCCTTGGG + Intergenic
1193547283 X:82845807-82845829 CCACTGCCCTGCACAGCCTTGGG + Intergenic
1193770412 X:85581090-85581112 CCACTGCCCTGCTCAGCCTTGGG - Intergenic
1193865805 X:86728639-86728661 CTGCTCCCCTGCACAGCCTTGGG + Intronic
1194313261 X:92340656-92340678 TCACTGCCCTGCATAGCCTTGGG - Intronic
1194507846 X:94754812-94754834 CCACTGCCCTGCACAGGCTTGGG - Intergenic
1195035070 X:100965058-100965080 CTGCTGCCCTGCACAGCCTCGGG + Intergenic
1195715972 X:107819125-107819147 CTGCTGCCCTGCACAGCCTTGGG + Intergenic
1195814244 X:108867887-108867909 CTGCTGCCCTGCACAGACTTGGG - Intergenic
1199117339 X:144008352-144008374 CTGCAGCCCTGCAGAGCCATAGG - Intergenic
1199421544 X:147650241-147650263 CCACTGCCCTGCACAGCCTTAGG + Intergenic
1200081157 X:153577119-153577141 CAGCTGCTCAGCAGACACTTGGG - Intronic
1200621527 Y:5454770-5454792 TCACTGCCCTGCATAGCCTTGGG - Intronic