ID: 1182285019

View in Genome Browser
Species Human (GRCh38)
Location 22:29241192-29241214
Sequence CTCCAGAGGAACCAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182285019_1182285026 -8 Left 1182285019 22:29241192-29241214 CCCTGGCCCTGGTTCCTCTGGAG 0: 1
1: 0
2: 4
3: 60
4: 326
Right 1182285026 22:29241207-29241229 CTCTGGAGGCTTGTGCTTGTGGG 0: 1
1: 0
2: 1
3: 79
4: 631
1182285019_1182285027 22 Left 1182285019 22:29241192-29241214 CCCTGGCCCTGGTTCCTCTGGAG 0: 1
1: 0
2: 4
3: 60
4: 326
Right 1182285027 22:29241237-29241259 TTTAGTAAGTTGTGATAGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
1182285019_1182285025 -9 Left 1182285019 22:29241192-29241214 CCCTGGCCCTGGTTCCTCTGGAG 0: 1
1: 0
2: 4
3: 60
4: 326
Right 1182285025 22:29241206-29241228 CCTCTGGAGGCTTGTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182285019 Original CRISPR CTCCAGAGGAACCAGGGCCA GGG (reversed) Intronic
900124792 1:1064600-1064622 CTCCACAGGCACCAGGGCCGTGG + Intergenic
901086446 1:6614492-6614514 CTCGAGAGCAACCGGAGCCAGGG - Intronic
901201356 1:7469188-7469210 CTCCAGGGGAGGCAGAGCCAGGG - Intronic
901522938 1:9799262-9799284 CTCCATGGGAACCGGTGCCAGGG + Intronic
902197138 1:14806109-14806131 CTCCAGTGGTCCCAGGGCCCTGG - Intronic
902761497 1:18583774-18583796 TCCCAGAGGAGCCTGGGCCATGG - Intergenic
904294174 1:29507084-29507106 CTGCAGAGGACCCTGGGGCAGGG + Intergenic
904301538 1:29557608-29557630 CTCCAGCACAGCCAGGGCCAGGG + Intergenic
904927681 1:34061438-34061460 CTAGAGAGGAGCCAGGGGCATGG - Intronic
905926113 1:41751113-41751135 CCCCAGAGAAACCAGGGACTTGG - Intronic
905964982 1:42084914-42084936 TTCCACAAGAACCAGTGCCAGGG - Intergenic
906289163 1:44608776-44608798 GGCCAGAGGAGCTAGGGCCAGGG + Intronic
906453199 1:45970335-45970357 CTCCATAGCAACCAGTGCCAGGG - Intronic
906613853 1:47221926-47221948 CTTCAGAGGTACCATGGGCAGGG - Intronic
906841959 1:49148619-49148641 ACCCAGAGGAACCAGGGCTCAGG - Intronic
907308445 1:53526296-53526318 CTCATGAGGTCCCAGGGCCATGG - Intronic
909781985 1:79559002-79559024 GTCCAGAGGCACCAGGGGCCAGG - Intergenic
912389213 1:109290314-109290336 CTCCAGTGGAAGCAGGACCTAGG - Intergenic
915937837 1:160099111-160099133 CTCGGGCGGAGCCAGGGCCAGGG - Intergenic
916875445 1:168963786-168963808 CTACACAGAAACCAGTGCCAAGG + Intergenic
917645265 1:177023461-177023483 CTCCAGCGGACCCTGGGCCATGG - Exonic
918656072 1:187027760-187027782 CACTTGAGGCACCAGGGCCAGGG - Intergenic
920652119 1:207845549-207845571 CACTACAGGAACCAGGGCCAAGG - Intergenic
921605239 1:217144580-217144602 CTCTGTAGGAACCAGTGCCAGGG + Intergenic
922702826 1:227771745-227771767 CTGCAGAGGACCCAGGACCCTGG + Intronic
924351029 1:243114801-243114823 GGCCAGAGGAAGCAGAGCCAGGG - Intergenic
1062787448 10:277490-277512 CACCAAGGGAACCAGGTCCAAGG + Exonic
1062856332 10:781246-781268 CACCCGTGGTACCAGGGCCACGG - Intergenic
1062957689 10:1551215-1551237 CTCAGGAGGAACCAGGCCCCTGG + Intronic
1063339745 10:5252237-5252259 TCCCAGAGGATGCAGGGCCAGGG + Intergenic
1063842463 10:10088202-10088224 CTCTAGAGGACCCAGGGTCCAGG + Intergenic
1064152864 10:12879523-12879545 CCCCACTGGAACCAGGGACAGGG - Intergenic
1064805273 10:19123057-19123079 CTCCAGAGAAAGCAGTTCCAGGG + Intronic
1065034567 10:21624808-21624830 ATCCACGGGAACCACGGCCACGG + Intronic
1065397967 10:25261765-25261787 CTCCAAAGGGAAAAGGGCCATGG - Intronic
1066041677 10:31554448-31554470 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1067298366 10:44989007-44989029 GACCCGAGGAACCAGGGCCATGG - Intronic
1068299656 10:55121797-55121819 CTCCAGAGGACCCAGCAACAAGG + Intronic
1068423329 10:56823412-56823434 CTTCTGAGGAAACAGGACCAGGG - Intergenic
1068442029 10:57069210-57069232 CCCCAGAGGAACAACTGCCAGGG - Intergenic
1069821131 10:71229457-71229479 CTCCTCAGGATCCAGGGGCAGGG - Intronic
1070733073 10:78845026-78845048 CACCACAGGAATCAGGACCAGGG + Intergenic
1071565241 10:86668273-86668295 CTCCAGAGGACACAGGAGCAAGG + Intergenic
1072323303 10:94271993-94272015 CTTCTGAGGAAACAGGACCAGGG + Intronic
1072409520 10:95187126-95187148 CTCCATAGGTATCTGGGCCATGG - Intergenic
1072942579 10:99780055-99780077 CTCAGCAGGAACCAGGGCTAGGG - Intergenic
1073318085 10:102596918-102596940 CTCCAGGGGAACCAGGGATTAGG - Intronic
1075563862 10:123488940-123488962 CTCCAGAGGATACAGCACCAAGG + Intergenic
1075619562 10:123915830-123915852 TTCCTGAGCAACCAGGACCAGGG - Intronic
1075718942 10:124573970-124573992 CTCCAGGGGAGCCAGGTCCCTGG - Intronic
1077080915 11:724405-724427 CCCCAGGGGAACCAGAGCCAGGG - Intronic
1077493399 11:2872676-2872698 CTCCACAGGGACCAGGACCTAGG + Intergenic
1077553919 11:3217110-3217132 CTCCAGATGATCCAGGGCTGAGG + Intergenic
1079106959 11:17577970-17577992 CCCCAGAGGGACCAGGAGCAGGG - Intronic
1081555850 11:44160252-44160274 CTCTCCAGGAACCAGTGCCAGGG - Intronic
1081597543 11:44469479-44469501 CTCCAGAGGAAGCAAGGCACTGG - Intergenic
1082228538 11:49737077-49737099 TTCTAGAGGAACCAGGTACAGGG + Intergenic
1082563931 11:54652736-54652758 CCCCACAGGAGCCAGTGCCAAGG - Intergenic
1082784916 11:57311484-57311506 CTCCGGAGGGAGCAGGGCCAGGG - Intronic
1082954822 11:58858762-58858784 TTCCTGAGGAATCAGGGACACGG - Intronic
1083127878 11:60590852-60590874 CTCCAGAGGACCCAGGGTCTAGG + Intergenic
1083641744 11:64149400-64149422 CTCCATTTGCACCAGGGCCAGGG - Intronic
1085186368 11:74579265-74579287 TTAAAGATGAACCAGGGCCAGGG + Intronic
1087289024 11:96299640-96299662 CTCCAGAGGCACCGGAGCTAGGG - Intronic
1088419989 11:109635503-109635525 CTCCAGAGGACCAAGAGTCAAGG - Intergenic
1088476872 11:110249749-110249771 CTCCTGAGTAACCAGGACTATGG - Intronic
1089051908 11:115552963-115552985 CACCAGTGGGTCCAGGGCCAAGG + Intergenic
1089474861 11:118751159-118751181 CCACAGAGGAAAGAGGGCCAAGG + Exonic
1089587196 11:119517733-119517755 CTCCAGCTGACCCAGGGTCAGGG - Intergenic
1089671418 11:120059642-120059664 ATCCAGAGGAGTCAGGGCAAAGG + Intergenic
1091271197 11:134313049-134313071 CTCCTGAGGGGCCAGGGCCTGGG - Intronic
1091849454 12:3683471-3683493 CTCAAGAGCTCCCAGGGCCATGG - Intronic
1093610795 12:21153019-21153041 CTGCACAGGAACCAGTGACAAGG - Intronic
1097664426 12:62463646-62463668 CTTCTGAGGAAACAGGACCAGGG - Intergenic
1097682072 12:62658336-62658358 GCCAAGAGGAACTAGGGCCAGGG - Intronic
1098430346 12:70412392-70412414 ATCCAGAGGTAGCATGGCCAGGG - Intronic
1099328118 12:81245647-81245669 CTCTACAGGAACAAGTGCCAAGG - Intronic
1100776904 12:97985110-97985132 CGCCACAGGCACCAGTGCCAAGG - Intergenic
1101910508 12:108857476-108857498 CTGCAGGGTCACCAGGGCCATGG + Exonic
1102150098 12:110683242-110683264 ATCCAGAGGCAACAGGGACATGG - Exonic
1103795878 12:123502854-123502876 GTCCAGAGGAAGCATGGCCCTGG - Intronic
1103847005 12:123908636-123908658 CTCCAGAGGAACAAGGGCAGTGG + Intronic
1104493664 12:129216578-129216600 CTCCAGAGGGAGCATGGCCCTGG + Intronic
1105741436 13:23327729-23327751 CTGCAGAGGCTCCAGGGACAGGG - Intergenic
1107143577 13:37032548-37032570 CTCCTCAGGAACCAGTGCCAGGG + Intronic
1107559248 13:41545506-41545528 CTCCAAAGGACACTGGGCCAAGG + Intergenic
1108452776 13:50584370-50584392 CTCCAGAGGATGCAGCGACAAGG - Intronic
1109597432 13:64574711-64574733 CTTCATGGGAACCAGTGCCAGGG - Intergenic
1109682571 13:65772109-65772131 CTTCTGAGGAAACAGGACCAGGG - Intergenic
1110792625 13:79602066-79602088 CTCCAGAGGAAGCAGCATCAGGG + Intergenic
1111870250 13:93822984-93823006 CTCCTGAGGAGCCAGGACTATGG + Intronic
1112236448 13:97642182-97642204 CTCTTCAGGAACCAGGACCAGGG - Intergenic
1113201194 13:107868246-107868268 CTCCAGAGGGTCCAGGTCCGAGG - Intergenic
1113518699 13:110922582-110922604 CCCCAGGGGCACCAGGTCCAAGG - Intergenic
1113794935 13:113051334-113051356 CTCCGGTGGTCCCAGGGCCACGG + Intronic
1115760497 14:36576225-36576247 CTCCACAGGGACCTGGGCCTGGG + Intergenic
1117608088 14:57452563-57452585 CTCTGCAGGAACCAGTGCCAGGG - Intergenic
1118896158 14:69947290-69947312 CTCCCAAGTAACTAGGGCCATGG + Intronic
1119088487 14:71758906-71758928 CTCCAGAGGGGCCTGGGGCAAGG - Intergenic
1120106234 14:80498517-80498539 CTCCAGAGAAGAAAGGGCCATGG - Intronic
1121017981 14:90559981-90560003 TTCCAGAGGGACAGGGGCCAAGG - Intronic
1122116554 14:99530479-99530501 CTCCGGAGGAACCCGGGCTCAGG + Intronic
1123700468 15:22911082-22911104 CTCCCGAGTAGCCAGGACCACGG - Intronic
1124219331 15:27835655-27835677 CGCCTGAGGCACCAGAGCCAAGG - Intronic
1125481225 15:40082312-40082334 CTCCTGAGGAAGCAGAACCAGGG - Intergenic
1125727459 15:41875342-41875364 CTCCAGAGGCTGCAGAGCCAGGG + Intronic
1128114319 15:65095836-65095858 CTCTGGGAGAACCAGGGCCAGGG + Intronic
1128591781 15:68904453-68904475 CTCCAGAGGATCCAGTACCACGG - Intronic
1128893126 15:71348863-71348885 CTCCAGAGGAACCCTGGTAAAGG + Intronic
1129155257 15:73713672-73713694 CTGCAGAGGAGGCTGGGCCAGGG - Exonic
1129944572 15:79527630-79527652 CCCCACAGGATCCAGGGCGAGGG - Intergenic
1130518682 15:84645684-84645706 CTCCACCAGACCCAGGGCCAGGG + Exonic
1130581852 15:85144688-85144710 CACCATGGGAACCAGTGCCAGGG + Intergenic
1130673016 15:85929696-85929718 CTCCATAGGAAACAGGGCTTTGG - Intergenic
1131597399 15:93812505-93812527 CTCCAGAGGATACAGCGACAAGG + Intergenic
1132311671 15:100862057-100862079 CTCCAGAGGGCCCAGGTCCCTGG + Intergenic
1132852931 16:2032991-2033013 CTCCAGAGGAGCAAGAGCCAGGG - Intronic
1132973411 16:2700057-2700079 CTCCAGTGGAAACAGGGCACAGG - Intronic
1133231741 16:4370198-4370220 CTTCAGAGGACACAGGGCCAAGG + Intronic
1133381721 16:5336558-5336580 CTCCAGAGGATACAGGACCAGGG - Intergenic
1134188867 16:12106004-12106026 CTCCAGAGGAGCCACGGCTGAGG - Intronic
1135397417 16:22141796-22141818 CTCCAGAGGCACCAGTGCCTAGG - Intronic
1135734227 16:24918026-24918048 CTCCAGAGGAAGCAGGGACTTGG - Intergenic
1135942200 16:26831843-26831865 CTTTATAGGAACCAGTGCCAGGG + Intergenic
1136550934 16:30982198-30982220 CTCATTAGAAACCAGGGCCATGG + Intronic
1137783345 16:51116020-51116042 CTCCAGTGGCACCAGAGCAAGGG - Intergenic
1138448573 16:57079456-57079478 CTCCAGAGCCACCAGGGTCTGGG - Intronic
1138551318 16:57750231-57750253 CTCCAGCGGAAGCAGAACCAGGG - Intronic
1138993188 16:62417373-62417395 CACCAGAGGTAGCAGGTCCAGGG + Intergenic
1139407059 16:66727514-66727536 TTCCAGAGGAAGAAGGTCCATGG - Intronic
1139464105 16:67144983-67145005 CCCCAGAGGAACTGAGGCCATGG - Intronic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1139853376 16:69963465-69963487 CGCCACAGGGACCACGGCCATGG + Intronic
1139882345 16:70186374-70186396 CGCCACAGGGACCACGGCCATGG + Intronic
1140370164 16:74409130-74409152 CGCCACAGGGACCACGGCCATGG - Intronic
1140922349 16:79550955-79550977 CTCCAAAGGAACCACGGTCCTGG - Intergenic
1141129910 16:81429271-81429293 CTGCAGTGGAACCAGGGCAAGGG + Intergenic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1141964511 16:87432790-87432812 CTCCAGAGGCACCACGGCCCCGG + Intronic
1142135429 16:88449817-88449839 CGTCAGAGGAGCCAGGTCCATGG + Intergenic
1143166429 17:4899373-4899395 CTCCAGGAGAACCTGGGGCAGGG + Exonic
1143516670 17:7422712-7422734 CTTCTGAGGAGCTAGGGCCATGG - Intergenic
1144773208 17:17770939-17770961 CTCCTAAGGACCCAGGGCCTGGG + Intronic
1145090016 17:19978269-19978291 CTCCTGAGGAAGCAGGGACTGGG - Intronic
1145316972 17:21740840-21740862 CTCCAGGGGAGCCCAGGCCAGGG + Intergenic
1147143877 17:38474383-38474405 TTCCAGGGGAAGGAGGGCCAGGG + Intronic
1147195959 17:38766830-38766852 ATTAACAGGAACCAGGGCCAGGG + Exonic
1147913750 17:43874210-43874232 TACCAGGGGAACCAGGCCCATGG - Intergenic
1147973119 17:44230588-44230610 CTCCACAGGAACCAGTGCCAGGG - Intergenic
1148088820 17:45010388-45010410 AGCCAGAGGGACCAGAGCCAAGG + Intergenic
1148103167 17:45105048-45105070 CTCCAGCAGAAACCGGGCCATGG + Intronic
1148249772 17:46066376-46066398 CTCCAGAGCAAACAGGGCCCAGG + Intronic
1149727498 17:58911108-58911130 CTCCATAGGAACCAATTCCAGGG - Intronic
1151475282 17:74341664-74341686 CTCCAGTGGGACCTGGGCCCTGG + Intronic
1151608123 17:75153461-75153483 CTGCAAGGGAACCAGGGCCAGGG + Intronic
1151716580 17:75834247-75834269 CTCCAGCAGCACCTGGGCCAAGG - Intronic
1151972613 17:77466571-77466593 CTCCCGAGGACCCAGGGCCTGGG - Intronic
1152161990 17:78674686-78674708 CTCCACAGGACCCTGGACCAGGG - Exonic
1152499017 17:80695791-80695813 ATGCAGAGGCACCAAGGCCAGGG + Intronic
1152614206 17:81330438-81330460 CTCCAGAGCCAGCAGAGCCACGG + Exonic
1153309917 18:3667821-3667843 TTCTAGAGGAACCTGGGCCAAGG - Intronic
1153478043 18:5518202-5518224 ATCCAGAAGAAACGGGGCCATGG - Intronic
1157304877 18:46509631-46509653 AGCCAGAGGAACCAGGGGAAGGG + Intronic
1157403441 18:47404825-47404847 CAGGAGAGGAACCAGAGCCATGG - Intergenic
1157555318 18:48609763-48609785 CCCTAGAGGCACCAGGGACAGGG - Intronic
1158481821 18:57828624-57828646 CTCCTGAGTAACCAGGGCTAAGG - Intergenic
1159071394 18:63627049-63627071 CTCCAGAAGACCCAGGGTCTAGG + Intergenic
1160056088 18:75482344-75482366 CTCCATGGGAACCAGAGCCCAGG + Intergenic
1160160210 18:76465044-76465066 CTCCAGAGGTGCCAGGGCCCAGG + Intronic
1160195796 18:76754085-76754107 CTCCATAGGCACCATAGCCAAGG + Intergenic
1160262090 18:77303632-77303654 CTGCAGAGGACACAGGACCAAGG + Intergenic
1160335959 18:78039905-78039927 CTCCAAAGGAACCAGCCCTAGGG - Intergenic
1160499186 18:79394124-79394146 CTCCTGAGGAGCCGGGGCCGGGG - Intergenic
1160510579 18:79451319-79451341 CATCAGAGGAGCCAGCGCCAGGG - Intronic
1160537919 18:79604778-79604800 CCCCAGGGGAACCTGGGCCGTGG + Intergenic
1161066470 19:2240932-2240954 CTGCGGAGGACCCAGGGCCCAGG - Intronic
1161127184 19:2564720-2564742 CTCCAGAGACTCCAGGGGCAGGG - Intronic
1161167612 19:2796717-2796739 CTCCCGAGGAGGCAGGGGCAGGG - Intronic
1161864482 19:6824058-6824080 CTCCTGAGGAGCTGGGGCCACGG + Intronic
1161877910 19:6926158-6926180 GTCCAGACAAACCAGGACCATGG + Intronic
1162021607 19:7870685-7870707 CTGCAGAGGAGGCAAGGCCAGGG + Exonic
1162050300 19:8028747-8028769 CTTCAGAGGCAGCAGGGACAAGG + Intronic
1162601628 19:11674307-11674329 CCTGAGAGGAACCAGGGCCGAGG - Intergenic
1162796083 19:13088365-13088387 CCCCAGAGGGGCCTGGGCCAGGG - Intronic
1163145529 19:15377256-15377278 CTGCAGAGGGACCTTGGCCAAGG + Intronic
1163422230 19:17220315-17220337 CTCCAGAGGAACATGGGCGGAGG - Intergenic
1163819082 19:19486012-19486034 TTCAGGAGGAACCAGCGCCACGG - Intronic
1164635163 19:29786292-29786314 CTGCAGGGCAAACAGGGCCAGGG + Intergenic
1166270835 19:41712485-41712507 CTGCACAGGAACTAGGGGCAGGG + Intronic
1166624405 19:44336998-44337020 CTCCAGAGTAGCCGGGACCATGG + Intronic
1166998313 19:46730330-46730352 CCCCAGAGTGGCCAGGGCCAGGG + Intronic
1167373882 19:49101095-49101117 CTCCAGAGGTCCAAGGGCCCGGG - Intronic
1168643785 19:58047014-58047036 CTCCAGAGGCGGCTGGGCCAAGG + Intronic
925467507 2:4121010-4121032 CCCTAGAGGAACCAAGGCCTTGG + Intergenic
925467841 2:4125612-4125634 CTCTAGGGGAACCAAGGCCTTGG - Intergenic
926323421 2:11764900-11764922 CTGCAGAGGAGACAGGGCCTGGG + Intronic
927224101 2:20744868-20744890 CCCCACAGGAAGCAGTGCCATGG - Intronic
927502226 2:23590557-23590579 CTGGAGGGGAACCAGGGCCTCGG - Intronic
927853829 2:26515931-26515953 CTCAAGAGGAAGAAAGGCCAGGG + Intronic
928420982 2:31137858-31137880 CTCCCGGGAAACCAGGGCGAGGG - Intronic
928490330 2:31777408-31777430 CTCCAAGGGAACCAGTGCCAGGG + Intergenic
929034733 2:37679824-37679846 ATCCAGAGGAGCCAGGGCTTTGG - Intronic
929547952 2:42868283-42868305 TTCCCGAGGGACCACGGCCATGG + Intergenic
929941332 2:46336236-46336258 CTTCAGTGGAACCTGGGCTAGGG - Intronic
930313739 2:49772441-49772463 CTCCAGAGGGACCAGGGGACTGG + Intergenic
931362704 2:61591717-61591739 GTCAGGAGGCACCAGGGCCAGGG - Intergenic
931455949 2:62409929-62409951 CTCTTGAGGAAGCAAGGCCATGG + Intergenic
931757766 2:65389076-65389098 CTCCAGAGGAAAGAGGGCTGGGG - Intronic
932397732 2:71459750-71459772 CTCCAGAGAGCCCAGGCCCAAGG - Intronic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
932968597 2:76509842-76509864 CTCCAGAGGTAGCATGCCCAGGG - Intergenic
933354678 2:81196743-81196765 CTCCACGGGAACCGGGGGCAGGG + Intergenic
933364572 2:81334267-81334289 CTCCACAAGAACCAGTGCCTGGG + Intergenic
933892418 2:86783983-86784005 CTCCTGTGGAAGCAGGGCCTGGG - Intergenic
934533083 2:95108175-95108197 CTCCACAGGGACCAGGGTCAGGG + Exonic
934555094 2:95282904-95282926 GGCGAGGGGAACCAGGGCCAGGG - Intronic
934556963 2:95292544-95292566 CTCCAGGGCCACCAGGACCAGGG - Intergenic
934655612 2:96115519-96115541 CCGCAGAGGTCCCAGGGCCAAGG - Exonic
935398436 2:102635463-102635485 ATACAGAGAAACTAGGGCCAGGG - Intronic
936982728 2:118279049-118279071 CTCCAGAAGAACCAATGCCAAGG - Intergenic
937207910 2:120248430-120248452 CCCCAGAGGAACCAGAGGCAAGG - Intronic
937959943 2:127449936-127449958 CTCCACAGGAACCAGTACCGGGG - Intronic
937992820 2:127673892-127673914 CTGCAGAGGGGCCTGGGCCAAGG + Intronic
938108804 2:128550924-128550946 CTCCTGCGGAACCCGGGCCTGGG + Intergenic
939008838 2:136821402-136821424 TTCCAGAGGAGTCAGGCCCAGGG - Intronic
940434777 2:153638629-153638651 CTCCATAGCAACAAGAGCCAAGG + Intergenic
941934277 2:170971128-170971150 CTCCCCAGGAAGCAAGGCCATGG - Intergenic
943203434 2:184860142-184860164 CTCCGGAGGACCCAAGGCCAAGG - Intronic
944395639 2:199263229-199263251 CTCCTGAGGAAACAGGACCAGGG - Intergenic
944902665 2:204231539-204231561 CTCCAGAGCAGACAGAGCCAGGG + Intergenic
946054298 2:216887454-216887476 GTCCACAGGGAGCAGGGCCAGGG - Intergenic
946746857 2:222854735-222854757 GTCCAGAGGAAACAGTTCCATGG - Intergenic
947510370 2:230747395-230747417 CTACAGAGGAAACAGTTCCATGG - Intronic
948298600 2:236884926-236884948 CTACAGAGGAAGCAGAGCCCAGG + Intergenic
948384977 2:237575629-237575651 CTCCTGAGCAGCCAGGACCAGGG + Intronic
948833529 2:240612772-240612794 CTCCAGAGGAAGAAGGGGAAGGG + Intronic
1168931391 20:1627167-1627189 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1170637290 20:18118481-18118503 CTGCACTGGAACCAGTGCCAGGG - Intergenic
1171012255 20:21515100-21515122 GCCCAGAGGCAGCAGGGCCAGGG - Intergenic
1171805530 20:29676000-29676022 CTACACAGGAACCCTGGCCATGG - Intergenic
1172009312 20:31837197-31837219 CACCACAGGCACCAGGGCCATGG + Intergenic
1172178460 20:32986568-32986590 CTCCTGAGGAGCTGGGGCCAGGG + Intronic
1173392319 20:42646203-42646225 CTCCAGGGGACCCACGGCCAAGG + Intronic
1174384408 20:50178563-50178585 CTCCAGAGGGAGCAGGACCCTGG + Intergenic
1174948143 20:55011531-55011553 CTCCCAAATAACCAGGGCCACGG + Intergenic
1175763523 20:61577605-61577627 CCCCAGAGAACCCAGGCCCATGG - Intronic
1175771162 20:61625205-61625227 CTCCAGAGGCACCCGGACCCAGG + Intronic
1175929160 20:62485479-62485501 CTCCAGAGGAAGCCAAGCCAGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1177752963 21:25308784-25308806 CTGCAGAGGACCCAGGGTCCAGG + Intergenic
1179544299 21:42104215-42104237 CTCCACCGGAACCAGGGGCCAGG + Intronic
1179610171 21:42545150-42545172 GGCCAGAGGACCCAGGGACAGGG - Intronic
1181460089 22:23080643-23080665 CTCCACAGTAACCAGGGCCCAGG - Intronic
1181542305 22:23580022-23580044 CTCCAGGGGCTCCAGGGCCCAGG + Exonic
1181937963 22:26452462-26452484 CTCGAGAGGAACCAGCTGCACGG + Exonic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1183456850 22:37927571-37927593 TTCCAGGGGTACCAGGGGCATGG - Exonic
1183572064 22:38660964-38660986 CTCCAGCAGAAACAGTGCCAGGG + Intronic
1184345793 22:43911848-43911870 CTTCACAGGAAACAGAGCCAAGG + Intergenic
1203242002 22_KI270733v1_random:28124-28146 CTCCAGAGCCACCAGGGTCACGG + Intergenic
950093762 3:10315970-10315992 CCACAAAGGATCCAGGGCCAGGG - Intronic
950428439 3:12937300-12937322 CTCAAGATGCACCAGGGCCAGGG - Intronic
950584650 3:13883647-13883669 AACCAGAGGAAACAGGGCCACGG + Intergenic
951675409 3:25234835-25234857 CTCCAGAGGAACCAGAAAAATGG - Intronic
952839117 3:37629417-37629439 CTCCTGAGCAGCCAGGCCCACGG - Intronic
952875469 3:37941096-37941118 CTGCAGTGACACCAGGGCCAGGG + Intronic
954305108 3:49721531-49721553 CTCAAGAAGGGCCAGGGCCAGGG - Exonic
956118985 3:65946728-65946750 CTCCAGAAGAGGTAGGGCCAGGG + Intronic
956255158 3:67275626-67275648 CACCAGAGCAACCAGGACCAGGG + Intergenic
960006117 3:112782833-112782855 CTCCAGAGGGTCCAGCCCCAGGG + Intronic
960935704 3:122900145-122900167 TTCCTGGGGAACCAGGGCCATGG + Intergenic
961476556 3:127150379-127150401 CTCCGGATGATCCAGGGCCATGG + Intergenic
961810566 3:129519359-129519381 CCCCCGAGGGACCATGGCCAAGG + Intronic
962010003 3:131383043-131383065 CTCCAGCAGAACCAGGCCCAAGG - Exonic
962308783 3:134311651-134311673 CTCCAGGGGAAGTAGGGGCAGGG - Intergenic
964369425 3:155984202-155984224 CTCTTCAGGAACCAGTGCCAAGG - Intergenic
965089754 3:164147838-164147860 CTTCTGAGGAAACAGGGCAAGGG - Intergenic
966696470 3:182794115-182794137 CCCCAGAGGAAACAGGGCGAGGG + Intronic
968334283 3:197900231-197900253 GTCCACAGGCACCAGGACCAGGG - Intronic
968967283 4:3775545-3775567 CTCCAGAGGACGCAGGCTCAGGG - Intergenic
969390101 4:6886271-6886293 TTCAAGAGGAACCAGGGGCAGGG - Intergenic
969538694 4:7772337-7772359 CTGAAGAGGAACCAGGGACAGGG + Intronic
970520658 4:16880633-16880655 CAGCAGAGGACACAGGGCCAAGG - Intronic
971515119 4:27475975-27475997 CTCCACAGGAACCAGTGTCAGGG + Intergenic
976180378 4:82393258-82393280 CTCCCCAGGAACCAGGGACGAGG - Intergenic
976453264 4:85216949-85216971 CTTCTGAGGAAACAGGACCAGGG - Intergenic
978021910 4:103824757-103824779 CTTCATCGGAACCAGGGCAAGGG - Intergenic
978515908 4:109568345-109568367 CTGCAGTTGAACCAGAGCCATGG + Intronic
979250909 4:118565752-118565774 GGCCAGAGGAAGCAGAGCCAGGG + Intergenic
979454653 4:120913761-120913783 CAGCAGAGTAACCAGGGACAAGG + Intronic
979765612 4:124461998-124462020 CTTCTGAGGAAACAGGACCAGGG - Intergenic
980185644 4:129457947-129457969 TTCCAGAGGATCCAGTCCCATGG - Intergenic
980442104 4:132862561-132862583 CTCCAGGGGAACCAATGCCAAGG + Intergenic
981080668 4:140636215-140636237 TTCAAGAGAAACCAGGGCAAAGG + Intronic
981571117 4:146151549-146151571 CTCCACAGGAACCAGTACCAGGG - Intergenic
983763150 4:171439755-171439777 ATTCAGAGGAACCAGTGTCAGGG - Intergenic
985086794 4:186322067-186322089 ATCCAGAGGCAGCAGGGCCGTGG - Intergenic
985317080 4:188669518-188669540 CTCTGCAGGAACCAGTGCCAGGG - Intergenic
985322171 4:188725216-188725238 CTCCTGAGTAGCCAGGACCACGG + Intergenic
985432306 4:189893142-189893164 CTCCAGAGCAATCAGGCCTAAGG + Intergenic
985800448 5:2002374-2002396 CTCCAGAGGCTTTAGGGCCAGGG - Intergenic
985816457 5:2131637-2131659 CTCCTTGGGAACAAGGGCCAGGG - Intergenic
985954156 5:3250114-3250136 CACCACGGGAGCCAGGGCCATGG - Intergenic
986958243 5:13182062-13182084 CTCCAGAGGATGCAGCGACAAGG + Intergenic
987100888 5:14590323-14590345 ATCCACTGGAGCCAGGGCCAGGG + Intronic
990441086 5:55846069-55846091 TTCCACAGGAACCAGTACCAGGG - Intergenic
991354121 5:65749851-65749873 TTCCATAGGGAGCAGGGCCAAGG - Intronic
993280673 5:85921017-85921039 CTGCAGCGGAACCACTGCCATGG - Intergenic
996807724 5:127476100-127476122 CTCTACAGGAACCAGTGTCAAGG - Intergenic
997184674 5:131869807-131869829 CTCCATGGGAACCATTGCCAGGG - Intronic
997294644 5:132761960-132761982 CTCCCTAGGACCCAGGGGCAGGG - Intronic
998185196 5:139974112-139974134 CTCCAGAGCAAAAAGGGCCAGGG - Intronic
998193285 5:140044264-140044286 CTCCACAGGAAACTGGTCCAAGG + Intergenic
998400864 5:141848475-141848497 CCCCAGAGAAACCTGGGGCAGGG + Intergenic
1000040424 5:157480883-157480905 CTGCAGAGGACCCATGGCCATGG - Exonic
1000400991 5:160826998-160827020 CTTCTGAGGAAACAGGACCAGGG - Intronic
1001791374 5:174460182-174460204 CTCCAGAGGGTCCAGGGCAAAGG + Intergenic
1002197548 5:177509526-177509548 CTCCAGAGGGTCCATGGTCACGG + Exonic
1002313353 5:178328039-178328061 CTCCACAGGATCCAGAGCCCAGG - Intronic
1005984779 6:30864647-30864669 CTCCAGGGAAACCAGAGGCAAGG - Intergenic
1006520888 6:34570522-34570544 CTCCCAAGTAACCAGGACCATGG + Intergenic
1009789675 6:68385706-68385728 CTTCTGAGGAAACAGGACCAGGG - Intergenic
1013327937 6:109066966-109066988 CACCAGAAGAACCAGGGCCAAGG - Intronic
1013720348 6:113018890-113018912 GTCCACAGGAACCAGAGCCAGGG + Intergenic
1016894825 6:149041493-149041515 CTCCAGAAGAGCAAGGGGCATGG - Intronic
1017657598 6:156645142-156645164 CTGCAGAAGAACAAGGGACATGG + Intergenic
1018392239 6:163349536-163349558 CCCCAGAGAGACCAGGGCCTGGG - Intergenic
1019265811 7:116859-116881 CACCAAGAGAACCAGGGCCAGGG - Intergenic
1019318942 7:406120-406142 CACCAGAGGAGTCAGGCCCAGGG - Intergenic
1019477724 7:1252018-1252040 CTCCTCAGGAACCGAGGCCAGGG - Intergenic
1021332442 7:19355199-19355221 CTCCAGAGAAACCAGGACAATGG - Intergenic
1022470390 7:30678504-30678526 TTCCAGATGCAGCAGGGCCAAGG - Intronic
1022482238 7:30751892-30751914 CCCTAGAGGCAGCAGGGCCAGGG + Intronic
1023141458 7:37106424-37106446 CTCCAGAGGATGCAGCGCCAAGG + Intronic
1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1023660099 7:42462214-42462236 CTCCAGAGCCACCAGGACCTTGG + Intergenic
1023978804 7:45053797-45053819 CTCCTGAGGGACATGGGCCACGG + Intronic
1024587770 7:50856354-50856376 GTCCATAGGAACCAGGTCCCAGG - Intergenic
1024597035 7:50947037-50947059 CTCCAGAGGAAACAGTGCCCTGG + Intergenic
1025241424 7:57279487-57279509 CAGCAGAGGCACCAAGGCCAGGG - Intergenic
1028609393 7:92692660-92692682 CTCCAGAGTAGCCGGGACCACGG - Intronic
1029110112 7:98209739-98209761 CTCCAGAGGGACCAGGGCAGGGG - Intergenic
1030923385 7:115420589-115420611 CTCCACAGAAACCAGTACCAGGG - Intergenic
1031029086 7:116715285-116715307 CTCCAGAGGGAGCATGGCCCTGG - Intronic
1034212482 7:149376074-149376096 CTCCAGAACAATCAGGCCCAGGG - Intergenic
1034212651 7:149377843-149377865 CTCCAGAACAATCAGGCCCAGGG - Intergenic
1037539313 8:19856196-19856218 TTCCAGAGGGCCCTGGGCCAGGG - Intergenic
1037617409 8:20531887-20531909 CTCCTGAGGTCCCAAGGCCATGG - Intergenic
1037761999 8:21747661-21747683 TTCAGAAGGAACCAGGGCCAGGG - Intronic
1037832636 8:22198486-22198508 CTCCAGAGGTAACAGGACCCAGG + Intronic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1039580406 8:38661602-38661624 CTTCTGAGGAAACAGGGCAAGGG - Intergenic
1039839290 8:41282009-41282031 CTTCAGAGCACTCAGGGCCAAGG + Intronic
1041212390 8:55565321-55565343 ATCCACAGGAACCATGACCAGGG - Intergenic
1047526896 8:125641490-125641512 CTCCCAGGGAGCCAGGGCCAAGG + Intergenic
1047672984 8:127169356-127169378 ATCCATTGGAACCAGTGCCAGGG - Intergenic
1047904663 8:129460116-129460138 CTCCAGAGGAGCCAGGGCAGAGG - Intergenic
1048239177 8:132724106-132724128 CTTCTGAGGAAACAGGGACAGGG + Intronic
1048930765 8:139314039-139314061 CTCTGGAGGAACCAGGTCTAAGG - Intergenic
1049538006 8:143191401-143191423 CTGTACAGGAAGCAGGGCCAGGG + Intergenic
1049603323 8:143518088-143518110 CTCCTGCAGCACCAGGGCCATGG - Intronic
1050323860 9:4480975-4480997 CTCCAGAGTAGCTGGGGCCATGG + Intergenic
1050397463 9:5214514-5214536 CTCCAGAGAAACCAGGATCCAGG + Intergenic
1052456081 9:28699994-28700016 CTTCTGAGGAAACAGGGCCAGGG - Intergenic
1055443502 9:76359578-76359600 CTGCGGAGGAACTAGGGCCTGGG - Exonic
1056262647 9:84864169-84864191 CTTCAGAGCATCCTGGGCCAGGG + Intronic
1056649268 9:88443974-88443996 CTACACAGGAACCAGGGCCATGG - Intronic
1059415069 9:114157147-114157169 CTCCAGAAGACCCTGCGCCAGGG + Intronic
1059537894 9:115100044-115100066 CCCCTGAGGAACCTTGGCCAGGG - Intronic
1060045443 9:120336790-120336812 CCCCAGAGGAGGCAGGGCCCTGG - Intergenic
1060481896 9:124021299-124021321 CTCCAGGTCAGCCAGGGCCAGGG + Exonic
1062101431 9:134730610-134730632 CTGCAAAGGGCCCAGGGCCAGGG - Intronic
1062653709 9:137591083-137591105 CTCCAGAGCAGCCTGGTCCAAGG + Intergenic
1203790388 EBV:148423-148445 CTCCAAAGGACCCAGGATCACGG - Intergenic
1203458319 Un_GL000220v1:11201-11223 CACCAGAGCCACCAGGGTCAGGG + Intergenic
1185832699 X:3317139-3317161 CTCCAGAGGATGCGCGGCCAGGG + Exonic
1187115572 X:16346847-16346869 CGCCACAGGGACCAGTGCCAGGG - Intergenic
1187239045 X:17496014-17496036 CCCCAGAGGATACATGGCCATGG + Intronic
1188067243 X:25677828-25677850 CTCCTGAGTAACCGGGGCTACGG + Intergenic
1190123956 X:47686959-47686981 AGCCAGAGGAATCAGGGTCATGG + Intergenic
1192788321 X:74355203-74355225 CCCCAGAGGACCCAGGGTCCAGG + Intergenic
1195135887 X:101906884-101906906 CTCCAGAGGACCCAGGCTCCAGG + Intronic
1195556772 X:106235795-106235817 CTTCTGAGGAAACAGGACCAGGG - Intergenic
1198446046 X:136715614-136715636 CTCCACAGGAACCAGCACTAGGG + Intronic
1198940659 X:141952373-141952395 CTCCAGTGGATCTAGGGTCAAGG - Intergenic
1200691953 Y:6314763-6314785 CTCCACTTGGACCAGGGCCAGGG + Intergenic
1200838237 Y:7753886-7753908 CTTCTGAGGAAACAGGGCAAAGG - Intergenic
1201043319 Y:9859960-9859982 CTCCACTTGGACCAGGGCCAGGG - Intergenic
1201243389 Y:11979797-11979819 CTCCAGAGGATGCGCGGCCAGGG - Intergenic
1201621697 Y:15966128-15966150 CTTCTGAGGAAACAGGACCAGGG + Intergenic