ID: 1182288127

View in Genome Browser
Species Human (GRCh38)
Location 22:29259972-29259994
Sequence CTTTAGACAGAGTAGGAGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 180}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182288116_1182288127 9 Left 1182288116 22:29259940-29259962 CCAGAGGTGCCCCTGCTCCCCAC 0: 1
1: 0
2: 5
3: 43
4: 401
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288123_1182288127 -10 Left 1182288123 22:29259959-29259981 CCACTGTGGCCCTCTTTAGACAG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288115_1182288127 12 Left 1182288115 22:29259937-29259959 CCTCCAGAGGTGCCCCTGCTCCC 0: 1
1: 0
2: 2
3: 46
4: 381
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288121_1182288127 -8 Left 1182288121 22:29259957-29259979 CCCCACTGTGGCCCTCTTTAGAC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288113_1182288127 21 Left 1182288113 22:29259928-29259950 CCTCTCCTGCCTCCAGAGGTGCC 0: 1
1: 0
2: 7
3: 56
4: 580
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288118_1182288127 0 Left 1182288118 22:29259949-29259971 CCCCTGCTCCCCACTGTGGCCCT 0: 1
1: 0
2: 2
3: 93
4: 578
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288120_1182288127 -2 Left 1182288120 22:29259951-29259973 CCTGCTCCCCACTGTGGCCCTCT 0: 1
1: 0
2: 6
3: 69
4: 1343
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288119_1182288127 -1 Left 1182288119 22:29259950-29259972 CCCTGCTCCCCACTGTGGCCCTC 0: 1
1: 1
2: 1
3: 48
4: 500
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288122_1182288127 -9 Left 1182288122 22:29259958-29259980 CCCACTGTGGCCCTCTTTAGACA 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180
1182288114_1182288127 16 Left 1182288114 22:29259933-29259955 CCTGCCTCCAGAGGTGCCCCTGC 0: 1
1: 1
2: 6
3: 36
4: 493
Right 1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182288127 Original CRISPR CTTTAGACAGAGTAGGAGCT CGG Exonic
900691375 1:3982538-3982560 CTCCAGACAGAGGAGGAACTTGG - Intergenic
902420658 1:16277145-16277167 TTTAAGACAGAATAGAAGCTAGG + Intronic
903884019 1:26530725-26530747 CTTCTGAGAGAGAAGGAGCTGGG - Intronic
905805781 1:40876408-40876430 CCTAACACAAAGTAGGAGCTTGG + Intergenic
906780561 1:48569331-48569353 CATGTGACAGAGTAGGTGCTTGG + Intronic
908851908 1:68385467-68385489 CTATAGGCAGAGCAGCAGCTTGG - Intergenic
909308134 1:74108219-74108241 CTTTATACAGAGTATGATTTCGG - Intronic
911502332 1:98703483-98703505 CTGTAGACAGAGTAGGAGAAAGG + Intronic
914424786 1:147565836-147565858 CTTGGGACATAGTAGGTGCTTGG + Intronic
915490274 1:156246757-156246779 CTAGAGACAGAGTGGGAGGTAGG + Intronic
915832110 1:159140737-159140759 ATTTAGCCAGATTGGGAGCTTGG - Intronic
916796538 1:168172623-168172645 CATCAGAGAGAGAAGGAGCTGGG - Intergenic
916949243 1:169762130-169762152 TTTTTCACAGAGTAGGGGCTGGG - Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
918777194 1:188648845-188648867 AATTAGACAGAGTTGCAGCTAGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
923566928 1:235083340-235083362 ATTTAGACACAGTGGCAGCTGGG + Intergenic
924321438 1:242854958-242854980 CTTTAGATTGTGTGGGAGCTGGG - Intergenic
1062995636 10:1863765-1863787 ATTGAGACAGAGCAAGAGCTAGG + Intergenic
1063236277 10:4119871-4119893 CTTTAGACAGAAAAAGAGATAGG - Intergenic
1067200960 10:44171798-44171820 CTTTAAGCAGAGTAGGGACTGGG + Intergenic
1068436024 10:56992095-56992117 CTTTAGAGACAGTTTGAGCTGGG - Intergenic
1069681027 10:70285363-70285385 CTCTGGACAGAGGAGGAACTAGG - Intergenic
1069939919 10:71948350-71948372 CTCTAGACAGAGTAGGACTAAGG + Intergenic
1070920795 10:80184685-80184707 CCTTAGGAAGAGTATGAGCTTGG + Intronic
1070932242 10:80269547-80269569 CTTGGCACAGAGTAGGTGCTTGG - Intergenic
1072680182 10:97500113-97500135 TTTGACACAGAGTAGGAGATGGG - Intronic
1072816569 10:98515193-98515215 CTTAAGACAGGGTAGGATCCAGG + Intronic
1073114889 10:101086299-101086321 CTCAGGACAGAGTAGGCGCTAGG + Intergenic
1073320758 10:102615010-102615032 CTTTTTACAGAGGAGGAACTGGG - Intronic
1076001893 10:126919006-126919028 CTTTAGACAGCCAAGAAGCTTGG - Intronic
1077629634 11:3802369-3802391 ATTTAGACAGAGTAGGAGTGTGG - Intronic
1080877394 11:36289290-36289312 CTTTAGACGGAGCAGGAATTGGG - Intronic
1080880178 11:36312448-36312470 CTTTACACCAAGTAGGTGCTTGG + Intronic
1082771806 11:57213591-57213613 CTTGAGAGAGAGGAGGGGCTGGG - Intergenic
1083057486 11:59836933-59836955 CTTTGCACATAGTAGGAGCTAGG + Intronic
1083349153 11:62014814-62014836 CTATAGACAGAGAAGCAGCTTGG - Intergenic
1085749394 11:79147602-79147624 CTTTAGCCAGAGGAGAAGATAGG - Intronic
1087303567 11:96463060-96463082 CTTTTGACTTACTAGGAGCTGGG + Intronic
1087860619 11:103150006-103150028 CTTAAGGTAGAGAAGGAGCTTGG + Intronic
1089806630 11:121096462-121096484 CTTTAGCCAGAGTAGGGGCAGGG + Intergenic
1089900679 11:121980559-121980581 GTCTAGACAGAGTAGGAGAGTGG + Intergenic
1092079625 12:5704667-5704689 CTTTAGCAAGAGTAAGTGCTTGG + Intronic
1092488035 12:8919694-8919716 ATTTACATAGAATAGGAGCTAGG + Intronic
1093509186 12:19905722-19905744 ATTAAGAAAGAGTATGAGCTGGG + Intergenic
1093675927 12:21940773-21940795 CTTAAGACAGTGTAGGAAGTCGG - Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1095675645 12:44914670-44914692 CTTAACACAGAGTAGCTGCTCGG + Intronic
1100929298 12:99587054-99587076 AATTAGACAAAGTGGGAGCTAGG + Intronic
1106466946 13:30021945-30021967 TTTTAAACAGAGTAAGATCTAGG + Intergenic
1107456729 13:40562437-40562459 CTTAAGACACATTAGGGGCTAGG - Intronic
1113346494 13:109483061-109483083 CCTTGGACAGAGGAGGAGCGGGG - Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1117158324 14:52962622-52962644 CTTTAGGCAGAAAAGGAGGTTGG - Intergenic
1117878167 14:60278224-60278246 TCTTAGACAGATTAGGAGCCTGG - Intronic
1118469812 14:66065458-66065480 CATTAGACTGAGAAGGGGCTGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120080700 14:80212872-80212894 CTCCAGACAGGGAAGGAGCTAGG + Intronic
1121350054 14:93166352-93166374 CTTTACAAATATTAGGAGCTAGG + Intergenic
1124871805 15:33551061-33551083 AGTTAGACAGAGTAGAAGCTTGG - Intronic
1126106612 15:45150960-45150982 CTATAGACAGAGTCTGATCTTGG - Intronic
1126504901 15:49393710-49393732 CAGTAGTCAGGGTAGGAGCTTGG - Intronic
1129899019 15:79131302-79131324 CTATAGAAAGAATAGGGGCTAGG - Intergenic
1130043501 15:80426261-80426283 CTTTGGTCACAGAAGGAGCTAGG - Intronic
1131202143 15:90408185-90408207 CTTTTTACAAAGTAGGTGCTTGG + Intronic
1133644326 16:7749152-7749174 CTTTAGACACATTTGTAGCTAGG + Intergenic
1134605859 16:15570692-15570714 CTGTAGGCAGGGTAGCAGCTTGG + Intronic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1136899178 16:34016436-34016458 CCTTAGCCACAGTAGTAGCTGGG - Intergenic
1137868903 16:51930594-51930616 CTTTAGAAAATGTATGAGCTTGG + Intergenic
1138230628 16:55333146-55333168 CTTTAGCCATAGAAGGAGTTTGG - Intergenic
1139204767 16:65016782-65016804 CCATAGACAGAGTAGCAGCATGG + Intronic
1141822582 16:86457209-86457231 CTCCAGACAGAGTATGGGCTTGG + Intergenic
1142472000 17:169851-169873 ATTTACACAGAGAAGGAACTGGG + Intronic
1148260940 17:46183130-46183152 CTAAAGAATGAGTAGGAGCTGGG + Intronic
1148977930 17:51545867-51545889 CTTTGCACATAGTAGGGGCTTGG + Intergenic
1149482595 17:57015960-57015982 CTTAAGACAGAGTAGAAACAGGG + Intergenic
1150436418 17:65157690-65157712 CTTTTGTCAGGGTAGGAGGTTGG - Intronic
1152678584 17:81654114-81654136 CTTTCATCAGAGTAGCAGCTGGG - Intronic
1158254449 18:55530306-55530328 TTTTAGAAAGAGTAGGGGGTTGG + Intronic
1159219280 18:65438774-65438796 CTTTACACAGAGTAGGATATTGG + Intergenic
1161744750 19:6049047-6049069 CTTTTGAAAGAGTAGAAGGTAGG - Intronic
1162952919 19:14082457-14082479 CTTTATTCATGGTAGGAGCTAGG - Exonic
1166211459 19:41309235-41309257 CTGAAGAACGAGTAGGAGCTGGG - Intronic
1168327096 19:55544041-55544063 CTTGGGACAGAGTTGGACCTGGG + Intronic
925803374 2:7624714-7624736 CTTTAGACAGAGAAGCAGAGGGG - Intergenic
925914996 2:8598365-8598387 CGTTAAACAGAGCAGGAGATGGG + Intergenic
926573807 2:14558721-14558743 GTTTAGACATAGTAGTTGCTGGG - Intergenic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
929490344 2:42390810-42390832 TTTCAGACAGATTTGGAGCTAGG - Intronic
931447930 2:62342610-62342632 CTTGACACATAGTAGGTGCTCGG - Intergenic
932481125 2:72039979-72040001 CTTGAGTCAGGGAAGGAGCTGGG - Intergenic
933141738 2:78799968-78799990 AGTTAGACAGTGTAGGGGCTGGG + Intergenic
933168271 2:79097751-79097773 CAGTAGACAGGGCAGGAGCTTGG + Intergenic
934204061 2:89910665-89910687 CTCCAGGCAGAGCAGGAGCTGGG - Intergenic
934760677 2:96854565-96854587 CTTGACACAGAGGAGGTGCTCGG - Intronic
935019738 2:99218205-99218227 CTTAAGGCAGAGTATGAGTTAGG + Intronic
935619542 2:105116883-105116905 CTTTGGAAAGGGTAGGAGCAGGG - Intergenic
936965741 2:118126085-118126107 CTTTGGACAGAGAGGCAGCTTGG - Intergenic
939007808 2:136809421-136809443 TTGTAGACAGGATAGGAGCTTGG + Intronic
939618511 2:144389279-144389301 ATGTAGACGGAGTTGGAGCTGGG - Exonic
940271028 2:151890275-151890297 CTTTAGTCAGATTAACAGCTGGG - Intronic
942202196 2:173582545-173582567 TTTTAGACAGAGCAGTAACTTGG - Intergenic
942449574 2:176100472-176100494 CAATAGACAGAGTACGGGCTGGG + Intronic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
944952884 2:204772925-204772947 ATTTATAAAGAATAGGAGCTGGG - Intronic
946132533 2:217617975-217617997 TTTCAGACACAGGAGGAGCTGGG + Intronic
946848005 2:223878246-223878268 CTGTTGTCAGAGCAGGAGCTGGG - Exonic
948422874 2:237871263-237871285 CTTTAGACAGAGCAGGGGCAGGG + Intronic
1169041485 20:2499143-2499165 GTTTGGACAGAGTTGGAGGTAGG + Intronic
1169619721 20:7491759-7491781 GGTTAGACAGAGTAAGAGCCTGG + Intergenic
1171128703 20:22628064-22628086 CCTTAGAGAGAGGAGAAGCTGGG + Intergenic
1171300498 20:24055635-24055657 CTTTGGAGGGAGGAGGAGCTGGG - Intergenic
1172227811 20:33316929-33316951 CTGAAGGCAGAGTAGGTGCTGGG - Intergenic
1172814367 20:37674518-37674540 CTTGGCACAGAGTAGGTGCTCGG - Intergenic
1173136649 20:40444529-40444551 CTTTAGAGAGAGCTGAAGCTAGG + Intergenic
1174087966 20:48023127-48023149 ATTTAGACAAAGCAGGAGATAGG + Intergenic
1175165150 20:57038322-57038344 CTTGGCACACAGTAGGAGCTCGG - Intergenic
1177596928 21:23256499-23256521 CTTTAGAAACATCAGGAGCTAGG - Intergenic
1180056976 21:45364035-45364057 CCTGACACACAGTAGGAGCTTGG + Intergenic
1182213759 22:28698889-28698911 CTTAACTCAGAGTGGGAGCTGGG - Intronic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1183668136 22:39256783-39256805 CTTTAGACAGAAACGGATCTAGG + Intergenic
951586647 3:24221671-24221693 CTTTATAGAGAGTAGAAGGTGGG - Intronic
952168690 3:30780329-30780351 CTTCAGAGAGAGTATGACCTTGG - Intronic
952646112 3:35661050-35661072 TTTTACACCTAGTAGGAGCTGGG + Intronic
953740127 3:45530997-45531019 CTTGAGACAGACCATGAGCTAGG - Intronic
957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG + Intergenic
957774095 3:84733403-84733425 CTTCAGACTGAGAAGGAGTTGGG - Intergenic
959585551 3:108022060-108022082 CTTGAGACAGAGTAGGAACAAGG + Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962535650 3:136326916-136326938 TTTTTGACAGAGTGGGGGCTAGG + Intronic
963906926 3:150780313-150780335 CCTTGGAGAGAGTAAGAGCTGGG - Intergenic
964266666 3:154904688-154904710 ATTTAGAGGGAGTTGGAGCTGGG - Intergenic
964630048 3:158800793-158800815 ATTTAGAGAGAGAAGGAGGTAGG - Intronic
966760414 3:183413160-183413182 CTTTGAACAATGTAGGAGCTGGG + Intronic
966862440 3:184237957-184237979 CACTTGACACAGTAGGAGCTGGG + Intronic
966974108 3:185070018-185070040 TTTTAAACAGAGTAGGAGACAGG - Intergenic
968673362 4:1864115-1864137 CTTTGGGCTGAGTGGGAGCTGGG + Intergenic
970139334 4:12964222-12964244 CTTTAGTCAGAATAGGAGAGAGG + Intergenic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972319331 4:37958517-37958539 CTTAAGTAAGAGAAGGAGCTAGG - Intronic
972580172 4:40388192-40388214 CTTGACACAGAGGAGGAGCTGGG - Intergenic
975871816 4:78787475-78787497 CGTTAGACAGAGTGGGAGCTGGG + Intronic
979086543 4:116417723-116417745 TTGGAGACAGAGTAGGAGGTAGG + Intergenic
979363799 4:119796262-119796284 CTTAAGAGAGAGTAGGAGGAAGG + Intergenic
980823419 4:138045129-138045151 CTTTATGCAGGGCAGGAGCTGGG - Intergenic
980834469 4:138173952-138173974 GCTTAGACAGAGAAGGGGCTAGG + Intronic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987170609 5:15253509-15253531 ATATAGACAAAGTAGGAGATGGG + Intergenic
988152711 5:27406978-27407000 GTTTAGACAGAGAAGGCACTTGG + Intergenic
990292201 5:54363609-54363631 CTTCAGCCAGAGTGGTAGCTTGG + Intergenic
993636598 5:90351984-90352006 CAGTAGCCAGAGTATGAGCTTGG - Intergenic
995722483 5:115151214-115151236 CTTTGGACTGTGTGGGAGCTGGG + Intronic
998483803 5:142484721-142484743 CTTTAAACAGAGTAGGCACTTGG - Intergenic
1001033945 5:168283458-168283480 CTTTAGAAAGATGAGGAGGTAGG + Intergenic
1001496624 5:172192453-172192475 ATTAAGACAGAGGAGGGGCTGGG + Intergenic
1003602894 6:7534274-7534296 ATTTAAATAGAGCAGGAGCTGGG - Intergenic
1004410094 6:15373242-15373264 CTTGAGACAGAGCAAGAGGTGGG - Intronic
1005353083 6:24955660-24955682 CCTTAGACGGAGTAAGAGATAGG - Intronic
1006020881 6:31116872-31116894 CCTGACACAGAGTGGGAGCTGGG + Exonic
1007048699 6:38803777-38803799 CTCTACACAGAGAAGGATCTAGG - Intronic
1007082261 6:39116052-39116074 CTTTAGACAGAGCAGGCCCTAGG - Intergenic
1012579579 6:100850182-100850204 CTTCTGGCAGTGTAGGAGCTTGG - Intronic
1015884516 6:137903065-137903087 TTTTAAGCAGACTAGGAGCTAGG - Intergenic
1016172738 6:141040292-141040314 CCTTAGGCAGGGAAGGAGCTTGG + Intergenic
1016317498 6:142806944-142806966 CCTGTCACAGAGTAGGAGCTGGG - Intronic
1018347525 6:162917353-162917375 TTTTAGACAGAGTTAGAGATTGG - Intronic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1020712459 7:11624842-11624864 CTTTATACAGAATTGGAACTAGG + Intronic
1023317462 7:38954492-38954514 CTTTAGACAGAGTTTTGGCTAGG - Intergenic
1027723227 7:81770539-81770561 AACTAGACAGATTAGGAGCTGGG - Intergenic
1031952681 7:127908488-127908510 TTTTTCACAGAGTAGGAACTGGG + Intronic
1033546659 7:142407249-142407271 GCTTAGACAGAGTGGGAGCTGGG - Intergenic
1033818453 7:145103913-145103935 CTAAAGACAGAGCAGGAGGTGGG + Intergenic
1034032054 7:147778371-147778393 CTTTACACAGAGTATGATTTGGG + Intronic
1034964914 7:155384881-155384903 CCGTAGACAGAGCAGGAGCCAGG - Intronic
1035909851 8:3554537-3554559 CTTCCAACAGAGCAGGAGCTGGG - Intronic
1036387151 8:8292422-8292444 TTTTAAATAGAGTAGGGGCTGGG - Intergenic
1038328704 8:26591120-26591142 CCATAGGCAGAGTAGGAACTGGG - Intronic
1039392010 8:37189004-37189026 CTTAAGACAGAAGAGGAGCATGG - Intergenic
1041174564 8:55181076-55181098 CTCGAGACATAGTAGGAGCTTGG - Intronic
1042040831 8:64586914-64586936 CTTTAGACACAGTAGGTGGAAGG + Intergenic
1042137229 8:65644265-65644287 CTTTAGGCAGAGCAGGAGTGCGG - Intergenic
1045645595 8:104294028-104294050 CTTGTAACAAAGTAGGAGCTTGG - Intergenic
1048080490 8:131121322-131121344 CTTAAGACAGAGAAGCAGCAAGG + Intergenic
1049248760 8:141577113-141577135 CTTAAGAAAGAGTGGGGGCTGGG - Intergenic
1050987547 9:12102232-12102254 TTTTAGACAGGGCTGGAGCTGGG + Intergenic
1051530466 9:18096484-18096506 CTGTGGCCAGAGTAGGAGATGGG + Intergenic
1051636043 9:19181920-19181942 CCATAGACAGAGTAGAAGCACGG - Intergenic
1058060225 9:100487462-100487484 CTTTAGAGAGAGAAGGAGGCTGG - Intronic
1058837719 9:108873939-108873961 CTCTAGACAGAAGAGGAGCTAGG + Intronic
1059204503 9:112451559-112451581 CTTTAAAAAGAGCAAGAGCTGGG - Intronic
1060679769 9:125551895-125551917 CTTTAGACAAAGTAGGACAAGGG - Intronic
1061293805 9:129666516-129666538 CTTAAGACCGAGGAGGAGCTGGG - Intronic
1187028000 X:15456089-15456111 CTATAGACTTATTAGGAGCTTGG - Intronic
1195922854 X:110000865-110000887 CCATAGGCAGAGTAGCAGCTTGG + Intergenic
1197963364 X:132029802-132029824 CAATAGACAGAATAGGTGCTTGG - Intergenic
1199367152 X:147000557-147000579 CTATAGGCAGAGCAGCAGCTTGG + Intergenic
1199404928 X:147445525-147445547 CTGTAGACAGAGCAGCAGCATGG - Intergenic