ID: 1182293304

View in Genome Browser
Species Human (GRCh38)
Location 22:29298595-29298617
Sequence GCCACACGGAAACACGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182293298_1182293304 6 Left 1182293298 22:29298566-29298588 CCTCACAGGGAAGGGGGCTGATG 0: 1
1: 0
2: 1
3: 30
4: 250
Right 1182293304 22:29298595-29298617 GCCACACGGAAACACGGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182293304 Original CRISPR GCCACACGGAAACACGGGAC AGG Intronic
900094626 1:935256-935278 GCCCCACGCACACACGGCACCGG - Intronic
900667671 1:3826300-3826322 GCCACACAGAAACCCTGGAAAGG - Intronic
900716614 1:4149055-4149077 GCAACAGGGAAACAGGGGAAGGG - Intergenic
902997229 1:20236007-20236029 CCCACACGGCAAAATGGGACTGG + Intergenic
917696748 1:177533505-177533527 GCCACACTGATACAAGGGATGGG + Intergenic
921667311 1:217888253-217888275 TCCACCAGGAAACATGGGACAGG - Intergenic
924802249 1:247335947-247335969 GCCTCACAGAAACACCAGACTGG - Intergenic
1070106596 10:73438261-73438283 GCCACTGAGAACCACGGGACGGG - Exonic
1071718244 10:88118306-88118328 GCCAAAGGGAAACACAGGAGAGG + Intergenic
1073486122 10:103820267-103820289 GCCACACGGAAGGAAGGGGCAGG - Intronic
1084193517 11:67509857-67509879 GCCACAAGGGATAACGGGACAGG + Intergenic
1100230257 12:92599959-92599981 GCCACACTGACACAAGGGATGGG + Intergenic
1100521652 12:95381057-95381079 GCCACATGGGAATACGGGCCTGG - Intergenic
1101371983 12:104138374-104138396 GCCTCACAGGAACGCGGGACTGG - Intergenic
1101978382 12:109383084-109383106 GCCCCACAGAAACATGGGAGAGG - Intronic
1114197832 14:20494770-20494792 TTCACACGGACACACGTGACAGG - Intergenic
1118520236 14:66575529-66575551 CCCACTCAGAAACACTGGACAGG - Intronic
1122634282 14:103122992-103123014 GCCACAAGGAGGCAGGGGACGGG - Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1138506598 16:57481247-57481269 GGCACACGCAAACAAGGGAGGGG + Intronic
1142676021 17:1513815-1513837 CCCACAGGGAAACCTGGGACTGG + Intronic
1149289104 17:55198238-55198260 GCCACACAGAAATGGGGGACAGG + Intergenic
1152600892 17:81261661-81261683 GCCACCCGGAAACATTGGGCTGG + Intronic
1155830195 18:30507211-30507233 GCCACAGGGAAATATGGTACTGG + Intergenic
1160543582 18:79638495-79638517 GCCACGTGGAAACCCGGGGCTGG + Intergenic
1163284472 19:16337956-16337978 GCCCCACGGACACACAGGAAGGG - Intergenic
925888661 2:8415117-8415139 GCCACACAGGCACACGGCACTGG + Intergenic
932807193 2:74794874-74794896 GCCACACTGAAACACACTACTGG + Intergenic
934169303 2:89326106-89326128 GCCACACCGTAACACGGGGCTGG + Intergenic
934197991 2:89856478-89856500 GCCACACCGTAACACGGGGCTGG - Intergenic
935804954 2:106736377-106736399 GCCACTCTAAAAGACGGGACTGG + Intergenic
944086648 2:195855649-195855671 GCCACACGAAAACAGGCGATGGG + Intronic
946828766 2:223706159-223706181 GCCACATTGAGACATGGGACAGG - Intergenic
948858030 2:240739577-240739599 GCCACAGGAAGACACAGGACAGG + Intronic
1170856477 20:20060827-20060849 CCCACAGGGAAACATGTGACTGG - Intronic
1174755289 20:53152517-53152539 GCCACACAGAAACACAGACCAGG + Intronic
1176173306 20:63706208-63706230 GCCACTCGGGAACCTGGGACAGG + Intronic
1182293304 22:29298595-29298617 GCCACACGGAAACACGGGACAGG + Intronic
1183301200 22:37060011-37060033 GCCAGGCGGACACACAGGACTGG - Intronic
1184781954 22:46654111-46654133 GCCACACCGAAAGAGGGGCCAGG + Intronic
953854486 3:46490507-46490529 GCCACACAGAAACTCGTGATGGG + Intergenic
961261057 3:125602271-125602293 GCCACAGAGAAACTCGGGGCAGG + Intergenic
961375888 3:126465528-126465550 GGCAGACGGAAACACAGGAGGGG + Intronic
964384504 3:156132609-156132631 GGCACATGGAAACAAGGGTCAGG + Intronic
969949221 4:10816875-10816897 GCCACCTGGAAACACGGGAATGG - Intergenic
986102312 5:4625293-4625315 GGCAGACGGAAAAACAGGACAGG + Intergenic
999997574 5:157106829-157106851 GCCACATTCAAACACAGGACAGG + Exonic
1004584376 6:16985303-16985325 GCCACACCAAAACACTGAACTGG + Intergenic
1012844613 6:104374263-104374285 GCCACAAGGAAACACAGGAGAGG + Intergenic
1019143376 6:169962075-169962097 GCCACCCCGAAACCCGGGAGAGG - Intergenic
1022442487 7:30445790-30445812 TCCACATGGAAGCATGGGACAGG - Intronic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1029236386 7:99123030-99123052 GCCAAACAGAAACACAGGACAGG + Intronic
1040640748 8:49331851-49331873 GCCACAGGGAATCACATGACTGG + Intergenic
1049498406 8:142947481-142947503 CCCACACGGGACCAAGGGACAGG + Intergenic
1051078610 9:13270457-13270479 GCCACACTGAAACACACTACTGG + Intronic
1060832425 9:126724799-126724821 GCCACACGGAAACAAAGGAGAGG - Intergenic
1061918589 9:133769930-133769952 GCCACACGGAATCAGGGGCAGGG - Intronic
1187038122 X:15564106-15564128 GCCATATGGAAACAGGGGGCTGG + Exonic
1195195424 X:102493414-102493436 GCCACAGAGAAAAATGGGACGGG + Intergenic
1197019707 X:121671962-121671984 ACCACAGTGAAACACGGGAAGGG + Intergenic