ID: 1182289380

View in Genome Browser
Species Human (GRCh38)
Location 22:29266666-29266688
Sequence GCCTGTCCTCCAGGGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182289371_1182289380 19 Left 1182289371 22:29266624-29266646 CCAAAGCAAGGCCTTCTCCCCCG No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289373_1182289380 2 Left 1182289373 22:29266641-29266663 CCCCCGTGCTGTTCTCTTGCATC No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289372_1182289380 8 Left 1182289372 22:29266635-29266657 CCTTCTCCCCCGTGCTGTTCTCT No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289369_1182289380 23 Left 1182289369 22:29266620-29266642 CCCACCAAAGCAAGGCCTTCTCC No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289368_1182289380 27 Left 1182289368 22:29266616-29266638 CCTGCCCACCAAAGCAAGGCCTT No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289376_1182289380 -1 Left 1182289376 22:29266644-29266666 CCGTGCTGTTCTCTTGCATCCAG No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289367_1182289380 28 Left 1182289367 22:29266615-29266637 CCCTGCCCACCAAAGCAAGGCCT No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289374_1182289380 1 Left 1182289374 22:29266642-29266664 CCCCGTGCTGTTCTCTTGCATCC No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289375_1182289380 0 Left 1182289375 22:29266643-29266665 CCCGTGCTGTTCTCTTGCATCCA No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data
1182289370_1182289380 22 Left 1182289370 22:29266621-29266643 CCACCAAAGCAAGGCCTTCTCCC No data
Right 1182289380 22:29266666-29266688 GCCTGTCCTCCAGGGCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182289380 Original CRISPR GCCTGTCCTCCAGGGCCTGT AGG Intronic