ID: 1182290481

View in Genome Browser
Species Human (GRCh38)
Location 22:29274559-29274581
Sequence GGGAACAGGGGAAAATCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182290481_1182290488 13 Left 1182290481 22:29274559-29274581 CCAGCTGATTTTCCCCTGTTCCC 0: 1
1: 1
2: 0
3: 19
4: 232
Right 1182290488 22:29274595-29274617 GCATGATGAGATTTATTTAGAGG 0: 1
1: 0
2: 0
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182290481 Original CRISPR GGGAACAGGGGAAAATCAGC TGG (reversed) Intronic
900429036 1:2593352-2593374 AGCCACAGGGGAAAACCAGCTGG + Intronic
900587819 1:3441749-3441771 GGAAACAGGGAAAAATCAACAGG + Intergenic
901305931 1:8232676-8232698 AGGAAAAGGGGATTATCAGCAGG - Intergenic
901740773 1:11340253-11340275 GGGAGCTGGAGAAAATCGGCAGG - Intergenic
901764503 1:11491221-11491243 GGGAACAGGGGAGGATGACCAGG + Intronic
901815636 1:11791878-11791900 GGGAAACGGGGAACATGAGCAGG - Intronic
902298640 1:15485812-15485834 GGTAACAGGGGAAATCCAGTAGG + Intronic
903549395 1:24147366-24147388 GGGTACAGAGGAATACCAGCGGG - Intergenic
904395595 1:30219374-30219396 GGGAGCAGGGGGAGAGCAGCAGG + Intergenic
904788583 1:33000676-33000698 GGGCACACGGGAAATTGAGCAGG - Intergenic
906577011 1:46900236-46900258 GGTAAGAGGGGAAAATTAGTTGG - Intergenic
907371382 1:54005732-54005754 GGGAACAGGGGACAGTAAGGTGG - Intergenic
907933199 1:59019024-59019046 GGGAACAGGGAAAGATGAGTAGG + Intergenic
909094328 1:71269041-71269063 TGGAACAGGTGAAAATAAACTGG + Intergenic
911993773 1:104736609-104736631 GGACACAGGGCAATATCAGCAGG + Intergenic
912224151 1:107712951-107712973 CGGGACAGAGGAAAAACAGCAGG + Intronic
912722333 1:112030665-112030687 GGAAACAGGGGAAAAACTTCTGG + Intergenic
913149019 1:116021877-116021899 GGGAACAGTGGAAGATGACCTGG - Intronic
913538341 1:119795621-119795643 GGGAACAGGGCCAGATCTGCAGG - Intronic
914826166 1:151139292-151139314 GGCCACAGGGGAAAATGAGAAGG - Intronic
915351439 1:155229075-155229097 GGGAACAGTGGAAAAATAACCGG + Intergenic
915354222 1:155246255-155246277 GGGAACAGTGGAAAAATAACCGG + Intergenic
915856605 1:159395266-159395288 AGGAACAAGAGAAAATCAGCAGG + Intergenic
917289083 1:173453696-173453718 TGGAACAGAGGAAAATTAACAGG + Intergenic
918635640 1:186771102-186771124 GGGAACATAGGAAATTGAGCTGG - Intergenic
919831070 1:201540217-201540239 CCGAACACAGGAAAATCAGCTGG + Intergenic
919840114 1:201602817-201602839 GGGGACTGGTGAAAGTCAGCAGG - Intergenic
920088579 1:203435837-203435859 AGGAACAGAGGGAAAGCAGCCGG - Intergenic
920243938 1:204573963-204573985 GGGAACCAGAGAAAAGCAGCTGG + Intergenic
921251237 1:213300472-213300494 GGGAAAAAGGGAAACTCAGAGGG - Intergenic
921281531 1:213572461-213572483 GGGAACCAGAGAAAATCAGAAGG - Intergenic
921813212 1:219537833-219537855 GGGAACAGGAGAAGGTCAGTGGG + Intergenic
922134577 1:222812507-222812529 GGGAAAAGGGGGAAAGCAACAGG - Intergenic
923630734 1:235648470-235648492 GGGAACAGGGCCAGATCAGATGG + Intronic
923911081 1:238444761-238444783 GGGAGAAGAGGAAAAGCAGCTGG + Intergenic
1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG + Intergenic
1068464066 10:57364978-57365000 GGGAGCAGGGGCAAATCACTCGG + Intergenic
1070784713 10:79156269-79156291 GAGAACTGGGGAAGAGCAGCGGG - Intronic
1071719421 10:88128395-88128417 TGGAACTGAGGAAAATTAGCTGG + Intergenic
1072409769 10:95190559-95190581 TGGAACAGGGGAGAAGCAGTTGG - Intergenic
1072728258 10:97828059-97828081 GGGAACTGGGGAAATTCCTCCGG - Intergenic
1076074880 10:127525452-127525474 TGGAACTGGGGGAAATCAGCAGG - Intergenic
1077539219 11:3138781-3138803 GGGACCAAGGGAGAAGCAGCTGG + Intronic
1078004353 11:7521387-7521409 GGGAACAGTGGAGAGGCAGCTGG - Intronic
1078802046 11:14656192-14656214 GGGAACATTGGAAGATGAGCTGG + Intronic
1080311311 11:30896375-30896397 GGAAATTGGGGAAAATAAGCTGG + Intronic
1081673222 11:44953305-44953327 GGGACCAGGGGAGAAGCAGCTGG + Intergenic
1083355346 11:62062137-62062159 GAGAGCAGAGGAAAATCAGTTGG - Intergenic
1084874242 11:72119048-72119070 GGGAAGAGGGAAAATACAGCAGG - Intronic
1086880613 11:92149302-92149324 GGGAATAGGGAAGAATCAGAAGG + Intergenic
1088540661 11:110910489-110910511 GGGATTAGGGGAAAATAGGCTGG - Intergenic
1088810941 11:113391685-113391707 GGTTTCAGGGGAAAATCAGGAGG + Intronic
1095291334 12:40483315-40483337 GGGACAAGTGGACAATCAGCTGG + Exonic
1095292423 12:40490918-40490940 GGGAAAAGTGGACTATCAGCTGG + Exonic
1097020892 12:56020306-56020328 GGGAAAAGGGGGAGATAAGCAGG + Intronic
1097158777 12:57030968-57030990 GGCAAAAGAGGAAAATCAGGGGG + Intronic
1097218327 12:57430971-57430993 GGGGGGAGGGGAAAATCAGAAGG + Exonic
1097247068 12:57612537-57612559 GGGAAGAGGGGAGGATGAGCTGG - Intronic
1097606869 12:61766026-61766048 GGGAAGAGAGGAAAATCAAAAGG - Intronic
1098499379 12:71172818-71172840 GGGAAAATGGGAAAATAAACTGG - Intronic
1100969203 12:100049109-100049131 GGGAAAAGGGGAAAAGTAGTTGG + Intronic
1102869156 12:116399958-116399980 AGGATCAGGGGAAACCCAGCTGG + Intergenic
1108673166 13:52712097-52712119 GGGGACAGGAGAAACTCAGGAGG + Intronic
1109164424 13:59015956-59015978 TGGAACATGGGAGAATCATCAGG + Intergenic
1112328964 13:98462481-98462503 GGCATCAGGGGATGATCAGCAGG - Intronic
1113456863 13:110455465-110455487 GGGAACAGGGGAAAAGCAGCAGG - Intronic
1115976664 14:39004278-39004300 CCGAACACAGGAAAATCAGCTGG + Intergenic
1116948338 14:50856759-50856781 GGGAACACTGGAATAACAGCAGG - Intergenic
1117249931 14:53926726-53926748 AAGCACAGGGGAAAATAAGCAGG + Intergenic
1120303983 14:82744479-82744501 GGTGACAGGAGAAAAACAGCTGG + Intergenic
1120542672 14:85769633-85769655 AGGGACAGGGGAGAAACAGCTGG - Intergenic
1121815134 14:96923526-96923548 GGCCACAGAGGAAAATGAGCTGG - Intronic
1122561957 14:102622096-102622118 AGAAACAGTGGAAAATCATCTGG + Intronic
1124410810 15:29435069-29435091 GGGAAGAGGGGAAAATGGGGAGG - Intronic
1130082165 15:80743245-80743267 GGGAGCAGGGGCAAATGGGCAGG + Intronic
1130667440 15:85881555-85881577 AGGAAGAGGGGAAAAGCAGAAGG - Intergenic
1130963823 15:88682433-88682455 AGGGACAGGGGAAAATAAGCTGG - Intergenic
1132242876 15:100274109-100274131 GGGAACATGGGACATTCTGCAGG - Intronic
1132595678 16:748229-748251 GGGAACATGGGAAAGGCTGCCGG + Intronic
1132761245 16:1509540-1509562 GGGAACCCGGGAACACCAGCAGG - Intronic
1133010808 16:2910394-2910416 AGGAACAAGAGAAAATTAGCTGG - Intergenic
1133111086 16:3548764-3548786 GGGAACAGGAGCAAGTGAGCCGG + Intronic
1133833397 16:9344985-9345007 GGGAACAGTGGAAAAGCAGAAGG + Intergenic
1134042837 16:11081356-11081378 GGCAACCTGGGAACATCAGCGGG - Intronic
1134823034 16:17261991-17262013 GGGAAAAGAGGAACATCAGCAGG - Intronic
1137522439 16:49205975-49205997 GGGAAAAGGAGAAAAACAGAGGG + Intergenic
1138132346 16:54491465-54491487 GGGAACTGGTTAAGATCAGCTGG - Intergenic
1138528169 16:57620680-57620702 GGGAGCAGGGGACCCTCAGCTGG - Intronic
1139523531 16:67499175-67499197 GGCAACGGGGGAAAATGAGCAGG - Intergenic
1141563984 16:84888962-84888984 AGGAACTGGGGGAATTCAGCAGG - Intronic
1141852168 16:86653883-86653905 GGGACCAGGAGGAAACCAGCAGG - Intergenic
1145007739 17:19347052-19347074 GGGCACAGGGTAAAATCGCCCGG + Intronic
1145871220 17:28275056-28275078 GGGAACAGGGGACAGGAAGCAGG + Intergenic
1145985413 17:29042795-29042817 CTGAAGAGGGGAAAACCAGCAGG + Intronic
1146950099 17:36899836-36899858 GGGAACAGGGGAAGACAGGCTGG + Intergenic
1148459738 17:47832338-47832360 TTGAAGAAGGGAAAATCAGCTGG - Intronic
1148899951 17:50867587-50867609 GGGAAAAGGGGAAAGTCTGGGGG + Intronic
1150517624 17:65830514-65830536 GTGAACTGGGGACAAACAGCCGG + Intronic
1150589751 17:66551679-66551701 GGGGACAGGGGCAAATTAGAGGG + Intronic
1150990420 17:70251479-70251501 TGGAACTGGGGAGCATCAGCTGG + Intergenic
1151880846 17:76893610-76893632 GGGGACAGGGGACAATCCCCTGG - Intronic
1153655513 18:7278457-7278479 AGGAGCTGGGGCAAATCAGCAGG + Intergenic
1154020504 18:10660507-10660529 GGGAACAAGGGAAAAAGAGAGGG - Intergenic
1155975538 18:32125473-32125495 TGGAACAGGAGAAACTGAGCTGG + Intronic
1157986380 18:52442877-52442899 GGGATCAGGGGTAAAGCAGGTGG + Intronic
1158110129 18:53931554-53931576 GGGTACAGGGGTACATCTGCAGG - Intergenic
1160265427 18:77337753-77337775 AGGTACAGGGGAAAAAAAGCAGG - Intergenic
1161513766 19:4685363-4685385 AGGAACAAGGGAGAGTCAGCAGG + Intronic
1161595370 19:5148577-5148599 GGGAGCTGGGGAAAGGCAGCAGG + Intronic
1162063039 19:8108291-8108313 GGAAACAGGGGAGCAACAGCAGG + Intronic
1162747369 19:12806348-12806370 GGGAAGAGGGGGAAATAAGAGGG - Intronic
1163958099 19:20662541-20662563 GGGACCAGGGGAAGGTCGGCAGG - Intronic
1164283671 19:23791060-23791082 GGGACCACGGGAGAATCATCAGG + Intronic
1164502957 19:28834674-28834696 GAGAACAGGGGAGAAGCACCGGG - Intergenic
1165355973 19:35304292-35304314 GGGATCAGGGGACAACCAGAGGG - Intronic
1168283342 19:55318005-55318027 GGGAAGAGGGGAGAACCAGGGGG + Intronic
1168382155 19:55933048-55933070 GGGAACGGGGGAAACTAATCAGG + Intergenic
926244316 2:11112070-11112092 GGGAACAGGCTAAATACAGCAGG + Intergenic
927665995 2:25033285-25033307 GGGGACAGGAGACAATAAGCTGG - Intergenic
927934489 2:27068606-27068628 GGGAACAGAGGAAACTGATCAGG - Intronic
928952038 2:36821803-36821825 GGGAACAGGGACAAATCAAAAGG + Intergenic
929321797 2:40552592-40552614 GTGAACATGGTAGAATCAGCTGG - Intronic
929601297 2:43206386-43206408 GTGACCATGGGAAAATCTGCAGG + Intergenic
929632306 2:43476211-43476233 GGGAACATGGGAACATAAACAGG + Intronic
929731126 2:44493614-44493636 GGCAACAGGCAAAAATCAGGTGG - Intronic
929828326 2:45327929-45327951 AGGAGGAGGGGAAAATGAGCAGG + Intergenic
933580865 2:84125582-84125604 GGAAAGTGGGGAAAATCGGCCGG + Intergenic
935179897 2:100679872-100679894 GGGTTCAGGGGGAAATAAGCAGG + Intergenic
935602635 2:104938635-104938657 GGAGCCAGGGGAAAATCAGAGGG + Intergenic
935871250 2:107452319-107452341 GGGAAAAGGGAAAACTCACCAGG - Intergenic
938098481 2:128479034-128479056 GAGAACAGAGTAAAATCAGGTGG + Intergenic
939941789 2:148360602-148360624 GTGAATAGGGGAAAAAAAGCAGG - Intronic
942746157 2:179235605-179235627 GAGAAGAGGGTAGAATCAGCAGG - Intronic
946427888 2:219609059-219609081 GGGACCGGGTGAAAAACAGCAGG - Intronic
946848874 2:223885792-223885814 GGGAAGGGGGGCAAATCTGCCGG - Intronic
948036473 2:234862287-234862309 AGGACCAGGGGAAAGCCAGCAGG + Intergenic
948744821 2:240081134-240081156 AGGAAAGGGGGAAAATCAGATGG + Intergenic
1169274217 20:4222026-4222048 TGGAACAGGGGTAGATGAGCGGG + Exonic
1171991414 20:31699411-31699433 GGAAACAGGGGATACTCAGCTGG + Intronic
1173990194 20:47296373-47296395 GAGCCCAGGGGCAAATCAGCTGG + Intronic
1175795564 20:61768519-61768541 AGGCACCAGGGAAAATCAGCAGG + Intronic
1176034068 20:63027981-63028003 GGGAACAGGGCAAGGACAGCTGG - Intergenic
1177149341 21:17438925-17438947 GGGAACAGGGAACACTCAGCAGG - Exonic
1177303124 21:19276709-19276731 GAGAGCAGAGGAAAAACAGCTGG - Intergenic
1181275159 22:21683465-21683487 GGGAGCAGGGGAACCTGAGCAGG - Intronic
1181337445 22:22149623-22149645 GGGAACAGGAGAATAACTGCTGG + Intergenic
1181775255 22:25154654-25154676 GGGAAAGGGGGAAAACCAGTCGG - Intronic
1182290481 22:29274559-29274581 GGGAACAGGGGAAAATCAGCTGG - Intronic
1183257978 22:36775460-36775482 GGGAGCAGGGGGAAATCCACTGG + Intronic
1184694846 22:46133510-46133532 GGCTACAGGGGAACATCGGCTGG + Intergenic
951416462 3:22429401-22429423 GGGCACATGAGAAAATCACCTGG - Intergenic
952950034 3:38515495-38515517 GGGAAAAGTGGAAAATTATCTGG + Intronic
954063861 3:48090330-48090352 GGGAACAAGAGAAAAGGAGCAGG + Intergenic
956979290 3:74616846-74616868 GGGACTAGGGAAAAATCACCTGG - Intergenic
961371183 3:126433045-126433067 TGGAAGAGGGGAAAACCGGCAGG - Intronic
962013881 3:131421099-131421121 GGGAGCAGGGGAGAACCAGAGGG - Intergenic
965208919 3:165759228-165759250 GGGAGAAGGGGAGAAGCAGCTGG + Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969113766 4:4859375-4859397 GAGAACAAGGGAAAATCCCCCGG + Intergenic
973666195 4:53162135-53162157 GGGAAAAAGGAAAAATAAGCAGG - Intronic
975188243 4:71428621-71428643 GGGGACAGGAGAAAATTAGCAGG + Intronic
976440101 4:85063358-85063380 GAGAAGAAGGGAGAATCAGCAGG + Intergenic
978484995 4:109242569-109242591 AGGAACAGGGAAGAATCATCCGG - Intronic
978776797 4:112513807-112513829 AGGAAAAGGGAAAAATCAGGAGG - Exonic
980982107 4:139663507-139663529 GGGAAGAGAGGAACAACAGCAGG - Intergenic
983185971 4:164700818-164700840 GGGAACAGGTGAACAGCAACTGG - Intergenic
984040465 4:174726567-174726589 GGCAACATGGCAACATCAGCAGG - Intronic
984181881 4:176493744-176493766 GGGAACACAGGAAAATCCACTGG + Intergenic
986312329 5:6561246-6561268 GAAAACAGAGGAAAATTAGCTGG + Intergenic
986321763 5:6637280-6637302 GGGAACAGGGTAAATGCAGCGGG - Intronic
987875883 5:23680676-23680698 GGGAAGAGGGGAATATCACAGGG + Intergenic
992755074 5:79896594-79896616 GGGAAGTGGGGAAAGTTAGCAGG - Intergenic
992770244 5:80040887-80040909 GGGAAGAGGGGAAAACCTGAGGG + Intronic
995355980 5:111238187-111238209 GGAAACAGGGAGAAATCAGGAGG - Intronic
995563437 5:113408027-113408049 GGGAACAGAGGAAAAGCAAAGGG + Intronic
996028862 5:118683149-118683171 GGTAGGAGGGGAAAAGCAGCAGG - Intergenic
998607319 5:143648429-143648451 TGGAAAAGGGGAAAGTCATCTGG - Intergenic
999602140 5:153278966-153278988 GGGCACAAGGGAAAATGTGCTGG - Intergenic
1000111405 5:158111604-158111626 GGGAACTGGGGAAAGGAAGCGGG + Intergenic
1000845956 5:166280456-166280478 GGGAGAAGAGGAAAAGCAGCTGG + Intergenic
1002556661 5:180046939-180046961 AGGAAAAGGGGAAAAACAACAGG + Intronic
1002823950 6:755753-755775 GGCTACAGGGAAACATCAGCAGG + Intergenic
1003105611 6:3212912-3212934 GAGAATAGGGGAAGAGCAGCTGG + Intergenic
1003629975 6:7777946-7777968 GGGAAAGGGGGAAAAACAGAAGG - Intronic
1003925801 6:10876610-10876632 GGAAGAAGGGGAAAATTAGCTGG + Intronic
1005683457 6:28229380-28229402 TGGAAAAGGGGATACTCAGCAGG - Intronic
1005842046 6:29749926-29749948 AGGAAAAGGGGGAAATCAGAAGG - Intergenic
1006398164 6:33800520-33800542 GGGAAAAGGTGGAACTCAGCTGG - Intronic
1006902316 6:37511122-37511144 GGGAATAAGGGAAATTCAGAGGG - Intergenic
1008555890 6:52672558-52672580 GAGAACATGGGAACAGCAGCAGG - Intronic
1008647965 6:53534568-53534590 AGAAACGGGGGAAAATCAGTGGG + Intronic
1009884233 6:69605183-69605205 GGGAAAAGTGGGAAACCAGCAGG + Intergenic
1012994364 6:105958796-105958818 GAGACTAGGGGAAAATAAGCGGG - Intergenic
1014293588 6:119590169-119590191 GAGAACAGAGGAAAAAAAGCAGG + Intergenic
1014300645 6:119677353-119677375 AGGAATAGGGGAAAAGCAGGGGG - Intergenic
1015562769 6:134534425-134534447 GGGAACACGGTAAGATCAGTGGG - Intergenic
1016298646 6:142604279-142604301 GAGAAAAGAGTAAAATCAGCTGG + Intergenic
1016927910 6:149371318-149371340 GGGCACAGGGAACAATCAACAGG - Intronic
1016992951 6:149942343-149942365 GGGAAGAGGCGAAAAGGAGCGGG + Intronic
1018152672 6:160955040-160955062 GGCAACATGGCAAAATTAGCCGG + Intergenic
1018762570 6:166904565-166904587 GGGAAGAGGAGAAAGGCAGCAGG + Intronic
1020461861 7:8435923-8435945 GGGAACCCCGGAAAATCCGCAGG - Intronic
1021938319 7:25653368-25653390 CCCCACAGGGGAAAATCAGCAGG + Intergenic
1022130624 7:27401472-27401494 GGGAGCAGGGGAATATCAGAGGG - Intergenic
1022340918 7:29467502-29467524 GAGAACCTGGGCAAATCAGCAGG + Intronic
1022375699 7:29808743-29808765 AAGAACAGGGGAAAGCCAGCTGG + Intronic
1023498577 7:40824390-40824412 GGGAGGAGGGGAAAAACATCAGG + Intronic
1023975586 7:45027466-45027488 GGGAAGTAGGGAAAATGAGCTGG + Intronic
1024286016 7:47758217-47758239 GGGAGAAGGGGAAAAATAGCAGG - Intronic
1024545310 7:50512792-50512814 GGGAAAAGAGGAAAATAAGGGGG - Intronic
1024557591 7:50616792-50616814 TGGAACAGGGGGACATCACCAGG - Intronic
1024885217 7:54133967-54133989 CAGAACATGGGAAAAACAGCTGG - Intergenic
1028230387 7:88300722-88300744 GGGAAAAGGGTAAAAGAAGCAGG - Intronic
1028892201 7:96001103-96001125 GGGAACTGGATAGAATCAGCTGG - Intronic
1031552768 7:123134930-123134952 GGGAACAGGTGAAAATTAGTGGG + Intronic
1032175793 7:129624798-129624820 GAGAACAGAGTAAAATCAGTAGG - Intronic
1032518040 7:132521592-132521614 GGGGTCAGGGGAAAAAGAGCTGG - Intronic
1034321207 7:150184400-150184422 TGGAACAGAGGAAAACCAACTGG - Intergenic
1034771540 7:153782864-153782886 TGGAACAGAGGAAAACCAACTGG + Intergenic
1035411349 7:158645256-158645278 GGCAACAGGTGAAAATGAACAGG + Intronic
1035577698 8:718563-718585 GGGAACAATGTAAAGTCAGCTGG + Intronic
1036126485 8:6067759-6067781 GGGAAGAGGGGTTAAGCAGCTGG - Intergenic
1038437320 8:27545297-27545319 GGGCAGAGGGGAAGATGAGCTGG - Exonic
1038659911 8:29488125-29488147 GGGTACATGGTAAAACCAGCAGG + Intergenic
1039954659 8:42197662-42197684 AGGGACAGGGGAAAGTCAGTGGG + Intronic
1041073036 8:54143749-54143771 GGGAGCAGGGGAACACCAGGAGG - Intronic
1042346366 8:67732173-67732195 TTGAACAGGGAGAAATCAGCAGG + Intronic
1046556456 8:115779383-115779405 GGGAAGAGAGGAAAAGCAGCAGG - Intronic
1048296645 8:133219453-133219475 GGGAATAGGGTTAAATCAGGTGG - Intronic
1048302213 8:133260149-133260171 GGGAACAGGGAAGAAACAGAGGG - Intronic
1049231794 8:141488485-141488507 GGCAACAGGGGAGAGGCAGCAGG - Intergenic
1049265576 8:141666194-141666216 GGGAAGTGAGGAAAATCACCAGG - Intergenic
1049503860 8:142984424-142984446 GGGAAAGGAGAAAAATCAGCTGG - Intergenic
1051681918 9:19616112-19616134 GGGAACTGGAGAAAATTAGAGGG + Intronic
1052799110 9:32951074-32951096 GGCAACAGGTGAAGGTCAGCAGG - Intergenic
1053475036 9:38376554-38376576 GGGTACCGGGGAAAATCCCCGGG + Intergenic
1056900459 9:90594568-90594590 AGGAACAGAGGAAAAGCAGCAGG + Intergenic
1058383597 9:104407279-104407301 GGGAACAGGGGAAAAACCATGGG + Intergenic
1059306068 9:113354158-113354180 GGTAACAGGAGAAAATCACTGGG + Intronic
1061196795 9:129110987-129111009 GGGGACAGGGGAGAGACAGCTGG - Intronic
1061667015 9:132166467-132166489 GGGATAAGGAGAAAATCCGCAGG - Exonic
1185592260 X:1285334-1285356 GGTGACAGAGGAAAATCAGCAGG + Intronic
1185840298 X:3383368-3383390 GGGAACATGGCAAAAGCTGCAGG - Intergenic
1186946842 X:14578102-14578124 GGGAAGAGAGGAAAGTCAACAGG - Intronic
1188422332 X:30005271-30005293 GGGAGGAGGGGAGAATGAGCAGG - Intergenic
1189010732 X:37043588-37043610 GGGAGGAGGGGAAAAGCAGTGGG + Intergenic
1189035671 X:37491967-37491989 GGGAGGAGGGGAAAAGCAGTGGG - Intronic
1192130313 X:68543442-68543464 GGGAACAGGGGAAGATAGACAGG + Intergenic
1192266189 X:69539497-69539519 GGGAACAGGGGAAAAAGAGAGGG - Intergenic
1196030502 X:111091179-111091201 GGGAACAGGGCAAAAGCTGGGGG + Intronic
1197340710 X:125263449-125263471 GGGAAAAGAGGAGAAACAGCTGG - Intergenic
1199637911 X:149830601-149830623 GGGAACACAGGAGAAACAGCCGG + Intergenic
1201576391 Y:15465882-15465904 GGCACCAGTGGAAAATCAGTTGG + Intergenic