ID: 1182291386

View in Genome Browser
Species Human (GRCh38)
Location 22:29282672-29282694
Sequence ATAAGTCATCTGACCATACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182291384_1182291386 29 Left 1182291384 22:29282620-29282642 CCAGCTTGCTTTGACTTCTTCAG 0: 1
1: 0
2: 0
3: 21
4: 244
Right 1182291386 22:29282672-29282694 ATAAGTCATCTGACCATACTTGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182291386 Original CRISPR ATAAGTCATCTGACCATACT TGG Intronic
901278785 1:8014745-8014767 TTAAGACATGCGACCATACTAGG + Intronic
905785459 1:40753060-40753082 AAAAGTCGTCTTACCTTACTTGG + Intronic
909777207 1:79496495-79496517 ATAAGTTTTCTCACCTTACTTGG - Intergenic
911431200 1:97789367-97789389 ATATGGCTTCTGACTATACTGGG + Intronic
911757220 1:101572570-101572592 ATAACCCATTTGACCATGCTTGG - Intergenic
911772925 1:101770192-101770214 AGAAGTGCTCTGACCTTACTGGG - Intergenic
913277177 1:117149709-117149731 AAAAGTACTCTGAACATACTTGG + Intronic
913699985 1:121365119-121365141 TTGAGTAATCTGACCATAATTGG + Intronic
914040534 1:144045573-144045595 TTGAGTAATCTGACCATAATTGG + Intergenic
914137553 1:144914906-144914928 TTGAGTAATCTGACCATAATTGG - Intronic
914259045 1:145983411-145983433 CTTTCTCATCTGACCATACTTGG + Intergenic
920487402 1:206383840-206383862 TTGAGTAATCTGACCATAATTGG + Intronic
920536654 1:206741750-206741772 ACAAGTCATCTGCTCATAGTTGG - Intergenic
921052958 1:211524271-211524293 ATAAGTCACTTGACCCCACTTGG + Intergenic
1065996050 10:31060381-31060403 AAAAAGCATCTGACCATATTCGG - Intergenic
1068252601 10:54463405-54463427 ATAAGTCATCTATCCTTACTAGG - Intronic
1078216158 11:9313942-9313964 ATAAGTCATATACCCACACTGGG + Intronic
1078755837 11:14208656-14208678 TTAACTCATCTGAGCATATTTGG + Intronic
1079584320 11:22107055-22107077 CTAAGTCATTTAACCATCCTTGG - Intergenic
1080004277 11:27389743-27389765 ACAAGTCATCTGACCTCTCTTGG - Intronic
1081102931 11:39027634-39027656 ATAAGACATCTGGCAATACCTGG + Intergenic
1082038221 11:47663407-47663429 GTGAGTCATCTGACCACCCTGGG - Intronic
1083980971 11:66169218-66169240 ATAAGTCCTCTTAGCAAACTTGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092785380 12:12021973-12021995 ATAAATCATCTGAGCATATCAGG + Intergenic
1103060969 12:117858374-117858396 GAAACTCATCTGGCCATACTGGG + Intronic
1105733169 13:23240612-23240634 ACATGTTATCTGACCATAGTGGG + Intronic
1106898108 13:34327034-34327056 ATAAGTGAGCTTACCTTACTTGG - Intergenic
1110866240 13:80399089-80399111 AAAAGTCATCTTAACTTACTGGG + Intergenic
1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG + Intronic
1114758643 14:25286723-25286745 ATAATACCTCTGACCATATTTGG - Intergenic
1117024069 14:51601948-51601970 ATAAGTCATCTTAGCCTACTTGG + Intronic
1119497737 14:75095106-75095128 ATAAGTCATATTACAGTACTGGG + Intronic
1123452765 15:20382248-20382270 ATAAGTTTTCTGATTATACTAGG + Intergenic
1125322742 15:38506191-38506213 ATTAGTCATCTGTCCAGACAAGG - Intronic
1125790612 15:42362713-42362735 ATAAGTCATTTGCCCTTTCTGGG - Intronic
1128294851 15:66509667-66509689 ATAAGTAAACTCTCCATACTTGG + Intronic
1133493465 16:6294340-6294362 CCAACTCATCTAACCATACTGGG - Intronic
1134651836 16:15915529-15915551 AAAAGCCAACTGACCACACTGGG + Intergenic
1143884994 17:10058661-10058683 ATAAGGCATCTCACCATAGCAGG - Intronic
1147553726 17:41463188-41463210 ACAAGTCATTTGACCTTTCTGGG - Intronic
1149050979 17:52304659-52304681 CTAAGTCATATTACCATATTTGG + Intergenic
1151271739 17:73001896-73001918 ATAAGTTTTCTGAGCATAGTGGG + Intronic
1152028184 17:77825161-77825183 ATAACTCACCTGGCCATGCTAGG + Intergenic
1155953602 18:31938568-31938590 ATAAGTCTCCTGACAATACTTGG + Intronic
1156745071 18:40380583-40380605 CCAGGTCATCTGACCTTACTGGG + Intergenic
1159424513 18:68267874-68267896 ATAACTCATCTGCCTAAACTGGG + Intergenic
1162655534 19:12126296-12126318 AGAAGTTATCTGACCAGGCTGGG - Intronic
1164776939 19:30859982-30860004 TTAAGTCATCTGACCATGATTGG - Intergenic
926482435 2:13415992-13416014 ATAAGTTTTCTGATTATACTAGG - Intergenic
931526261 2:63158162-63158184 GTATGTCCTCTGACCATAATGGG - Intronic
933582553 2:84143858-84143880 ATAAGATATCAGACCATACCAGG + Intergenic
936555870 2:113498588-113498610 ATAATTCAGCTCACCATTCTGGG + Intergenic
938142868 2:128811165-128811187 ATGGGCCATCTGACCATACCAGG + Intergenic
939279554 2:140044646-140044668 AGAAATCATCTGACCATTTTGGG - Intergenic
940063814 2:149603615-149603637 TTATGTCATCTGACTATTCTTGG - Intergenic
944097522 2:195985622-195985644 ATATGTCCTCTGTCCATCCTAGG + Intronic
1182291386 22:29282672-29282694 ATAAGTCATCTGACCATACTTGG + Intronic
950471356 3:13188540-13188562 ATAAGTCACCTAACCTTTCTGGG - Intergenic
952321351 3:32280731-32280753 ATAAGTAGTCTGGCCATACCTGG + Intronic
955425829 3:58788793-58788815 ATAAGAGAACTGACCCTACTGGG + Intronic
958423722 3:93957735-93957757 ATAAGTGATTTGAGCATCCTTGG - Intronic
959001483 3:100969301-100969323 ATATGTCATCTAACCACACTTGG - Intronic
960377128 3:116916861-116916883 AAAATTCATTTGACCATATTTGG - Intronic
960752241 3:120967946-120967968 ATAACTTTTCTGACCATAATGGG - Intronic
967001088 3:185335617-185335639 ATAAGGAATCTGAACATCCTTGG - Intronic
967476829 3:189931341-189931363 AACAGTCATCTCACCAAACTAGG - Intergenic
970216844 4:13767566-13767588 AAAAGTCATCTCAGCATAATGGG - Intergenic
975362183 4:73483772-73483794 ATAAGTCATGTGAACAAAATAGG - Intronic
978916672 4:114133349-114133371 ATAACTCATCACAACATACTGGG + Intergenic
983379343 4:166970857-166970879 ATAAGTCATATGACTGTAGTTGG - Intronic
988188399 5:27898239-27898261 ATAATACCTCTGACCATACAGGG + Intergenic
988704710 5:33713530-33713552 ATAAATCAAATGCCCATACTGGG - Intronic
992553717 5:77883577-77883599 ATAAATCATCTGAGCATTTTAGG - Intergenic
993394939 5:87374291-87374313 CAAACTCTTCTGACCATACTGGG - Exonic
993814636 5:92527502-92527524 ATAAATCATCTAACTTTACTGGG - Intergenic
1008967913 6:57333175-57333197 ATAATTTGTATGACCATACTAGG - Intronic
1010050599 6:71499423-71499445 ATAAGTCATCTGGCCTTATTTGG + Intergenic
1012159591 6:95867117-95867139 GCAAGTCATTTGACCACACTGGG + Intergenic
1012998630 6:105998533-105998555 ATAAGTCAAATGAATATACTTGG + Intergenic
1013212994 6:108003341-108003363 AGAAGGCATATGACCATAGTGGG - Intergenic
1020606855 7:10349392-10349414 ATAAGACTTCTGATCATTCTTGG + Intergenic
1027294390 7:76753208-76753230 ATTTGTCATCTGACTCTACTTGG - Intergenic
1029825124 7:103184650-103184672 ATAGGTGATTTGACCATAGTGGG + Intergenic
1031022361 7:116642186-116642208 ATTATTCAGCTGACCACACTTGG - Intergenic
1037029662 8:14089008-14089030 TTAAGTCATCTTCCCATAATAGG + Intergenic
1037733539 8:21549159-21549181 TTAAATCTTCTGTCCATACTTGG - Intergenic
1048667815 8:136683762-136683784 AGAAGGCATTTGACCAGACTGGG + Intergenic
1049897153 9:118765-118787 ATAATTCAGCTCACCATTCTGGG - Intergenic
1052127759 9:24799109-24799131 AGTAGTCAACTGACCATACAAGG + Intergenic
1053740256 9:41129030-41129052 ATAATTCAGCTCACCATTCTGGG - Intergenic
1054443218 9:65285023-65285045 ATAATTCAGCTCACCATTCTGGG - Exonic
1054487062 9:65736478-65736500 ATAATTCAGCTCACCATTCTGGG + Intergenic
1054688093 9:68302283-68302305 ATAATTCAGCTCACCATTCTGGG + Intergenic
1054725832 9:68649140-68649162 AGAAGTCATCTAACCTTAGTGGG + Intergenic
1055804656 9:80079003-80079025 ATGAGTCATCTGATCACTCTGGG - Intergenic
1056011901 9:82340899-82340921 ATAAGTGATGTGCCCCTACTTGG - Intergenic
1058285598 9:103173719-103173741 ATATGTCATCTCACCTTTCTTGG + Intergenic
1059822965 9:117994360-117994382 ATAAGTCCCCGGACCAGACTTGG - Intergenic
1186220731 X:7346572-7346594 ATAAGTATTTTGACCAAACTGGG - Intronic
1186372546 X:8962008-8962030 ATAAGTCTTTTGACCTTTCTTGG + Intergenic
1187502319 X:19850040-19850062 ATGATTCAGCTGACCATGCTGGG + Intronic
1188482611 X:30650781-30650803 ATAAGGCATTTGAGCATTCTCGG - Intergenic
1188554327 X:31394963-31394985 ATATGTCTTCTCACCACACTTGG - Intronic
1188820423 X:34768111-34768133 ATGAGTGATCTGAACACACTAGG - Intergenic
1189611673 X:42743143-42743165 ATAAGTTTTCTGATCATATTGGG + Intergenic
1192091266 X:68158882-68158904 AAAAGTAATCTGAGAATACTAGG + Intronic
1192564206 X:72149882-72149904 ATAAGTTATTTGACCTTTCTGGG - Intergenic
1196852262 X:119948630-119948652 ATAAGTGATGTGACCATTCTAGG + Intergenic
1201254077 Y:12089779-12089801 ATTATTCATCTGACCACAATGGG + Intergenic