ID: 1182288028

View in Genome Browser
Species Human (GRCh38)
Location 22:29259467-29259489
Sequence GCCCTCCCGCATCTCAGGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182288020_1182288028 -7 Left 1182288020 22:29259451-29259473 CCCTCTGAGCCCCCAGGCCCTCC 0: 1
1: 0
2: 11
3: 91
4: 619
Right 1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1182288017_1182288028 18 Left 1182288017 22:29259426-29259448 CCGGGGGCTTCTTGCCTCAGTTC 0: 1
1: 0
2: 1
3: 23
4: 208
Right 1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1182288021_1182288028 -8 Left 1182288021 22:29259452-29259474 CCTCTGAGCCCCCAGGCCCTCCC 0: 1
1: 1
2: 10
3: 109
4: 883
Right 1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1182288018_1182288028 4 Left 1182288018 22:29259440-29259462 CCTCAGTTCTTCCCTCTGAGCCC 0: 1
1: 0
2: 1
3: 45
4: 420
Right 1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182288028 Original CRISPR GCCCTCCCGCATCTCAGGTT GGG Exonic
901917192 1:12508789-12508811 GCCCAGCTGCATCTCAGGATGGG - Intronic
902962007 1:19970458-19970480 GCCCTGCCCCATCTCAGGGAGGG + Intergenic
906495983 1:46304164-46304186 GCCTTGCCCCAGCTCAGGTTAGG + Intronic
907309778 1:53532619-53532641 GGGCTCCCCCATCTCACGTTGGG - Intronic
908234658 1:62137842-62137864 GGCCTCCCTCACCTCAGGTGGGG + Intronic
908572130 1:65420848-65420870 CCCTTCCCGCCTCTCCGGTTCGG + Intronic
912722689 1:112033246-112033268 CCCCTCCTGCATCTCAGTCTGGG + Intergenic
919308822 1:195878744-195878766 AGCCTCCCCCATCACAGGTTTGG - Intergenic
1064190454 10:13201422-13201444 GCGCTCCTGCATCTCAGCCTCGG - Exonic
1068962925 10:62883446-62883468 CCCCACCCCCTTCTCAGGTTTGG + Intronic
1069622704 10:69847664-69847686 GCTCTGCAGCATCTCAGCTTGGG + Intronic
1071011226 10:80942726-80942748 GCCCTGCTTCATCTCAGGTTTGG - Intergenic
1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG + Intronic
1076728972 10:132428994-132429016 TCCCTCCTGCATCTCATGCTGGG - Intergenic
1076898651 10:133326182-133326204 GCCCTCCCGCTTCTGCGGTTGGG + Intronic
1077292057 11:1801958-1801980 GCCTTCCTACATCTCAAGTTGGG + Intergenic
1080390682 11:31843053-31843075 GCCTTCCCTGATCCCAGGTTTGG + Intronic
1083815542 11:65130547-65130569 GCCCTCCAGAATCTCAGTCTGGG - Intronic
1084944784 11:72632725-72632747 GCCCTCCCTCCTCTCAGGGGAGG - Intronic
1090838317 11:130469423-130469445 GCCCTGCCCCAGCTCAGGTGAGG + Exonic
1090938343 11:131365385-131365407 GCCCTCACACATCTGGGGTTGGG - Intergenic
1091789860 12:3265714-3265736 CACCTCCCCCAACTCAGGTTGGG + Intronic
1101609151 12:106274582-106274604 GCCCTCCTTCTTCTCTGGTTGGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103368220 12:120398461-120398483 GTCCTCTCTCACCTCAGGTTGGG + Intergenic
1108026410 13:46183020-46183042 GCCCTCAAGCATCTGGGGTTTGG - Intronic
1112561294 13:100517134-100517156 GCCCTCCCTCCACTCCGGTTTGG - Intronic
1116792649 14:49356482-49356504 GTCCTCCAGGATCTGAGGTTTGG + Intergenic
1117974551 14:61284199-61284221 GGGCTCCCGCACCTCAGGCTGGG + Intronic
1120149228 14:81014508-81014530 CCCCTTCTCCATCTCAGGTTTGG + Intronic
1120915991 14:89710914-89710936 GCACTCCCTCAGCTGAGGTTGGG + Intergenic
1128976937 15:72161072-72161094 GCCTGCCCGCATCTCAGGCATGG - Exonic
1135976480 16:27111690-27111712 GCCCTGCAGCATCTCAGGGAAGG + Intergenic
1140672529 16:77293139-77293161 GCCCTCCTGCAGCTCAGGTCTGG + Exonic
1143628498 17:8124026-8124048 CCCCTCCCGCCTCTCACCTTGGG + Exonic
1145393029 17:22470647-22470669 GCCCTCCTGCCTCCCTGGTTAGG - Intergenic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG + Intronic
1156119196 18:33821174-33821196 TCCCTCCCCCATCTCACCTTTGG + Intergenic
1158565998 18:58554676-58554698 GCCCTCCCTTTTCTCAGGTCTGG + Intronic
1158694679 18:59693369-59693391 GCCTTCACACATCTCAAGTTGGG - Intronic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1163642661 19:18470342-18470364 GCCCCCCCACTGCTCAGGTTGGG + Intronic
1164475286 19:28570879-28570901 GCCCTTCCGCAGCTCAAGCTGGG - Intergenic
1164479804 19:28602618-28602640 TCCCTCCCACTCCTCAGGTTTGG + Intergenic
1166560803 19:43731360-43731382 GGGCTACCCCATCTCAGGTTTGG + Exonic
926012921 2:9423040-9423062 CGCCTCCCGCCTCTCAGGGTCGG - Exonic
926518845 2:13884026-13884048 GCCCTCCAGCATCTAAGATCTGG - Intergenic
935733994 2:106091664-106091686 GTGCTCCTGCATCTCAGGATTGG - Intergenic
937065242 2:119012491-119012513 GCCTTCACGCAACTCATGTTGGG + Intergenic
942045550 2:172097318-172097340 GCCCTCCCGACTCCCAGGCTTGG + Intergenic
946321195 2:218955495-218955517 GCCCTCCAGCATCTCAGCATTGG + Intergenic
1168816553 20:741644-741666 CCCCTCCCAAATCTCAGGTGGGG + Intergenic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1183672315 22:39280268-39280290 GCCCTCCCGTTTCTCAGCTGAGG + Intergenic
952843769 3:37669501-37669523 GTTCTACCGCATCTCAGGATAGG - Intronic
955062544 3:55505821-55505843 GCCCTCTCCCACCTCAGGGTTGG + Intergenic
968815594 4:2820084-2820106 GTCCTCCAGCATCTGAGGCTTGG + Intronic
968843623 4:3026709-3026731 GCTCTCCCGCCTCCCAGGGTGGG + Intronic
969710059 4:8837656-8837678 GCCCTCCTCCATCTCCTGTTTGG + Intergenic
971405378 4:26317799-26317821 GCCCTCCCCCATCTCAGGAAAGG - Intronic
981531912 4:145761730-145761752 GCCCTGCCGCCTCTCAGGGGTGG + Intronic
985030877 4:185788035-185788057 GCCCTCTCCCATCTCAGATCTGG - Intronic
985187658 4:187334899-187334921 GCTCTCCCTCATCTGCGGTTGGG + Intergenic
985517512 5:354471-354493 GGGCTCCTGCATCTCAGGTGGGG + Intronic
986460354 5:7964019-7964041 GCTCTCCTGCAACTCAGGTATGG + Intergenic
1000365238 5:160484592-160484614 TCCCTCCCTCTTCTCAGGCTTGG - Intergenic
1001965617 5:175908010-175908032 CCCCTCACCCATCTCAGGCTTGG + Intergenic
1002251332 5:177931185-177931207 CCCCTCACCCATCTCAGGCTTGG - Intergenic
1005195022 6:23272246-23272268 TCCCTCCAGGATCTCAGTTTTGG + Intergenic
1007091990 6:39190377-39190399 GCCCGCCCGCATCCCAGCTGTGG - Exonic
1007181502 6:39932337-39932359 GCCCTCCCCCATCTTATGATGGG + Intronic
1007592968 6:43034459-43034481 GCAGTCCCGAATCTCAGGGTGGG + Intergenic
1012148733 6:95718753-95718775 GCCCTCCCCCATAACAGGTCTGG - Intergenic
1018858876 6:167696345-167696367 GCCCTCCCCCATCAGAGGATGGG - Intergenic
1019047363 6:169159403-169159425 GCCCTGCCGCATCTCTGGGCTGG + Intergenic
1019048776 6:169167740-169167762 GCCCTGCCGCATCTCCGGGCTGG + Intergenic
1020347687 7:7182875-7182897 GCCCTCCCCCCTCTCCGGGTTGG + Intronic
1020461996 7:8436703-8436725 GCACTCCCGCAGCCCAGGATGGG - Intronic
1021189351 7:17602444-17602466 GCTCTCCCCCATCACAGGTGTGG + Intergenic
1030388184 7:108891746-108891768 GCCCTCCCTTCTCTCAGCTTTGG + Intergenic
1035153123 7:156892370-156892392 GCCCGCCCGCCTCTCGCGTTTGG - Intronic
1041363214 8:57073244-57073266 CACCTCCCCCATCTCAGGTAGGG - Intergenic
1043516662 8:81001120-81001142 ACCCTCCCACCTCTCAGGTGTGG + Intronic
1044259277 8:90098524-90098546 ACCCTCCCCCGTCGCAGGTTCGG - Intergenic
1049708162 8:144052171-144052193 GCTCTCCAGGATCTCAGGGTCGG + Exonic
1056797799 9:89670509-89670531 GCCCTCCTAAATCTCAGATTGGG + Intergenic
1057003147 9:91531488-91531510 GCTCTCCCGAATGTCTGGTTAGG - Intergenic
1060591858 9:124821948-124821970 GACCTTCAGCATCTCAGGTTGGG + Intergenic
1060984244 9:127810469-127810491 GGGCACCCGCTTCTCAGGTTTGG + Intronic
1062364814 9:136203503-136203525 GTCCTCCCGCCGCTGAGGTTTGG + Intronic