ID: 1182292408

View in Genome Browser
Species Human (GRCh38)
Location 22:29291151-29291173
Sequence TGCACCCTCAACCTCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182292408_1182292409 -8 Left 1182292408 22:29291151-29291173 CCTTGGGAGAGGTTGAGGGTGCA 0: 1
1: 0
2: 0
3: 31
4: 236
Right 1182292409 22:29291166-29291188 AGGGTGCACCTTTATGAACATGG 0: 1
1: 0
2: 2
3: 8
4: 90
1182292408_1182292410 -3 Left 1182292408 22:29291151-29291173 CCTTGGGAGAGGTTGAGGGTGCA 0: 1
1: 0
2: 0
3: 31
4: 236
Right 1182292410 22:29291171-29291193 GCACCTTTATGAACATGGAAAGG 0: 1
1: 0
2: 1
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182292408 Original CRISPR TGCACCCTCAACCTCTCCCA AGG (reversed) Intronic
901879978 1:12188123-12188145 TAGACCCTCAATCTCTCACATGG - Intronic
901961374 1:12828856-12828878 TGCAATCTCATCTTCTCCCAGGG + Intronic
901967961 1:12883461-12883483 TGCAATCTCATCCTCTCCTATGG + Intronic
901985648 1:13073605-13073627 TGCAATCTCATCTTCTCCCAGGG - Intronic
901996161 1:13153162-13153184 TGCAATCTCATCTTCTCCCAGGG + Intergenic
902142942 1:14371547-14371569 TAGACACTCAGCCTCTCCCAGGG - Intergenic
902513134 1:16976822-16976844 TGCTCCCTCTACCCCTCCCAGGG + Intronic
903603335 1:24557564-24557586 TGCCCCATCATCCACTCCCACGG - Intronic
903725508 1:25440321-25440343 TGCAGCCTCAACCTCAACCTGGG - Intronic
904255961 1:29255087-29255109 TCCACCCTCTCCCTCTACCAAGG - Intronic
905923869 1:41736376-41736398 TGGCCCCTCAACCCCTTCCACGG - Intronic
906533894 1:46540759-46540781 TTCACCCATCACCTCTCCCAGGG - Intergenic
907413595 1:54299167-54299189 TGCCCCCTTAACATCTCCCTTGG - Intronic
907475458 1:54702264-54702286 TGCACCCTCTACCCCTCCCTCGG + Intronic
915604122 1:156940113-156940135 TGCACCCTCCACCTTCCCGAAGG - Intronic
915775765 1:158484218-158484240 TGGACCCTCAACTTCTTCCATGG - Intergenic
916166337 1:161970047-161970069 TCCACCCTCAACCTCTAGGATGG - Intergenic
916303608 1:163303966-163303988 TGCTCCCCCAACCCATCCCATGG + Intronic
920096111 1:203487630-203487652 TGAACCCTTCCCCTCTCCCATGG - Exonic
920167190 1:204044335-204044357 AGCACCCTCCACCTATCTCACGG + Intergenic
920216138 1:204362620-204362642 TGCAGCCTCCACCTCTACCTGGG + Intronic
921188603 1:212690740-212690762 AGCAACCTCAAACCCTCCCATGG - Intronic
923169727 1:231403698-231403720 TGCAACCTCCACCTCTTCCCAGG - Intronic
924060517 1:240169540-240169562 TGCAGCCTCGACCTCCCCCCGGG + Intronic
924251288 1:242135763-242135785 TCCACCCTCTCACTCTCCCAGGG + Intronic
924322413 1:242863223-242863245 TCCACCCTGAAACTCTCCCATGG - Intergenic
1062868129 10:874943-874965 TGCACCCTTAACAACCCCCAAGG + Intronic
1062947142 10:1470080-1470102 TCCAGCCTGACCCTCTCCCAGGG + Intronic
1065327225 10:24559901-24559923 TGCACCCCCCACCACCCCCAGGG + Intergenic
1065539156 10:26743585-26743607 TGAAGCCAGAACCTCTCCCAGGG - Intronic
1066107548 10:32169029-32169051 TGCGCCCTCGAACCCTCCCAGGG - Intergenic
1067080997 10:43212099-43212121 CCCAGCCCCAACCTCTCCCAGGG - Intronic
1067799726 10:49350742-49350764 TACAGCCTCAACTTCTGCCATGG - Intergenic
1070515565 10:77202735-77202757 AGCACCCTCAAACTCACCCAAGG + Intronic
1070834512 10:79439714-79439736 TGCAACCTCCACCTCCCCCCAGG - Intronic
1070959335 10:80487875-80487897 TGACCGCTCCACCTCTCCCACGG - Intronic
1070982737 10:80662834-80662856 GGCACCCGCAGCATCTCCCACGG + Intergenic
1070989417 10:80718396-80718418 ACCACCCTCACACTCTCCCAGGG - Intergenic
1072645294 10:97249907-97249929 TCCTGCCTCAGCCTCTCCCAGGG + Intronic
1073446357 10:103582765-103582787 TTCTCCCTGAACCTCTCCAAGGG - Intronic
1073481884 10:103791202-103791224 TGCACCCCCAGCCTCTCCATGGG - Intronic
1075585231 10:123652497-123652519 AGCACCCTCACCCCCACCCAGGG + Intergenic
1076364978 10:129915900-129915922 TGCACCCTCCCCGTCTCCCCAGG - Intronic
1076421207 10:130333355-130333377 TGCACCATCAACCGTTCCCTGGG - Intergenic
1076521828 10:131085973-131085995 TGGACCCTGGGCCTCTCCCAGGG - Intergenic
1076726344 10:132415959-132415981 TCCACCCTCACACTCTCACACGG + Intronic
1076764809 10:132627267-132627289 TCCACCCTCAGCCCCTCCCTCGG - Intronic
1077207176 11:1350218-1350240 TGCCTCCTCCACCTCCCCCAGGG + Intergenic
1078643184 11:13114804-13114826 TGCACCCTGACCCTCTGGCAAGG - Intergenic
1083475544 11:62912776-62912798 GGGACCCTCAACCTCTTCAATGG - Intronic
1083622535 11:64056242-64056264 AGCTCCCTCAGCCTCTCCCATGG - Intronic
1083776665 11:64897493-64897515 TGGACCCCCTCCCTCTCCCAGGG - Exonic
1084778274 11:71391653-71391675 TGCAGCCTCAACCTCACCAAAGG - Intergenic
1085352678 11:75809955-75809977 TGCAGCCTCAACCTCCTCCCAGG - Intergenic
1085400743 11:76234152-76234174 TGCACCCTCTGCCTAGCCCAAGG - Intergenic
1085509808 11:77082520-77082542 TGCACCCTCCATCTGCCCCAAGG - Intronic
1085923233 11:80983850-80983872 GGCACCCGCCACCACTCCCAGGG - Intergenic
1086094635 11:83037998-83038020 TTCACCCTCTCCCACTCCCAAGG - Intronic
1086501161 11:87455318-87455340 TGCACCTTGCACATCTCCCATGG - Intergenic
1090446577 11:126769729-126769751 TGCACCCTCCACCTTGCCCCTGG - Intronic
1091880346 12:3972220-3972242 TGTACCCACCACCCCTCCCAGGG + Intergenic
1092526931 12:9315134-9315156 TGCACCCTCATCCCCACCCCAGG - Intergenic
1092540343 12:9416646-9416668 TGCACCCTCATCCCCACCCCAGG + Intergenic
1094187403 12:27659580-27659602 TGCAGCCTCAAACTCTACAATGG - Intronic
1094512705 12:31105830-31105852 TGCACCCTCATCCCCACCCCAGG - Intergenic
1097040253 12:56152224-56152246 TGCAGCCTCAATCTTTCCCCAGG + Intergenic
1097672334 12:62555252-62555274 TGCAGCCTCAACCTCTCCTGGGG + Intronic
1098985995 12:77012909-77012931 TGCCCCCTCGACCCCTACCATGG - Intergenic
1101969590 12:109303658-109303680 TGGACCCTCACCTTCTCCCAGGG - Intronic
1102735162 12:115152949-115152971 TGCAGCCACAGCCTTTCCCAAGG - Intergenic
1102777731 12:115535175-115535197 TTCACCTACAACCTCTCCAAAGG + Intergenic
1102916697 12:116759754-116759776 TGCACCCTCCACCACCTCCATGG - Intronic
1103612378 12:122131805-122131827 TGCACCCTCAACCTCCCTCCTGG + Intronic
1104870538 12:131992078-131992100 GGCTCCCCCAACCTGTCCCATGG + Intronic
1105698432 13:22914703-22914725 TCCACCCTCAGCCTGTCCCCAGG - Intergenic
1105850094 13:24326943-24326965 TCCACCCTCAGCCTGTCCCCAGG - Intergenic
1106549466 13:30758891-30758913 TGCAACCTCCACCTCTTCCCAGG + Intronic
1106549522 13:30759247-30759269 TGCTCCCTCTTCCTATCCCATGG + Intronic
1113104621 13:106759040-106759062 TGGACCCTCAGCCTATGCCACGG - Intergenic
1113104657 13:106759243-106759265 TGGACCCTCAGCCTATCCCACGG - Intergenic
1113104703 13:106759495-106759517 TGGACCCTCAGCCTATCCCATGG - Intergenic
1115896362 14:38092800-38092822 TGCACTCTCACCTTCTCCCATGG - Intergenic
1116498074 14:45586864-45586886 TGTACCCTCCACCACCCCCATGG - Intergenic
1118858786 14:69645561-69645583 GACACCCTCCACCTCTTCCATGG - Intronic
1119916077 14:78403511-78403533 AGCAGCCTCATCCTCTCCCAGGG - Intronic
1121585461 14:95060167-95060189 TGGACCCTCCACCTCTGCCTGGG - Intergenic
1121691190 14:95877999-95878021 TGCATCCTTAACCTTTCCCTGGG + Intergenic
1122227379 14:100287552-100287574 TGCACCCTCAACACCTCCAAGGG + Intergenic
1122840044 14:104454916-104454938 TCCACCCTCAGCCTGTCCCCAGG - Intergenic
1124995921 15:34722666-34722688 TGCACCCTCTAGCTGTGCCAGGG + Intergenic
1126719963 15:51567996-51568018 TGCAGCCTCAACCTGTCAAATGG - Intronic
1127602026 15:60547400-60547422 TGCAACCTCCACCTCCCCCAGGG + Intronic
1128474000 15:67981565-67981587 TGCACGCTCCACCTCTCCAATGG + Intergenic
1130098520 15:80874070-80874092 GGCACCCTGACCCACTCCCACGG - Intronic
1133029168 16:3001487-3001509 TGCCCCCTCCTCCCCTCCCAGGG - Intergenic
1133450624 16:5900926-5900948 TGCACTGTCAGTCTCTCCCAAGG - Intergenic
1133751451 16:8729223-8729245 TGCAACCTCTGCCTCCCCCAGGG - Intronic
1134059828 16:11192408-11192430 TCCACCCTCACCCTGCCCCAGGG - Intergenic
1134265411 16:12688409-12688431 TGCAACCTCCACCTCTTCCTGGG + Intronic
1135632812 16:24049312-24049334 TGCACCCTTAACCACTACCCTGG + Intronic
1135632832 16:24049383-24049405 TGCACCCTTAACCACTACCCTGG + Intronic
1135632862 16:24049527-24049549 TGCACCCTTAACCACTACCCTGG + Intronic
1136072564 16:27796803-27796825 TGCACCTGCCACCTCTCCCCAGG + Intronic
1137543149 16:49378310-49378332 TGCCCCTCCGACCTCTCCCAGGG + Intronic
1138288071 16:55824966-55824988 TGCACACTCAATCCCTCCCCAGG - Intronic
1140939892 16:79711852-79711874 TGCAACCTCTGCCTCTCCCCGGG + Intergenic
1141192777 16:81836429-81836451 TGCACTCTTAACCACTACCAAGG - Intronic
1141456682 16:84146664-84146686 TGCAGCCTCAGCCTCCCCCTTGG - Intronic
1141496511 16:84414157-84414179 TGCTCCCTCAGCTCCTCCCATGG - Intronic
1141508991 16:84500555-84500577 TGCACCCCCATCCCCTTCCAAGG - Intronic
1141620498 16:85234713-85234735 GGCATCCTCAGCCTCTCCCCTGG - Intergenic
1142290181 16:89190512-89190534 AGCCTCCTCTACCTCTCCCAGGG - Intronic
1143893835 17:10121777-10121799 TACCCCGTCAACCTCTCCCTTGG + Intronic
1144819930 17:18065414-18065436 TGCTCCCTCCACCTGCCCCACGG - Exonic
1146236664 17:31172249-31172271 TGCAACCTCAACCTCTTCCTGGG - Intronic
1147423151 17:40332402-40332424 TGCACCCACCACCCCTCTCACGG + Intronic
1148594504 17:48842546-48842568 TGCAGCCTCAACCTCCTCCCAGG + Intronic
1148669933 17:49402860-49402882 TGCATCCTGCACCCCTCCCAGGG - Intronic
1148766033 17:50038672-50038694 TGCATCCACAGCCTCTCTCAGGG - Intergenic
1149303602 17:55327901-55327923 TGAACCCTCAGCCTGTCCCAAGG + Intergenic
1150283847 17:63944710-63944732 TTCACCCTCAACCTCTTCATTGG - Exonic
1150338648 17:64348142-64348164 TGCACCCTCAGTCGCTCCAAAGG - Intronic
1150816311 17:68394958-68394980 AGCACCCACAGCCTCTCCTATGG - Intronic
1151137837 17:71964767-71964789 TGCACCCTCAGCCTCCCTCAAGG - Intergenic
1151386178 17:73756763-73756785 TGGAGCCTCAACCTCTCCTTGGG - Intergenic
1151586049 17:75009091-75009113 GGCACCCTTCTCCTCTCCCAGGG + Intergenic
1151777306 17:76214162-76214184 TGCACCCTCAACCTGTGGGATGG + Intronic
1156449861 18:37260919-37260941 TGCTCCCTCACCCCCTTCCAGGG + Intronic
1159544678 18:69824417-69824439 TGCAGCCTCAACCTCCTCCTGGG + Intronic
1160222367 18:76986435-76986457 TGCACCCTCAGCCTCTGCTGGGG + Intronic
1161657812 19:5526505-5526527 TGCAGCCTCTGCCTCTCCCAGGG - Intergenic
1164563323 19:29308948-29308970 TGAGCCCTCAGCCCCTCCCAGGG - Intergenic
1164563346 19:29309070-29309092 TGCGCCCTCAGCCCCTCCCTGGG - Intergenic
1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG + Intergenic
1166961730 19:46500993-46501015 TGCCACCTCATCCTGTCCCACGG - Intronic
1167252812 19:48409857-48409879 TGCAACCTCAACCTCCCTCCCGG + Intronic
1167587882 19:50385101-50385123 TCCACGCTCAAACCCTCCCACGG - Intronic
1168149362 19:54436470-54436492 TGCCCCCTCAGCTACTCCCAAGG - Exonic
925771921 2:7290421-7290443 TGTACCCTCAGCCTCTACCTGGG + Intergenic
926684807 2:15690543-15690565 TGCTTCCTCAGCCTCTCCCATGG + Intergenic
926738359 2:16091290-16091312 TGAACCCTCAACCCCTCCTTTGG + Intergenic
927182183 2:20454581-20454603 TGCACCCTCAACCTCAACCTGGG + Intergenic
927404828 2:22754992-22755014 TTCACCCTAAACCTCTCCTCTGG + Intergenic
927486227 2:23490082-23490104 TGCACGCGCATCCTCGCCCACGG - Intronic
928360202 2:30656384-30656406 GGCACCTTCAACGTCTCCTAAGG + Intergenic
929495128 2:42434378-42434400 TGCAACCTCAACCTCCTCCTGGG - Intergenic
930091102 2:47531966-47531988 TGCAACCTCTGCCTCTCCCCAGG - Intronic
931071170 2:58652123-58652145 TGCACTGTCATCCTCTCCCCGGG - Intergenic
931433805 2:62230614-62230636 TGCACCCACAGCCTCTTCCTGGG + Intergenic
931711250 2:64990173-64990195 AACACTCTCCACCTCTCCCAGGG + Intronic
934475156 2:94588620-94588642 TCCATCCTCAGCCTCTCCCTTGG + Intronic
937066823 2:119023825-119023847 TGCTCCATGAAGCTCTCCCACGG + Intergenic
937536840 2:122899439-122899461 TGGACCCTTGAGCTCTCCCAAGG + Intergenic
937955663 2:127420553-127420575 TGCACCTCCACCCTTTCCCAAGG + Intronic
938103635 2:128514766-128514788 TTCAGCCTCGACCTCTCCCTGGG + Intergenic
942898336 2:181085081-181085103 TACACAATGAACCTCTCCCAGGG + Intergenic
942985115 2:182131705-182131727 TGCAACCTCCAGCTCTGCCAGGG - Intergenic
943508970 2:188800774-188800796 TGCACTCTTGATCTCTCCCAGGG - Intergenic
947600803 2:231448804-231448826 TGCAGCCTCAACCTCCCCAGTGG + Intergenic
947909417 2:233791496-233791518 TGCCCCCTTCACCTCTCCCCTGG - Intronic
1169200818 20:3708670-3708692 TGCAGCCTCGACCCCTCCCCTGG - Intergenic
1169436935 20:5601102-5601124 TGCAACCTCTACCTCCCCCCAGG - Intronic
1172222002 20:33280471-33280493 TGGTCCCTCCTCCTCTCCCAGGG - Intronic
1172501353 20:35430243-35430265 TGGCCCCTCCACATCTCCCAGGG - Intergenic
1172894783 20:38292748-38292770 TGCACCCACTACCTGACCCATGG - Intronic
1173596949 20:44264571-44264593 TGCAGCCCCCACCTCCCCCAGGG - Intronic
1176520102 21:7817984-7818006 TGCACCCTCTGCCTCTGTCACGG + Exonic
1178654129 21:34447996-34448018 TGCACCCTCTGCCTCTGTCACGG + Intergenic
1178795812 21:35743321-35743343 TCCAGCCTCAACCTCTCTCCTGG + Intronic
1180844754 22:18975002-18975024 TGCCCACTCAGCCTCTCCTAAGG - Intergenic
1181485959 22:23231955-23231977 GGTACCCTCAGCCTGTCCCAAGG + Intronic
1181990947 22:26836262-26836284 TGCTCCCTCCTCCCCTCCCAGGG + Intergenic
1182292408 22:29291151-29291173 TGCACCCTCAACCTCTCCCAAGG - Intronic
1182502520 22:30757739-30757761 TGTAGCCTCAACCTCTCTCCTGG + Intronic
1182712980 22:32334246-32334268 TGCCCTCTCCACCTCTCCCCTGG + Intergenic
950163458 3:10776653-10776675 TGTACCCTCAACTTTTCCCAGGG - Intergenic
950494263 3:13324311-13324333 TGCACTCCCACCCACTCCCAGGG + Intronic
950576773 3:13836866-13836888 TGCACCCACACCCGCTCCCTTGG - Intronic
951521776 3:23617013-23617035 TGCACCTTCAAGCTCTCCCTGGG - Intergenic
955517013 3:59735837-59735859 TATACCCTCAAACTCACCCAAGG - Intergenic
956642623 3:71429168-71429190 ATCACCCACAACCTCGCCCATGG + Intronic
960124243 3:113980669-113980691 TGCATTCTCAATCTCTTCCAAGG + Exonic
960510334 3:118541718-118541740 TGTACCCGTAACCACTCCCAGGG + Intergenic
960933913 3:122883843-122883865 TTCACCCTCAACCCCTCTCCAGG + Intergenic
962342374 3:134596417-134596439 TGCATCCTCAGCCTCCTCCAGGG + Intergenic
966385702 3:179395521-179395543 TCCACCCTCATCCTCCCCCAAGG + Intergenic
967820626 3:193835838-193835860 TGCCCCCACCACCTCTCTCATGG + Intergenic
968969231 4:3784765-3784787 TGCCCCCTGCACCTGTCCCAGGG - Intergenic
971528701 4:27656930-27656952 TGCACCCTCCCCCTGCCCCAAGG - Intergenic
971832677 4:31717560-31717582 GGCACCTGCAACCTCTTCCAGGG - Intergenic
972117726 4:35658208-35658230 TGCACTCTCTCTCTCTCCCAAGG + Intergenic
972941325 4:44198187-44198209 TTCACTCTCTATCTCTCCCAGGG - Intronic
973826037 4:54708509-54708531 TGCACGGTCAACGTCTTCCAAGG + Intronic
977557729 4:98501880-98501902 TGCACCCTGACCCTCACCCTAGG - Intronic
977918429 4:102618590-102618612 TGCAGCCTCAGCCTCTCTAATGG - Intergenic
978395803 4:108278546-108278568 TGCTCCAGCAACCTGTCCCATGG + Intergenic
979638164 4:122979817-122979839 TGCAGCCTCAACATTCCCCAGGG - Intronic
983534208 4:168839820-168839842 GGCAAACTCATCCTCTCCCAAGG - Intronic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
986170188 5:5308541-5308563 CACACCCTCAACCTCCCCCAGGG + Intronic
987035275 5:14013043-14013065 TGCAACCTAGATCTCTCCCATGG + Intergenic
987204224 5:15608708-15608730 TGCAGCCTCAACTTCTGCCTGGG + Intronic
987515316 5:18899664-18899686 TGCAACCTCTACCTCCCACATGG - Intergenic
988365297 5:30290584-30290606 TCCAACCTCAACCTCTTCCTTGG + Intergenic
989396342 5:40961113-40961135 TGCACCTTCTACCTCTCACAAGG - Intronic
991911555 5:71568064-71568086 TGCAGCCTCAACCTCCTCCTGGG - Intergenic
996578204 5:124999930-124999952 TTCTTCCTCTACCTCTCCCATGG + Intergenic
998372443 5:141670521-141670543 TGGACCCTCACCCCCTCGCAGGG - Exonic
999114226 5:149148500-149148522 TGAACTCTCAACCTATTCCAAGG + Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1002310346 5:178310152-178310174 GGCACACTCGCCCTCTCCCAGGG - Intronic
1002837370 6:876347-876369 CCCACCCTGACCCTCTCCCAGGG + Intergenic
1005974174 6:30784730-30784752 TGCAACCTCCACCTCTTACAAGG - Intergenic
1006947622 6:37795692-37795714 TGCACCCTGATCCAATCCCAGGG + Intergenic
1008201498 6:48596608-48596630 TCCACACTCCACGTCTCCCACGG + Intergenic
1011468971 6:87688672-87688694 TGCAACCTCCACCTCCCCCCGGG - Intronic
1011651332 6:89509089-89509111 TGCACCCTCCCACTCTCCCTGGG + Intronic
1011847271 6:91581882-91581904 AGCACCTTCAACCTGTCCCGGGG - Intergenic
1013179711 6:107707822-107707844 TGCTCCCTCAATCCCCCCCAAGG + Intronic
1013418410 6:109945117-109945139 TGCATTTTCAAACTCTCCCAAGG + Intergenic
1014987673 6:128031918-128031940 TGCACCCTCACCCTGTGTCAGGG + Intronic
1017738064 6:157381448-157381470 GGCACCGGCAACCCCTCCCAGGG - Exonic
1018066387 6:160127519-160127541 TGCAGCCCCAGCTTCTCCCAGGG + Intronic
1020110828 7:5446893-5446915 TGCCCCCTCAGCATATCCCAGGG + Intronic
1021984541 7:26086025-26086047 TGAGCCTTCAGCCTCTCCCATGG + Intergenic
1022494571 7:30844748-30844770 AGCACCCTTCCCCTCTCCCAGGG - Intronic
1022791184 7:33690756-33690778 TGCACCATCGTCCTCTCCTAAGG + Intergenic
1028435003 7:90793147-90793169 TGTACCCTCAACATCTAGCATGG + Intronic
1028823837 7:95245863-95245885 TGCACCCTCACCGGCTCCTAGGG - Intronic
1032695532 7:134332831-134332853 TGCACCTCCAGGCTCTCCCAAGG - Intergenic
1034241934 7:149617468-149617490 TGCCCCCTCCACCCATCCCACGG - Intergenic
1034380680 7:150689393-150689415 TGCTACCTCATTCTCTCCCATGG - Intronic
1035203137 7:157279355-157279377 CGCACCCACAACCGCTCCCGCGG - Intergenic
1039507718 8:38064062-38064084 TCCTCCCTCTACCTCACCCAAGG - Intergenic
1040614448 8:49020283-49020305 TCCACCCTGAAGCTCTCCCCTGG + Intergenic
1040932389 8:52748545-52748567 TTCACCTTCAACCTCCCACAAGG - Intergenic
1041831752 8:62162475-62162497 TGCCCCCTCAACAACACCCAAGG + Intergenic
1042575591 8:70215239-70215261 TGCCCTCTCACCCTCTCACAAGG + Intronic
1042801195 8:72719692-72719714 TGCTCCCTCACCATCTACCAGGG + Intronic
1045359055 8:101415158-101415180 TGCACTCTCAGCCTCTCCCCAGG + Intergenic
1045423718 8:102042333-102042355 CGCTCCCTAAACCTTTCCCAAGG - Intronic
1047325935 8:123835896-123835918 TGCTTCCCCAACCACTCCCAAGG + Intergenic
1049460349 8:142724477-142724499 TGCACAGCGAACCTCTCCCAGGG - Intergenic
1052854895 9:33401142-33401164 TCCATCCTCAGCCTCTCCCTTGG - Intronic
1053377619 9:37621374-37621396 TGCACCGTCATCCTCACCAAGGG + Intronic
1053682916 9:40497471-40497493 TCCATCCTCAGCCTCTCCCTTGG - Intergenic
1053932897 9:43125785-43125807 TCCATCCTCAGCCTCTCCCTTGG - Intergenic
1054280798 9:63127457-63127479 TCCATCCTCAGCCTCTCCCTTGG + Intergenic
1054296016 9:63332971-63332993 TCCATCCTCAGCCTCTCCCTTGG - Intergenic
1054394032 9:64637466-64637488 TCCATCCTCAGCCTCTCCCTTGG - Intergenic
1054428681 9:65142678-65142700 TCCATCCTCAGCCTCTCCCTTGG - Intergenic
1054501698 9:65878864-65878886 TCCATCCTCAGCCTCTCCCTTGG + Intronic
1056076351 9:83044980-83045002 TGCAACTTCAACCCCTCCCTGGG + Intronic
1057481833 9:95450765-95450787 TGCACTCTCCTCCTCTGCCATGG - Intronic
1061251239 9:129427733-129427755 GGCAGGCTCAACCTCTCCGAGGG - Intergenic
1061678516 9:132231414-132231436 TGCACCGTCACCCTCCACCAGGG + Intronic
1062342363 9:136099497-136099519 TGCACCCTCACCTCCACCCAAGG + Intergenic
1062422888 9:136492391-136492413 TGCACGCACCACCTCTCCCTGGG + Intergenic
1062442234 9:136575977-136575999 TGGACCCTCAGCCTCTGCCTCGG - Intergenic
1203786969 EBV:133528-133550 TGCAGTCTCAATCTCTCCCACGG + Intergenic
1187186341 X:16990264-16990286 TGCCCCCTCAACCCCTGGCATGG - Intronic
1189085568 X:38019706-38019728 TGCACCCTCCACCTCCCACGTGG + Intronic
1189332718 X:40153304-40153326 GGCACCCCCACCCTCGCCCAAGG + Intronic
1189560595 X:42187904-42187926 TGCAGCCTGAGCCTCTCCCCTGG + Intergenic
1189697268 X:43677106-43677128 TGCCTTCTCCACCTCTCCCAGGG - Intronic
1192148596 X:68698067-68698089 TGAACCCTCACCTTCCCCCAAGG + Intronic
1192448303 X:71226570-71226592 TGCAGCCTCAACCTCCTCCTGGG - Intergenic
1194705799 X:97173829-97173851 TGCAGCCTCAGCTTCTCCCAGGG - Intronic