ID: 1182293350

View in Genome Browser
Species Human (GRCh38)
Location 22:29298825-29298847
Sequence GGTTCCCGAGGGAACCCCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182293337_1182293350 20 Left 1182293337 22:29298782-29298804 CCGTGGAGGAGATAGAGGAGGCT 0: 1
1: 1
2: 2
3: 35
4: 323
Right 1182293350 22:29298825-29298847 GGTTCCCGAGGGAACCCCTCTGG 0: 1
1: 1
2: 0
3: 4
4: 63
1182293342_1182293350 -4 Left 1182293342 22:29298806-29298828 CCCTCCAAGAGGACCCCGGGGTT 0: 1
1: 1
2: 0
3: 8
4: 81
Right 1182293350 22:29298825-29298847 GGTTCCCGAGGGAACCCCTCTGG 0: 1
1: 1
2: 0
3: 4
4: 63
1182293344_1182293350 -8 Left 1182293344 22:29298810-29298832 CCAAGAGGACCCCGGGGTTCCCG 0: 1
1: 1
2: 0
3: 7
4: 128
Right 1182293350 22:29298825-29298847 GGTTCCCGAGGGAACCCCTCTGG 0: 1
1: 1
2: 0
3: 4
4: 63
1182293343_1182293350 -5 Left 1182293343 22:29298807-29298829 CCTCCAAGAGGACCCCGGGGTTC 0: 1
1: 1
2: 0
3: 10
4: 107
Right 1182293350 22:29298825-29298847 GGTTCCCGAGGGAACCCCTCTGG 0: 1
1: 1
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182293350 Original CRISPR GGTTCCCGAGGGAACCCCTC TGG Exonic
902330581 1:15729305-15729327 GGTTCCAGAGGGAATACATCTGG - Intronic
903670595 1:25033302-25033324 GGTTGCACAGGGACCCCCTCTGG - Intergenic
916599212 1:166276066-166276088 GGTTCCCGAGGGAACACCTCTGG - Intergenic
920504725 1:206507788-206507810 GGTTCCCCCGGGCAGCCCTCCGG - Exonic
922198739 1:223382936-223382958 GGTTCCCCAGGGACAGCCTCAGG - Intergenic
1069832494 10:71289768-71289790 GGCTCCCCAGAGGACCCCTCAGG - Intronic
1071306121 10:84300082-84300104 GGTTCAGGAGGGATCCTCTCTGG - Intergenic
1083278209 11:61609328-61609350 TGTTCCCCATGGCACCCCTCAGG + Intergenic
1084691118 11:70727386-70727408 CATCCCCGAAGGAACCCCTCAGG - Intronic
1090621452 11:128564466-128564488 GCTTCCCTAGGGACCCCCTGGGG + Intronic
1091337873 11:134786098-134786120 GGGTCCTGAGGGACCCACTCCGG - Intergenic
1096252308 12:50040995-50041017 GCTTTCCCAGGGAAACCCTCGGG + Intergenic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1097102626 12:56600278-56600300 GGTACCTGCGGGAGCCCCTCTGG - Exonic
1101494017 12:105236343-105236365 CGTTGCTGAGGGAACCCTTCGGG + Intronic
1107988401 13:45796084-45796106 GGGACCCGAGGGAGCCCCTGAGG + Intronic
1110188391 13:72701555-72701577 GGTTAACTAGGGAACCCCTAGGG - Intergenic
1113764281 13:112871099-112871121 GTTCCCCGAGGGAAGCCCCCAGG + Intronic
1115176479 14:30567271-30567293 GGTTCACCAGTGAACCCATCTGG + Intronic
1118786996 14:69054396-69054418 GGTGCCAGAGGGTACCTCTCAGG - Exonic
1122338158 14:101007290-101007312 GGTTCCCCGGAGAACCCCACAGG - Intergenic
1122935510 14:104954220-104954242 ACTTTGCGAGGGAACCCCTCAGG - Exonic
1129540092 15:76341737-76341759 GGCTCCCTAGGCAACTCCTCCGG + Exonic
1130560906 15:84958237-84958259 GGTTCCAGAAGGAACATCTCGGG - Intergenic
1136487541 16:30583042-30583064 GGATAGCCAGGGAACCCCTCTGG + Exonic
1138492165 16:57383020-57383042 GGTGCCCGTGTGAACTCCTCTGG + Exonic
1142620954 17:1165470-1165492 AGCTCCAGAGGAAACCCCTCAGG + Intronic
1143871345 17:9959173-9959195 GGCTCCCGAGGGGCGCCCTCAGG - Intronic
1147496819 17:40924652-40924674 GGTTCACGGGAGAACCCGTCTGG + Intronic
1149536996 17:57440912-57440934 TGAGCCCAAGGGAACCCCTCTGG - Intronic
1151154998 17:72117986-72118008 GGCTCCCCAGGGAAGCCCTCGGG - Intergenic
1152017509 17:77761363-77761385 GGTTCCCCAGGAAACGTCTCTGG - Intergenic
1158953985 18:62523055-62523077 GGCTCGCGAGGGAACAGCTCAGG + Exonic
1160686771 19:440556-440578 GGTCCCAGAGGGAACCCGCCAGG + Intronic
1160816373 19:1037809-1037831 GGTGCCCGAGGGAGCCCCATCGG - Exonic
1160873273 19:1286435-1286457 GGTTCCCGCGGGAGCCCCCCAGG + Intronic
1162471241 19:10872855-10872877 GATGCCCTGGGGAACCCCTCAGG + Intronic
1165454764 19:35904018-35904040 GGTGCCTGGGGGAACCCCTGAGG + Intronic
937197745 2:120174799-120174821 GGTTACTCAGGGAACCCCTGGGG - Intronic
942678022 2:178449265-178449287 GGTTCCCATGGGGACCCTTCCGG + Intronic
948043036 2:234919492-234919514 GGTTCCCCAGGGAAGCCTCCTGG + Intergenic
948095148 2:235327453-235327475 GGTCCCTGAGAGAAGCCCTCAGG - Intergenic
1174803067 20:53581461-53581483 GCTTCCCGAAGGAATCCATCTGG - Exonic
1180084002 21:45499428-45499450 GGCTCCCGCGGGAACCCGTGTGG + Intronic
1182293350 22:29298825-29298847 GGTTCCCGAGGGAACCCCTCTGG + Exonic
1183473003 22:38019455-38019477 GGTTGGGGAGTGAACCCCTCAGG + Intronic
1183654443 22:39176644-39176666 CGTTCCCCAGGGAAGCTCTCGGG + Intergenic
950001708 3:9661604-9661626 GGTGCCCTAGGGACCCTCTCTGG - Intronic
952862074 3:37821375-37821397 GGTTCCCCAGAGAACACTTCAGG + Exonic
954332425 3:49898106-49898128 GGTGCCTGAGGGAACCCATCAGG - Exonic
956615902 3:71172364-71172386 GGGTCTCGAGGGAATCCATCGGG + Intronic
967381219 3:188860487-188860509 TGTTCCTGAGGCAACCGCTCAGG + Intronic
969101059 4:4768590-4768612 GATTACCCAGGGAACCCCTGGGG - Intergenic
969566837 4:7983734-7983756 GTTTCCCGGGGGAGGCCCTCAGG - Intronic
973982136 4:56315605-56315627 GGTTCCCGCGGGAATCACACCGG - Exonic
990713816 5:58613898-58613920 GGTATCTGAAGGAACCCCTCGGG - Intronic
999110455 5:149116010-149116032 GGTTCCAGAGGGAAGGCCTTGGG + Intergenic
1017529379 6:155273633-155273655 GGTTCCCAAGGGAAACACACAGG + Intronic
1018090274 6:160340525-160340547 GGTTTCTGAGGAAACCCCTGAGG + Intergenic
1018673281 6:166197287-166197309 GGCTCCCGTGGGAAAGCCTCAGG + Intergenic
1019474624 7:1238112-1238134 GGGTCCCCAGGGGACCCTTCGGG + Intergenic
1019788128 7:2992514-2992536 GCTTCCAGAAGGAGCCCCTCTGG - Intronic
1027316762 7:76990475-76990497 GCTCCCCCAGGGAGCCCCTCTGG - Intergenic
1032780561 7:135162214-135162236 AGTTTCTGAGGGGACCCCTCTGG - Intronic
1044742299 8:95340641-95340663 GGGTCCCGAGGAAAGCCCTGGGG - Intergenic
1053273037 9:36763098-36763120 GGGTCCCGAGGGAGCTCCCCAGG - Intergenic
1061941613 9:133887054-133887076 TGAGCCCCAGGGAACCCCTCTGG - Intronic
1185462804 X:340306-340328 GGTTCTCTAGGTCACCCCTCGGG + Intronic
1189199107 X:39176458-39176480 GGTTCATGAGGGAAGGCCTCTGG + Intergenic