ID: 1182298079

View in Genome Browser
Species Human (GRCh38)
Location 22:29321687-29321709
Sequence TTTATATCAGTTTGGACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1284
Summary {0: 3, 1: 55, 2: 186, 3: 378, 4: 662}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182298079_1182298081 30 Left 1182298079 22:29321687-29321709 CCATGAGTCCAAACTGATATAAA 0: 3
1: 55
2: 186
3: 378
4: 662
Right 1182298081 22:29321740-29321762 CATTCAGCTTGCTTGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182298079 Original CRISPR TTTATATCAGTTTGGACTCA TGG (reversed) Intergenic
900689404 1:3971177-3971199 TTTTTCTCAGTTTGGACTCCTGG + Intergenic
900924616 1:5696430-5696452 TTTATATCAGTATAGAATCATGG - Intergenic
901164745 1:7210769-7210791 TTTATACCCATATGGACTCATGG + Intronic
901869608 1:12130238-12130260 TTTATATCTGTATGGATTCATGG + Intronic
902491817 1:16788023-16788045 TTTATATCAGTCTGGTTTCTTGG - Intronic
902914923 1:19631899-19631921 TCTATATCAGTATGGACTCATGG + Intronic
903113682 1:21160254-21160276 TTCATATCACTATGGACTCATGG - Intronic
903428689 1:23274704-23274726 CTTATGTCAGTATGGACTCATGG - Intergenic
903949234 1:26985131-26985153 TTTATATCAATTAGGGCTTAGGG - Intergenic
904345211 1:29863592-29863614 TTTATGTCAGTATGGATTCATGG - Intergenic
904406541 1:30294051-30294073 TTTATATCAGTCTGGACTCATGG - Intergenic
904414721 1:30352687-30352709 TTTATATCAGCATGGACTTATGG + Intergenic
904426108 1:30424220-30424242 TCTTTATTAGTTTGGACTAATGG - Intergenic
904629630 1:31831192-31831214 TTTATATTGCTCTGGACTCACGG + Intergenic
904844618 1:33400269-33400291 TTTATAGGAGTTTGCACTCAGGG + Intronic
904913578 1:33953588-33953610 TCTTTACCAGTTTGGAGTCAGGG + Intronic
905499186 1:38422695-38422717 TTTGTATCAGAATGAACTCATGG - Intergenic
905628215 1:39502729-39502751 TTTATATCATTATGGATTCAAGG - Intronic
905714826 1:40139912-40139934 TTTATATTAGTGTGGGCTTAAGG + Intergenic
906133130 1:43473932-43473954 TTTATATCAGTCTGGAGTCTTGG - Intergenic
906184675 1:43852333-43852355 TTTGAATCTGTTTGGTCTCATGG + Intronic
906255168 1:44343236-44343258 TTTATATCTTTATGGACTCATGG - Intronic
906628389 1:47344432-47344454 TTCATATCTGTTTGCATTCAAGG - Intronic
906758628 1:48348349-48348371 TTTACATCAGTATGGACTCTTGG + Intronic
907002618 1:50876950-50876972 TTTATATCTATCTGGACTCATGG - Intronic
907008268 1:50937994-50938016 TTTAAATCAGTATGTACTGAGGG - Intronic
907020849 1:51065749-51065771 TTTCTATCATTATGAACTCATGG + Intergenic
907076228 1:51581617-51581639 TTTATACCCGTATGGACTCATGG + Intronic
907774902 1:57504519-57504541 TGTATATCAGTATGGACTCAAGG - Intronic
907988901 1:59559843-59559865 TTTATGTCAGTATGGTCTTATGG - Intronic
908587303 1:65584086-65584108 TTTCTATCAGGATGGACTCATGG + Intronic
908819422 1:68068291-68068313 TTTATATCAGTATAGATTTAAGG + Intergenic
908897903 1:68921818-68921840 CTTTTATAAATTTGGACTCAGGG + Intergenic
909117616 1:71558535-71558557 TTTATATCAGTATGGACTAGTGG + Intronic
909953680 1:81751220-81751242 TATATGTCAGAGTGGACTCATGG - Intronic
910219130 1:84872582-84872604 TTTATGTCAGTATGGACTCATGG - Intronic
910400389 1:86832222-86832244 TTTATACCAATGTGGACTCATGG - Intergenic
910909692 1:92219919-92219941 TTTATATCAGTATAGACTCATGG + Intronic
910953881 1:92680433-92680455 TTTACATCAGTGTGAATTCATGG - Intronic
911028719 1:93462999-93463021 TTTATATCAGTATGAACTGATGG + Intronic
911113807 1:94222141-94222163 TTTATGTCAGTATGGACTCATGG - Intronic
911127037 1:94350463-94350485 TTTATGTCACTTTGCACTCTTGG - Intergenic
911442130 1:97939843-97939865 TTTATATTAATATGGACTGATGG + Intergenic
911565674 1:99461114-99461136 TTGATATCAATTTGAACTCATGG - Intergenic
911896633 1:103444037-103444059 TTTATATCAAAATTGACTCATGG - Intergenic
912725346 1:112054361-112054383 ATTCTATCAGTGTGGACTTATGG - Intergenic
912775034 1:112501526-112501548 TTTGTATCAGCATGGACTCATGG + Intronic
912889711 1:113516561-113516583 TTTATATCAATATGGGCTCATGG - Intronic
912941163 1:114046328-114046350 TTTATATCAGTAGTGACTCATGG + Intergenic
913693619 1:121303287-121303309 TTTATATCAGTGTGGACTTGTGG + Intronic
914143940 1:144976793-144976815 TTTATATCAGTGTGGACTTGTGG - Intronic
914386782 1:147177343-147177365 CTTGTATCAGTATGAACTCATGG - Intronic
914457729 1:147852094-147852116 TTTATACCTGTATGGGCTCATGG - Intergenic
914779204 1:150768919-150768941 TTTATATCATTATGAATTCATGG + Intergenic
915870359 1:159553281-159553303 TCTAAATCATTTTGGATTCATGG + Intergenic
916094348 1:161335528-161335550 TTTTTATCAGTATGGACTCAAGG + Intronic
916249030 1:162718067-162718089 TTTATAGCAGCATGAACTCATGG + Intronic
916364987 1:164016415-164016437 TTTATATCAGTGTGAGCTCATGG - Intergenic
916478146 1:165189608-165189630 TTTATATCAGTGTGGATTTATGG + Intergenic
916533264 1:165678420-165678442 TTTATATCAGTATGGACCCATGG - Intronic
916669970 1:167007180-167007202 TTTATATGAGCATGGACTCATGG + Intronic
917284318 1:173408385-173408407 TTTATATTAGTATGGACCCATGG - Intergenic
917318645 1:173756178-173756200 AGTATATCAGTGTGGAATCATGG - Intronic
917431437 1:174973736-174973758 TTTTTTTCAGTTTGGTCTCTTGG - Intronic
918000129 1:180485996-180486018 TTTATATCAGTTTAGACTCATGG - Intronic
918201443 1:182270993-182271015 TGTGTACCAGTGTGGACTCATGG - Intergenic
918295645 1:183153728-183153750 TTTATATTATTTTAGATTCATGG + Intergenic
918436833 1:184523028-184523050 TTTACATCAGTATGGACTCATGG - Intronic
918813557 1:189152169-189152191 TTAATATTATTTTAGACTCAGGG + Intergenic
919201870 1:194365534-194365556 TTTCTACCAGTATGGAGTCATGG + Intergenic
919344926 1:196363161-196363183 TTTATATTAGTATGGACTACTGG + Intronic
919364207 1:196636461-196636483 TGTATATAAATATGGACTCATGG - Intergenic
919852117 1:201679928-201679950 TTTATATCACAATGTACTCATGG + Intronic
919966706 1:202534098-202534120 TTTATATCAATGTCTACTCATGG + Intronic
920480943 1:206321656-206321678 TTTATATCAGTGTGGACTTGTGG + Intronic
922403656 1:225287945-225287967 TTTATATAAGTATGGGCCCATGG - Intronic
922410050 1:225364407-225364429 TTTATATCAGTATGGTCTCATGG + Intronic
923248010 1:232152277-232152299 TCTACATCAGTTTAGACTCATGG - Intergenic
923439512 1:234002840-234002862 CTTATGTCAGTATGGACTCATGG + Intronic
923483604 1:234407659-234407681 TTTATATCGGTGTGGGCTCGAGG + Intronic
923528628 1:234794516-234794538 TTTATATCAGTCTGGTTTCTTGG + Intergenic
924187522 1:241510464-241510486 GGTATATCAGTATGGACTGATGG - Intronic
924375995 1:243409763-243409785 TTAATATCAGCATGGAGTCATGG - Intronic
924406823 1:243756549-243756571 TTTTTATCAATATGGGCTCATGG - Intronic
924431404 1:244000363-244000385 TTTATATCAGTATGGATTCATGG - Intergenic
924702677 1:246469622-246469644 TTATTATTAGTATGGACTCATGG - Intronic
1063265257 10:4441121-4441143 TTTATATCAATATGCACCCATGG + Intergenic
1064315606 10:14252960-14252982 TTTATATCAGTGTAGACTCATGG + Intronic
1064439411 10:15340215-15340237 TTTCTATGTGTATGGACTCATGG + Intronic
1064518927 10:16180774-16180796 TTTACATCAGTGTGGATTCATGG + Intergenic
1064714993 10:18167440-18167462 TTTATCTTATTTTAGACTCAGGG - Intronic
1065160828 10:22919519-22919541 TTTAAATCAATATGGACTGATGG + Intergenic
1065163299 10:22946616-22946638 TTTATATCAGTATGGACTCATGG - Intronic
1065203549 10:23337109-23337131 TTCATATCAGTATGGATTGATGG - Intronic
1065296673 10:24282502-24282524 TTTATAACAGTATAGACTCATGG + Intronic
1065454991 10:25898014-25898036 TTTATATCAATATAGACTCATGG - Intergenic
1065681185 10:28234325-28234347 TTCAGATCAGTATGGAGTCATGG - Intronic
1065805798 10:29392680-29392702 TTGATATCAATATGAACTCATGG - Intergenic
1065846778 10:29750738-29750760 CTAATATCACTGTGGACTCATGG - Intergenic
1065942987 10:30581896-30581918 TTTATATCAATATGAACTCATGG + Intergenic
1066339673 10:34518610-34518632 TTTATATCATTATGGACTCATGG - Intronic
1066610472 10:37242506-37242528 CTTGTATCAGTATGGATTCATGG + Intronic
1066666942 10:37792347-37792369 TTTATGTCAATGTGGCCTCATGG - Intronic
1066704157 10:38159554-38159576 TTTATATTATTATGGATTCATGG + Intergenic
1066986454 10:42472325-42472347 TTTATATTATTATGGACTCATGG - Intergenic
1067074726 10:43170549-43170571 TTTGTATCAGTATAGACTCATGG - Intronic
1067363634 10:45604699-45604721 TTTATATCAGTGTAGAATCATGG + Intergenic
1067516815 10:46955359-46955381 TTTATATCAGTATGAACTCATGG - Intronic
1067645436 10:48096467-48096489 TTTATATCAGTATGAACTCATGG + Intergenic
1067671450 10:48326233-48326255 TTTATATCAGTATGGACTCATGG + Intronic
1067809292 10:49414845-49414867 TTTCCATCAGAATGGACTCATGG - Intergenic
1067815181 10:49468997-49469019 TTTAGATCAGTGTGGACTAATGG - Intronic
1068143298 10:53032412-53032434 TTTATATCAGTATGGACTCATGG - Intergenic
1068646077 10:59470072-59470094 TTTATATCAGTATGGATTCATGG - Intergenic
1068799968 10:61129507-61129529 TTTATATCAGTATGGGCTCATGG + Intergenic
1068839151 10:61590800-61590822 TTTATGTCAGTATGGATTCTCGG - Intergenic
1068957663 10:62833892-62833914 TTTATATCAATATGTACTAAGGG - Intronic
1069236458 10:66081596-66081618 TTTATATCACTATGAACTCATGG - Intronic
1069239914 10:66126772-66126794 TTTCTATCACTATGGACTTATGG - Intronic
1069391459 10:67940225-67940247 TTTATATAAGTTAGGACAAATGG - Intronic
1069668348 10:70180407-70180429 TTTATGTCCATATGGACTCATGG - Intergenic
1070166733 10:73904512-73904534 TATATATCTGTGTGGACTCCTGG - Intergenic
1070404163 10:76079815-76079837 TTTATAACAGTTAGGAGTAAGGG + Intronic
1070446389 10:76508463-76508485 TTTATAACATTGTGGTCTCATGG + Intronic
1071184073 10:83020350-83020372 TTTATATCAGTAGGGACTTGGGG - Intergenic
1071221722 10:83474859-83474881 TTTATATCAGTATGGAATCATGG - Intergenic
1071365400 10:84894499-84894521 TTTGTATAACTTTGAACTCATGG + Intergenic
1071453165 10:85819063-85819085 ATTATATCAGTATGAACTCATGG - Intronic
1071800175 10:89051218-89051240 TTTCTATCAGTGTGGACTTGTGG - Intergenic
1071930868 10:90468193-90468215 CTTATCTTAGTATGGACTCATGG + Intergenic
1072018746 10:91377935-91377957 TTTGTATCACTATGAACTCATGG + Intergenic
1072035388 10:91558533-91558555 TTTATTCCAGTTTTGAGTCAGGG - Intergenic
1074001752 10:109380408-109380430 TTTTTATCATTGTGGTCTCATGG + Intergenic
1074012873 10:109501759-109501781 TTAATATCACTGTGGACTCATGG - Intergenic
1074033623 10:109715261-109715283 TTTGTATCATTTTGGTATCAGGG + Intergenic
1074310647 10:112320253-112320275 CTTAGGTCAGTATGGACTCATGG - Intergenic
1074331616 10:112517371-112517393 TTTATATCAGTCTGGCATCATGG - Intronic
1074645039 10:115440011-115440033 TTTATATCGGTATGAACTCATGG + Intronic
1074802712 10:117017560-117017582 TTTATATCAGTATGAACTCATGG - Intronic
1075123957 10:119684582-119684604 TTTATGTCACTTTTCACTCAGGG + Intergenic
1075172043 10:120124763-120124785 TTTATATCAGTATGGACTCATGG + Intergenic
1075398896 10:122147631-122147653 TTTATATCTGCATGGACTCCTGG + Intronic
1075578823 10:123600799-123600821 CTTATAGTAGTATGGACTCATGG + Intergenic
1075842992 10:125519837-125519859 TTTATATCAATGTGGACTCGTGG - Intergenic
1076156355 10:128208757-128208779 TCTATATCAGCATGGACTCATGG - Intergenic
1076341357 10:129748239-129748261 TTTATGTTAGTATGGACTCAGGG + Intronic
1076524802 10:131105633-131105655 TTTATATTGCTATGGACTCATGG + Intronic
1076704825 10:132295525-132295547 TTGATATCACTGTAGACTCATGG - Intronic
1077676289 11:4195975-4195997 GTCATATCAGTATGAACTCATGG - Intergenic
1077957249 11:7034215-7034237 TCAATATCAGTACGGACTCATGG + Intronic
1078106087 11:8358757-8358779 TTTATGTCAGTATGGATTCATGG - Intergenic
1078499154 11:11852320-11852342 TTTGTATCAGTATGGACTTATGG + Intronic
1079068323 11:17318766-17318788 CTTATATCAGTGTAGACTCGTGG - Intronic
1079068365 11:17319203-17319225 CTTATATCAGTGTAGACTCATGG + Intronic
1079072408 11:17358759-17358781 TTGATATCAATAAGGACTCAAGG + Intronic
1079105050 11:17565657-17565679 TTTATATCAGCATAGACTCATGG + Intronic
1079476665 11:20837792-20837814 ATTATATCAGTGTAGACTCATGG - Intronic
1079590127 11:22173287-22173309 TTTATATCAGTATAGACTCATGG - Intergenic
1079620034 11:22542790-22542812 TTTATATCATCATGGACTCGTGG + Intergenic
1080077935 11:28174217-28174239 TTTATATCAGTATGGACTCATGG + Intronic
1080262148 11:30360909-30360931 TTAATATCACCTTGGACTAAAGG + Intergenic
1080301969 11:30794641-30794663 TTTATATCAGTATTGATTCATGG + Intergenic
1080320316 11:31001162-31001184 TTTGTGTCAGTATTGACTCATGG + Intronic
1080468013 11:32516503-32516525 TTTATATTAGTATGGACTCATGG - Intergenic
1080502487 11:32884048-32884070 TTTATATCAATATGTACTCATGG - Intergenic
1080820080 11:35797284-35797306 TTTATATCAGAATGGACTCATGG - Intronic
1080922695 11:36724721-36724743 TGTATATCAGTTGGGGTTCAGGG + Intergenic
1080938968 11:36893438-36893460 TTTATGTCAGTGTAGACTGATGG - Intergenic
1081089469 11:38845259-38845281 TTTATATCAGCTTGGATTTATGG - Intergenic
1081377256 11:42374657-42374679 CTTATATTAGTATGGGCTCATGG - Intergenic
1081404842 11:42685194-42685216 TTTATATCAGGTTGGACCTATGG - Intergenic
1081696786 11:45117336-45117358 CTTATATCAGTATGGACTTATGG - Intronic
1081916215 11:46732342-46732364 ATTCTATCAGTGTGGACTTAAGG + Intronic
1081950008 11:47037229-47037251 TTTATATCATTGTGGACTCATGG - Intronic
1082652455 11:55810007-55810029 TGTGTATTAGTTTGAACTCAGGG + Intergenic
1083188469 11:61032342-61032364 TTTATATCAGTATGGGCTCACGG + Intergenic
1085086224 11:73669354-73669376 TTTATATCAGTATGGACTCATGG - Intergenic
1085137335 11:74104002-74104024 TTTATATCAGGATGGATTCATGG - Intronic
1085342208 11:75739968-75739990 TTTATATCAGTATGTACTCATGG - Intergenic
1086829172 11:91538324-91538346 ATAAATTCAGTTTGGACTCAAGG + Intergenic
1086869994 11:92026311-92026333 TTTACATCAGTATGGACTCATGG - Intergenic
1086992831 11:93324442-93324464 TTTATATCAGTATGGACACATGG - Intergenic
1087020732 11:93600344-93600366 TTTATATTAATATGGTCTCATGG - Intergenic
1087100233 11:94356717-94356739 TTTATATCAGTATAGATTCGTGG - Intergenic
1087249823 11:95885597-95885619 TTTATCTTATTATGGACTCATGG - Intronic
1087496751 11:98900808-98900830 TTTATATCAGTATGGACTTATGG + Intergenic
1087554433 11:99697109-99697131 TTTGTATCAGTAGGGACTCAAGG - Intronic
1087957881 11:104311967-104311989 TTTATATTCATTTGGACTCAAGG - Intergenic
1088174367 11:107034322-107034344 TATTTATCAGTATGGACTCATGG - Intergenic
1088183295 11:107136232-107136254 TTTATATCAGTATGGACTTCTGG - Intergenic
1088262138 11:107954259-107954281 TTTATCCCACTTTGAACTCATGG - Intronic
1088263240 11:107964990-107965012 TTTATGCCATTTTGGACTGATGG - Intergenic
1088391863 11:109323621-109323643 TTTATATTAGTGTTAACTCATGG + Intergenic
1088456975 11:110042879-110042901 TTTAAATTTGTATGGACTCAAGG - Intergenic
1088505826 11:110526020-110526042 GTTATATCACTTTGGGCTCCTGG - Intergenic
1088570353 11:111217852-111217874 TTTATATCAGTATGAATTAATGG - Intergenic
1089025337 11:115263590-115263612 ATTATATCAGTATGGACTCATGG + Intronic
1089557907 11:119325216-119325238 TTATTATCAGTTTGGAGTCATGG - Intergenic
1089872739 11:121690907-121690929 TTTATATAAGTTAAGTCTCAGGG + Intergenic
1090491282 11:127163032-127163054 TTTATTTTATTTTGGATTCAGGG - Intergenic
1090529024 11:127570401-127570423 TTTATATTAGGTTGTACTCTTGG - Intergenic
1090730647 11:129570695-129570717 TTTATATCCATTTGGATACAAGG - Intergenic
1090746156 11:129706497-129706519 TTTATATCGGTACAGACTCATGG + Intergenic
1090859704 11:130641925-130641947 TTTATATCAGTATGGATTCATGG + Intergenic
1091149000 11:133308940-133308962 TTTATATCAATGTGAACTCATGG - Intronic
1091348291 11:134870690-134870712 TTTATATCAGTACGGACTCATGG + Intergenic
1091354500 11:134925245-134925267 TTTATATCACTATAGACTCGTGG + Intergenic
1091521288 12:1246377-1246399 TTTATATCAGCATAAACTCATGG - Intronic
1092189535 12:6508475-6508497 TTTATAGCAGAATGGACTTAGGG - Intronic
1092444998 12:8546933-8546955 TTGACATCAGTATAGACTCATGG + Intergenic
1092446841 12:8566027-8566049 TTGACATCAGTATAGACTCATGG - Intergenic
1092657810 12:10705753-10705775 TTTATATTTGTATGGACTCATGG + Intronic
1093393778 12:18655384-18655406 TTTATAGCAGTGTGGATTCGTGG - Intergenic
1093514318 12:19968026-19968048 TTGAAATCAGCTTGGACTAAAGG - Intergenic
1093884760 12:24447001-24447023 TTTCTATCAATATGGACTCATGG - Intergenic
1093978438 12:25449660-25449682 TTTATATCAGTATGTACTCATGG + Intronic
1094005713 12:25748395-25748417 TTTATATCAGTATGGACTCATGG + Intergenic
1094021582 12:25920008-25920030 TTTATATGACTATTGACTCATGG - Intergenic
1094070467 12:26407262-26407284 TTTATAAGAGTTTGTATTCAGGG + Intronic
1094194365 12:27731023-27731045 TTTATATCAGTATGGACTCATGG + Intronic
1094321533 12:29189241-29189263 TTTATATCAGTACAAACTCATGG + Intronic
1094371723 12:29745731-29745753 TTTATAACTGTTTATACTCAGGG - Intronic
1094373131 12:29759903-29759925 TTATTATTAGTATGGACTCATGG - Intronic
1094770999 12:33659872-33659894 TTTATTTCAGTTTGGATTCTGGG - Intergenic
1094800782 12:34032439-34032461 TAAATATTAGTTTTGACTCATGG - Intergenic
1095116480 12:38359272-38359294 TTTATGTCAGTATGGATTAATGG - Intergenic
1095207769 12:39457963-39457985 TTTATATTAGTATGGGCTCATGG + Intergenic
1095414102 12:41956710-41956732 TTTTTATCAGTATGGACTCATGG - Intergenic
1095701755 12:45197913-45197935 TTTATATCTGTGTGGACTCATGG + Intergenic
1096017306 12:48288716-48288738 TTTACATCAGTAGGAACTCATGG + Intergenic
1096452389 12:51755268-51755290 TTTATATCAGTATGGATTAATGG + Intronic
1096527305 12:52218457-52218479 TTTACATTAGTGTAGACTCAGGG + Intergenic
1096922543 12:55102920-55102942 TTTATATAAGCGTGAACTCATGG + Intergenic
1097230759 12:57509048-57509070 TTATTATCAGTATAGACTCATGG + Intronic
1097342660 12:58456525-58456547 TTTAGTTAAGTTTGGGCTCAAGG - Intergenic
1097945058 12:65358385-65358407 TTTATATCAGTATAGACTCATGG + Intronic
1098209740 12:68151048-68151070 TTTATATCAATATATACTCATGG + Intergenic
1098331285 12:69356371-69356393 ATTATATCAGTATGGACCCATGG + Intergenic
1098665760 12:73161189-73161211 TTTGTATAACTTTGAACTCATGG + Intergenic
1098778950 12:74659598-74659620 TTTATATCAGAATAGATTCATGG + Intergenic
1098887224 12:75972623-75972645 TCAATATCAGTATGGACTCGTGG + Intergenic
1098899163 12:76095062-76095084 CTTATATCATTATGGACTCATGG - Intergenic
1099306861 12:80968187-80968209 TTTATATCAGCATAGACTCATGG + Intronic
1099585951 12:84513761-84513783 TTTATATCGGTATGGTCTCAGGG + Intergenic
1099645409 12:85347267-85347289 ATTATACCAATTTGGTCTCAGGG + Intergenic
1099832853 12:87867435-87867457 TTTATGTCAGTATGGACTCATGG - Intergenic
1100202057 12:92309498-92309520 TTTGTACCAGTATGGGCTCATGG + Intergenic
1100961279 12:99965372-99965394 TTTATATCAGTGTGGACTCATGG - Intronic
1101619216 12:106368006-106368028 TTTATATCAATTTGGACTCATGG + Intronic
1101908294 12:108844250-108844272 TTTCTATGATTTTGGACTTAGGG - Intronic
1102020966 12:109682526-109682548 TTTTTATTAGTGTGGACTCATGG + Intergenic
1102109604 12:110355060-110355082 TTTATGTCAGCGTGGACTTATGG - Intergenic
1102541716 12:113624642-113624664 TTTATATCAGTATGAAAGCATGG + Intergenic
1102944613 12:116975040-116975062 TTGATACCAATATGGACTCATGG - Intronic
1103788662 12:123453531-123453553 TTTATATCAGTAGGGACTGGTGG + Intergenic
1103889890 12:124230672-124230694 TTCATAGCAGTATGGACTCATGG + Intronic
1104156997 12:126142915-126142937 TTTATATCAGTAGGGACTCATGG - Intergenic
1104160490 12:126175023-126175045 TTTATATTAGTATGGACACATGG + Intergenic
1104327770 12:127816406-127816428 TTTATATCAGTATAAACTCATGG - Intergenic
1104668486 12:130664825-130664847 TTTATATCAGTATGGACTGATGG - Intronic
1104737694 12:131147944-131147966 TTGATATCAGTACAGACTCATGG + Intergenic
1105419225 13:20237955-20237977 TTGATATCAGCATGGACTCATGG + Intergenic
1105620038 13:22057827-22057849 TTTATATCAGTATGGGCTCATGG + Intergenic
1105621449 13:22071384-22071406 TTTTTCCCAGTTTTGACTCAAGG - Intergenic
1105786097 13:23750774-23750796 TTTATATCAATATGGACTCATGG + Intronic
1106096996 13:26655727-26655749 TTTATATCAGTATGGACTGATGG + Intronic
1106128132 13:26917580-26917602 TTTATATTAGTGTGGATTCTTGG + Intergenic
1107260954 13:38490448-38490470 TTTACATCAGTGTGGACTCATGG + Intergenic
1107265400 13:38547144-38547166 TTTATATCAGCATTGACTCATGG - Intergenic
1107271271 13:38619973-38619995 TTTATATTACTATGAACTCATGG - Intergenic
1107588678 13:41881070-41881092 TTTCTATCAGTATGGACTCATGG + Intronic
1107699614 13:43034647-43034669 TTTATATTAGTTTGGTTTCATGG + Intronic
1107796476 13:44057878-44057900 TTTATATCATTATGGACTCATGG - Intergenic
1107866406 13:44707500-44707522 TTTACATCACTATAGACTCATGG + Intergenic
1107895046 13:44953506-44953528 CTCATATCAGTATAGACTCATGG + Intronic
1107951199 13:45463973-45463995 TTTATAGCAGTATGGACTCATGG + Intergenic
1107959785 13:45547751-45547773 TTTATATCAGCTTGTACACAAGG - Intronic
1108310028 13:49179635-49179657 TTTATATCAGTATGTACTCATGG + Intronic
1108336939 13:49453169-49453191 TTTATATCAGCATGGACTCATGG + Intronic
1108378513 13:49835779-49835801 TTTATATCAGTATGGACTCATGG + Intergenic
1109024150 13:57139366-57139388 TTTATATCCGTATGGACTTATGG - Intergenic
1109025045 13:57145466-57145488 TTTATATCCGTATGGACTTATGG - Intronic
1109026032 13:57152036-57152058 TTTATATCCGTATGGACTTATGG - Intronic
1109027022 13:57158609-57158631 TTTATATCCGTATGGACTTATGG - Intergenic
1109028014 13:57165180-57165202 TTTATATCCGTATGGACTTATGG - Intergenic
1109029000 13:57171745-57171767 TTTATATCCGTATGGACTTATGG - Intergenic
1109139004 13:58689922-58689944 TTTATGTCAGTTTGAACTCATGG - Intergenic
1109426638 13:62172668-62172690 TTTATGTCTGTGTGTACTCAAGG - Intergenic
1109558372 13:64012597-64012619 TTTATATGAGTATGGACTTATGG + Intergenic
1110019086 13:70446260-70446282 TTGATATCAGTATGGACATATGG + Intergenic
1110310621 13:74044958-74044980 TTTATATCAGTGTGGATTCATGG - Intronic
1110383791 13:74884577-74884599 TTTATATAAGTATGGTCTCAGGG + Intergenic
1110432044 13:75435909-75435931 TTTATATCAGTGTGGATTCATGG - Intronic
1110440827 13:75523430-75523452 TTGATATCAGTATGTACCCATGG - Intergenic
1110784257 13:79504870-79504892 TTTATATCAGTATGAATTCATGG + Intronic
1110982932 13:81925118-81925140 TTATTATCTGTATGGACTCATGG + Intergenic
1111216788 13:85153614-85153636 TTTACATCAGTGTGGATTCATGG + Intergenic
1111243545 13:85507283-85507305 TTTATATCAGCATAAACTCACGG - Intergenic
1111367223 13:87264502-87264524 TTTATATCAATATAGATTCATGG + Intergenic
1111414514 13:87922052-87922074 TTTATATCAGTATGTATTTAAGG + Intergenic
1111434490 13:88188923-88188945 TTTGTATCAGTATGAACTCATGG - Intergenic
1111475237 13:88737819-88737841 TATACTTCAGCTTGGACTCAAGG - Intergenic
1111887669 13:94042935-94042957 TTTATATCGGTATGAGCTCATGG + Intronic
1112347610 13:98603611-98603633 TTTACATCAGTATGGACTTATGG + Intergenic
1112605480 13:100901331-100901353 TCTATATAAGTCTGGACTCATGG + Intergenic
1112784826 13:102940191-102940213 TTTATATCAGTATGGACCCATGG + Intergenic
1112855843 13:103768591-103768613 ATTGTATCAGCTGGGACTCAGGG + Intergenic
1113825366 13:113248347-113248369 TTTATATCATTATGAACTCAGGG + Intronic
1114201246 14:20522762-20522784 TTTATATCAGTATGGATTCATGG + Intergenic
1114440817 14:22745969-22745991 CGTACATCAGTTTGGACTCTTGG + Intergenic
1114927129 14:27417502-27417524 TTTATATCAGTATGAACTCTTGG - Intergenic
1115032960 14:28819900-28819922 TTTATATCAATATGGACTCCTGG - Intergenic
1115068172 14:29291132-29291154 TCTATATCAGTATGGACTTATGG - Intergenic
1115347656 14:32360601-32360623 TTTATATCAGTATAGGCTCACGG + Intronic
1115626776 14:35201431-35201453 TTTATGGTAGTATGGACTCATGG + Intronic
1115841300 14:37473589-37473611 ATTAGAACAGTTTAGACTCACGG + Intronic
1116296856 14:43121736-43121758 TATATATCAGTATGAACTCATGG - Intergenic
1116903618 14:50384624-50384646 TTCATATCACTGTGGATTCATGG - Intronic
1116991343 14:51280119-51280141 TTTTTATCAATTTGGACTTACGG + Intergenic
1117605850 14:57428312-57428334 TTTATATAAATATGGACTCAAGG + Intergenic
1118194271 14:63610280-63610302 TTTTTATCAGTATGGACTCATGG - Intronic
1118451126 14:65903358-65903380 TTTATATCAGTATGGACTCATGG - Intergenic
1118472271 14:66085596-66085618 CTTATATCAGTATGGACTCATGG - Intergenic
1118472887 14:66091700-66091722 TTTATATCAGTATGGACTCAGGG + Intergenic
1118673832 14:68161049-68161071 TTTCTATAAATTGGGACTCAAGG + Intronic
1119043268 14:71294852-71294874 TAAATAGCATTTTGGACTCATGG + Intergenic
1119106455 14:71929796-71929818 TTTCTATCAGCATGGACTCATGG + Intergenic
1119527946 14:75337325-75337347 TTTATATTGGCATGGACTCATGG + Intergenic
1119534487 14:75391858-75391880 CTTATATCAGTATGGACTCCTGG - Intergenic
1119676437 14:76559014-76559036 TTTATATCAGTATGGATTTGGGG - Intergenic
1119794579 14:77384444-77384466 TTGATATTAGTGTGGACTTATGG + Intronic
1119845811 14:77828836-77828858 TTTTTATCACTATGAACTCATGG + Intronic
1119864208 14:77959638-77959660 TTTATATCAGTACACACTCATGG - Intergenic
1120076189 14:80161126-80161148 TTTACATCTATATGGACTCATGG + Intergenic
1120617876 14:86730456-86730478 TGTATATCAATATGGACTTATGG - Intergenic
1120698765 14:87674633-87674655 TTTATATCGGCATGGACTCATGG + Intergenic
1120699551 14:87683770-87683792 TTTATATCCTTGGGGACTCATGG - Intergenic
1120769483 14:88362773-88362795 TTTAATTCAGTTTGTACACAAGG - Intergenic
1120961151 14:90126123-90126145 CTTAAATCAGTGTGGACTTAGGG - Intronic
1120986171 14:90336969-90336991 TTTGTATCATTTAGGACTCTTGG - Intergenic
1121260500 14:92562519-92562541 CTTATATCATTGTGGAATCAGGG + Intronic
1121572655 14:94958832-94958854 TTTAAATCAGTATGGACTCATGG + Intergenic
1121677052 14:95761966-95761988 TTTATATCAGTATAGGCTCATGG - Intergenic
1121818946 14:96950481-96950503 TTTATATCAGAATGCACTCAAGG + Intergenic
1122105333 14:99449078-99449100 TTCATATCGGTATGGACTCATGG - Intronic
1122250226 14:100433686-100433708 TTTGTATCCATGTGGACTCATGG + Intronic
1122396091 14:101433016-101433038 TTTCTATCAGGATAGACTCATGG - Intergenic
1122830875 14:104395037-104395059 TTTAAATCAGCTTTGCCTCATGG - Intergenic
1123667080 15:22616434-22616456 TTTATATCAATGTGTCCTCACGG + Intergenic
1123789438 15:23705958-23705980 TTTATATCAGTATGGACTCATGG + Intergenic
1123798261 15:23795382-23795404 TTTATATCATTATGAACTCATGG - Intergenic
1123929418 15:25155255-25155277 TTTACATCAATATGGATTCATGG - Intergenic
1124057587 15:26256372-26256394 TTTATACCAGTATGCACTCATGG + Intergenic
1124104766 15:26727337-26727359 ATTGTATCAGTGTGGACTCATGG + Intronic
1124320922 15:28711002-28711024 TTTATATCAATGTGTCCTCACGG + Intronic
1124358019 15:29012599-29012621 TTTATATTTGTATGGACTCATGG + Intronic
1124398698 15:29329818-29329840 TTTATAGAAATATGGACTCATGG - Intronic
1124429680 15:29595762-29595784 TTTATATAAATATGGTCTCATGG + Intergenic
1124522019 15:30412841-30412863 TTTATATCAATGTGTCCTCATGG + Intronic
1124536646 15:30553377-30553399 TTTATATCAATGTGTCCTCATGG - Intronic
1124563069 15:30792868-30792890 TTTATATCAATGTGTCCTCATGG - Intergenic
1124594170 15:31080060-31080082 TTTATATCAGTGTGGACCCATGG - Intronic
1124762007 15:32454215-32454237 TTTATATCAATGTGTCCTCATGG + Intronic
1124776622 15:32594853-32594875 TTTATATCAATGTGTCCTCATGG - Intronic
1124960221 15:34388331-34388353 TTTATATCAATGTGTCCTCATGG + Intronic
1124976850 15:34534552-34534574 TTTATATCAATGTGTCCTCATGG + Intronic
1125294622 15:38189367-38189389 TTTATAACAGTTTGGAATCTGGG - Intergenic
1125763473 15:42115975-42115997 TTTATATTAGTATGGACTCATGG + Intergenic
1125792295 15:42376399-42376421 TTTATATCAATATGGACTCATGG + Intronic
1126010025 15:44293955-44293977 CTTGTATCGGTATGGACTCATGG + Intronic
1126272536 15:46838115-46838137 TTTATATTGGTAAGGACTCATGG - Intergenic
1126359441 15:47831115-47831137 TTTATATCAGTCTAGACTCTTGG - Intergenic
1126434375 15:48621088-48621110 TATTTATCAGTATGGACTTATGG - Intronic
1126676919 15:51167539-51167561 TTTCTATCAGTGTGCTCTCAGGG + Intergenic
1126904496 15:53349777-53349799 TTTATATTAGTATGAACTCATGG - Intergenic
1126944536 15:53804404-53804426 TTTATATCAGTATGGATTCATGG - Intergenic
1127031690 15:54871659-54871681 TTTATATCAGTATGGATTCATGG - Intergenic
1127041533 15:54982317-54982339 TTTATATCATTATGGAGTCATGG - Intergenic
1127265548 15:57358219-57358241 TTTATATGAGTATGGACTCATGG - Intergenic
1127441527 15:59013757-59013779 TTTATATCAGTATGGATTCATGG + Intronic
1127878280 15:63131330-63131352 TTCATACCAGTATGCACTCATGG + Intronic
1127945808 15:63750928-63750950 TTTATTTTATTTTGAACTCAGGG - Intronic
1128394132 15:67206602-67206624 TTTATATTAGTATGAACTCATGG + Intronic
1128413883 15:67425886-67425908 TTTATGTCAGTATGAAGTCATGG + Intronic
1128586343 15:68853674-68853696 TTTATATCAGTATGGACTCATGG - Intronic
1128591730 15:68903978-68904000 TTTATATCAGTATGGATTCATGG + Intronic
1128774042 15:70305559-70305581 TTTATATCAGTATAGACTCAAGG + Intergenic
1128808007 15:70547724-70547746 TGTATACCAGTATGGACTCATGG - Intergenic
1128888892 15:71313129-71313151 TTGATATCAGTATGGACCCATGG + Intronic
1129036973 15:72656096-72656118 TTTATATCAATGTGTCCTCATGG - Intronic
1129176788 15:73846054-73846076 CCTATCTGAGTTTGGACTCATGG - Intergenic
1129212914 15:74081129-74081151 TTTATATCAATGTGTCCTCATGG + Intronic
1129306449 15:74667728-74667750 TTTATATCAGCATGTACTCATGG - Intronic
1129358136 15:75006323-75006345 ATAATGTCACTTTGGACTCATGG + Intronic
1129397488 15:75259957-75259979 TTTATATCAATGTGTCCTCATGG - Intronic
1129401097 15:75284234-75284256 TTTATATCAATGTGTCCTCATGG - Intronic
1129531690 15:76270840-76270862 TTTATATCAGTATGGACTTATGG - Intronic
1129655556 15:77522660-77522682 GTTATCTCTGTATGGACTCAGGG - Intergenic
1129730051 15:77925445-77925467 TTTATATCAATGTGTCCTCATGG + Intergenic
1129838466 15:78728542-78728564 TTTATATCAATGTGTCCTCATGG - Intergenic
1130216890 15:81980184-81980206 TTTATATTAGTGTGGATTCATGG + Intergenic
1130890576 15:88130219-88130241 TTTGTATCAATATGGACTCATGG - Intronic
1131325191 15:91436628-91436650 TTTACATCAATTAGGACTCTTGG - Intergenic
1131345132 15:91639660-91639682 TTTATCTCAATGAGGACTCATGG - Intergenic
1131685544 15:94763710-94763732 ATTTTATCAGATTGGAATCAAGG + Intergenic
1132162976 15:99560549-99560571 TTTGTATCAGTACGGGCTCATGG + Intergenic
1132174101 15:99694833-99694855 TTTCTATCAATATGGACTCGTGG + Intronic
1132433764 15:101780648-101780670 TTTATATCAATGTGTCCTCATGG + Intergenic
1132706541 16:1246029-1246051 TTTATATCAGCATTGACTCATGG + Intergenic
1132706784 16:1247564-1247586 TTTATAACTGTATAGACTCATGG + Intergenic
1133007267 16:2891021-2891043 TTTGTATCAGCTTGGACTCATGG + Intronic
1133692149 16:8226934-8226956 TTTATATCAGCGGAGACTCATGG - Intergenic
1134075597 16:11289097-11289119 TTTATATCAGTATGGATCCATGG + Intronic
1134324578 16:13195400-13195422 TTCATATCAGTGTAGACACATGG - Intronic
1134518282 16:14904611-14904633 TTTATAGCAGTATGGAATCATGG - Intronic
1134555647 16:15161612-15161634 TTTATAGCAGTATGGAATCATGG + Intergenic
1134705953 16:16303269-16303291 TTTATAGCAGTATGGAATCATGG - Intergenic
1134961587 16:18408841-18408863 TTTATAGCAGTATGGAATCATGG + Intergenic
1134965887 16:18491444-18491466 TTTATAGCAGTATGGAATCATGG + Intronic
1135151746 16:20013085-20013107 GTTAGATCTGTATGGACTCATGG - Intergenic
1135430314 16:22376884-22376906 TTTATGTCAGTATGGACTCATGG - Intronic
1135713943 16:24744509-24744531 TTCATATCAGTATGGACCCATGG + Intronic
1135767933 16:25193979-25194001 TTTTTATCAGTATGGATTCATGG + Intergenic
1136285465 16:29237941-29237963 TTTATATTAGTGTGGACTCGTGG + Intergenic
1137297379 16:47108124-47108146 ATTACATCAGTATGGGCTCATGG - Intronic
1137348689 16:47690587-47690609 TTTATATTAGCATAGACTCATGG - Intronic
1137354255 16:47744125-47744147 TTTATATCAGAATGAATTCATGG + Intergenic
1137508520 16:49077840-49077862 TTTATATCAGTTTGAACTTATGG + Intergenic
1137528473 16:49260220-49260242 TTTATATCAGTATAGATTCATGG - Intergenic
1137648518 16:50097410-50097432 TTAGTATCATTTTGAACTCAGGG + Intronic
1137889384 16:52142734-52142756 TTTATATCAGTATAGACACATGG - Intergenic
1138003096 16:53302705-53302727 TTCATATCAGTATGGATTCATGG + Intronic
1138010892 16:53379071-53379093 TTTTTATCAGTAGGAACTCATGG + Intergenic
1138256145 16:55563373-55563395 TTTATCTGACTTTGGCCTCATGG - Intronic
1138267989 16:55673946-55673968 TTTATATCAGTATGGGCTCCTGG + Intronic
1138394652 16:56694765-56694787 GTTATATCAGAATGGATTCATGG + Intronic
1138585755 16:57969598-57969620 TTTATTTCAGTTTTGAGACAGGG - Intronic
1138620874 16:58210107-58210129 TTTATATTATTATGGACTCATGG + Intergenic
1138653719 16:58477551-58477573 TTTATATCAATAAGGACTCATGG - Intronic
1138793370 16:59936573-59936595 TTTATGTCAGTAAAGACTCATGG + Intergenic
1138919365 16:61508428-61508450 TTTATATTATTTTGGATTCAAGG - Intergenic
1139045977 16:63060751-63060773 TTTGTATCTGTTTGTACTCCAGG - Intergenic
1139255779 16:65540978-65541000 TTTAGATAAGTATGAACTCATGG + Intergenic
1139376996 16:66505658-66505680 TTTATATCAGCATGGATTCGTGG + Intronic
1139765424 16:69224743-69224765 TTTATATTATTGTGGACTCTTGG + Intronic
1139971014 16:70775114-70775136 TTTATGTCATTATGGACTCCTGG + Intronic
1140097361 16:71885949-71885971 TCTTGATCAGTTTGGACTGAGGG + Intronic
1140132768 16:72178574-72178596 TTTACATCACTATGAACTCATGG + Intergenic
1140247011 16:73260377-73260399 TTTATATCAGCATGGACTCATGG + Intergenic
1140482620 16:75270065-75270087 TTTATATCAGTATGGACTTATGG + Intergenic
1140523456 16:75602134-75602156 GTGATATCAGTTTGAACTCTTGG + Intronic
1140623698 16:76767477-76767499 TTTATATTAGTATGGTATCATGG - Intergenic
1140880778 16:79196385-79196407 TTTATACCAGTTTGAACCGAGGG + Intronic
1141038601 16:80652421-80652443 TTTAAAGCAGTATGGACTCATGG - Intronic
1141074324 16:80989353-80989375 TTTATATGAGTTTGGACTCATGG + Intronic
1141572946 16:84945317-84945339 TTTGTGTCAGCATGGACTCAAGG - Intergenic
1142090792 16:88208081-88208103 TTTACATTAGTGTGGACTCGTGG + Intergenic
1142529456 17:569525-569547 TCTATGTCAGCATGGACTCATGG - Intronic
1142531877 17:584880-584902 TATATATCAGTATGAACTCATGG - Intronic
1142884981 17:2906847-2906869 TTTGTATTAGTTAGGACTCTTGG + Intronic
1142964992 17:3575084-3575106 TTTGTATCAGAATGGCCTCATGG - Intronic
1143004840 17:3823413-3823435 TTTACATCAGTTTAGAATCATGG - Intronic
1143656428 17:8296274-8296296 ATTTAATCAGTATGGACTCATGG + Intergenic
1143743493 17:8972437-8972459 TTTATGTCATTATGGACTCTTGG - Intergenic
1143802705 17:9397660-9397682 TTTTTATCAATATGGACTCATGG - Intronic
1143942306 17:10555186-10555208 TTTGTATCTGTTTGCACTCATGG + Intergenic
1144383912 17:14730859-14730881 TTGATATCAGTATGCAGTCATGG - Intergenic
1144712180 17:17409066-17409088 TTTATATCAGTATGGATTAATGG + Intergenic
1144973386 17:19126065-19126087 TTTATATTAATATGGACTCATGG - Intergenic
1145092127 17:19994704-19994726 TTGATTTCAGTAAGGACTCAGGG + Intergenic
1145290309 17:21539480-21539502 TCTATATCAGTATGGACTTGTGG - Intronic
1146109227 17:30072897-30072919 TTTATAGCAGTATGTATTCATGG + Intronic
1146331037 17:31927423-31927445 TTTATATCAGTATGGATTCATGG - Intergenic
1146436920 17:32858806-32858828 TTTATGTAAGTATGGACTCATGG + Intronic
1146934280 17:36801893-36801915 TTTGTATCAGTATGGATTCATGG + Intergenic
1147275933 17:39316650-39316672 TTTACATCAGTCTGAACTTATGG - Intronic
1147277243 17:39328554-39328576 TTTATATCCGTATGGATTCATGG - Intronic
1147665408 17:42144124-42144146 TTTATATCAGTATGGACTCCAGG - Intronic
1147929408 17:43968429-43968451 TTTGTTTCATTTTGGTCTCAGGG - Intronic
1148474807 17:47921222-47921244 TTTATGTCATTATGGACTCACGG + Intronic
1149236602 17:54598373-54598395 TTTACATCAGTATGGACAGATGG - Intergenic
1149837817 17:59929566-59929588 TTTATGTCATTGTGGACTTAGGG + Intronic
1150081521 17:62243978-62244000 TTTATGTCATTGTGGACTTAGGG - Intergenic
1150097430 17:62389769-62389791 TTTCTATCAGTGTGGATTCATGG - Intronic
1150692902 17:67379789-67379811 TTGATATGAGTTTGGATTCTAGG + Intronic
1150718781 17:67596720-67596742 TTTTTATCAGTTTAGAATAAAGG - Intronic
1151055753 17:71029565-71029587 TTGATACCAGTATGCACTCATGG - Intergenic
1151062904 17:71117160-71117182 TTTATTTCAGTCTGGCATCATGG - Intergenic
1151112620 17:71696927-71696949 TTTATATCAGTATGGACTCATGG - Intergenic
1151179347 17:72314942-72314964 TTTATAGCAGTATGGACTCATGG + Intergenic
1151212575 17:72555559-72555581 TTTATATCAGTATGGGCTCATGG - Intergenic
1152001567 17:77648937-77648959 TTTATATCCATATAGACTCATGG + Intergenic
1152712431 17:81879698-81879720 TATATATCAGTATGAACGCAAGG - Intergenic
1153198136 18:2623558-2623580 TTTATGTCAGTATGGACCCATGG + Intergenic
1153482506 18:5561491-5561513 TTTTTAGGAGTATGGACTCATGG - Intronic
1153606009 18:6833839-6833861 TTTATATCAGAATGGACTCCTGG + Intronic
1155878555 18:31116444-31116466 TTTTTATAAATTTGCACTCAGGG + Intergenic
1156114310 18:33768565-33768587 TTTATACCAGTATGGACTCGTGG + Intergenic
1156367540 18:36443357-36443379 TTTGTATCAGTATGAACTCATGG + Intronic
1156577347 18:38333390-38333412 TTTATGTCAGTATAGACTCATGG + Intergenic
1156643433 18:39130120-39130142 TTCATATTAGAATGGACTCATGG + Intergenic
1156652917 18:39248059-39248081 TTTATACCAGTAAGGACTCATGG - Intergenic
1157004456 18:43565269-43565291 TTTATATCAGTGTGAACTCATGG - Intergenic
1157128414 18:44979675-44979697 TTTATATCAGTGTGGACCATTGG - Intronic
1157137769 18:45073902-45073924 TTTATATTGGTATAGACTCATGG + Intergenic
1157149442 18:45201413-45201435 TTTATATCGGTATGGACTCATGG + Intergenic
1157155710 18:45263675-45263697 TGTATATCGGTTTAGACTCATGG + Intronic
1157213945 18:45766717-45766739 TTTATAATATTTTAGACTCAGGG + Intergenic
1157348281 18:46860648-46860670 TTTATAACAGTGTGGACTCATGG - Intronic
1157635849 18:49153658-49153680 TTTCTATCAGTTTGGACACATGG - Intronic
1157918042 18:51688841-51688863 TCTATATCTGTATAGACTCATGG + Intergenic
1157968180 18:52233761-52233783 TTTATTTCTGTTTTGACCCATGG - Intergenic
1157978880 18:52357483-52357505 TTTATGTCAGTATGTACTCATGG - Intronic
1158494926 18:57946359-57946381 TTTATATCAGATTTGACTAAAGG + Intergenic
1158607214 18:58906287-58906309 TTTATATCAGTATGCATTCATGG + Intronic
1158656157 18:59336476-59336498 TTTAGATCAGTTCAGACTCATGG - Intronic
1158783037 18:60674981-60675003 CTTATATCAGAAGGGACTCATGG - Intergenic
1159097901 18:63925619-63925641 TTTATATCAGTATAGACTCATGG - Intronic
1159676616 18:71291502-71291524 TTTCTATCAGTATGGACTCATGG + Intergenic
1159693864 18:71528316-71528338 TTTATGTAGGTATGGACTCATGG + Intergenic
1159819031 18:73116276-73116298 TTTCTATTAGTTTGGACTAATGG - Intergenic
1159865518 18:73700015-73700037 TTTATTTCAGTATGGACCTATGG + Intergenic
1159903278 18:74067650-74067672 TTTCTATCAGTATAGAATCATGG - Intergenic
1159908583 18:74121740-74121762 TTAATGTCACTTTGGACTCTTGG - Intronic
1159956448 18:74521653-74521675 TTTATATTAGTATGGACTCATGG - Exonic
1159964295 18:74580621-74580643 TTTCTATGAGTTTGTATTCAGGG - Intronic
1160139016 18:76302673-76302695 CTTATTTCTGTATGGACTCATGG - Intergenic
1160289428 18:77577469-77577491 TTCATATCAGTATGGACCCATGG - Intergenic
1160361441 18:78285285-78285307 TTTAGATCAGTATGGACTCATGG + Intergenic
1160377243 18:78422350-78422372 TTAAAATCAGTATAGACTCATGG - Intergenic
1160626972 18:80217235-80217257 TTTACATCATTGTGGAGTCATGG - Intronic
1162494620 19:11016662-11016684 TTAATATGAGTATGGACCCACGG + Intronic
1162836529 19:13322401-13322423 TTGATTTCAGTTTGGACTTCTGG + Intronic
1164679688 19:30125639-30125661 CCTATATCAGTATGGATTCATGG - Intergenic
1165174540 19:33918079-33918101 TTTATAGGAGTATGGACTCATGG - Intergenic
1165174815 19:33920950-33920972 CTTATATTAGTATGGACTCATGG - Intergenic
1165195299 19:34097844-34097866 TTAATATCAGTGTGGACTCATGG - Intergenic
1165801105 19:38551002-38551024 TTTATATCAGTGTGGATTCACGG + Intronic
1165807397 19:38588974-38588996 TTTATACCAGCATGGTCTCATGG - Intronic
1165889649 19:39103261-39103283 TTTATGTCCGTGTGAACTCATGG + Intronic
1166059196 19:40314572-40314594 TTTTTATGAGTTTGGACTCAGGG - Intergenic
1166254973 19:41597421-41597443 TTTATATTAGTAGGAACTCATGG + Intronic
1166261189 19:41642371-41642393 TTTATATCAGCATGGACTCATGG - Intronic
1166412294 19:42563838-42563860 TTTATATCAGCATGGATTCATGG - Intergenic
1167198293 19:48045899-48045921 TTTATCTGAGTATGGACTCCTGG - Intergenic
1167317518 19:48773813-48773835 TTTATGTCTGTGTGGACTCATGG + Intergenic
1168430480 19:56275412-56275434 TTTATATCAGCGTGAACTCAGGG + Intronic
1168487250 19:56774387-56774409 TTTATATCAGATTGGATTCGTGG - Intergenic
925545058 2:5006782-5006804 TTTACATCAGTATGGACTCATGG - Intergenic
925704540 2:6671424-6671446 TTTATATCAATATGAACTCATGG + Intergenic
925848253 2:8053132-8053154 TGTATATCAGTTTGGAATTATGG - Intergenic
925934213 2:8738159-8738181 GTTATATTACTATGGACTCATGG - Intronic
925965257 2:9059652-9059674 TTTTTATCAGTATGGGTTCATGG - Intergenic
925966130 2:9068043-9068065 CTTATATCAGTATGGATCCATGG + Intergenic
926389967 2:12379630-12379652 TTTTTAACATTTTGGGCTCAAGG + Intergenic
926448787 2:12976592-12976614 TGTATATCAGTATGTACTTATGG + Intergenic
926768784 2:16349651-16349673 TTGATCTCACTCTGGACTCAAGG - Intergenic
926926183 2:17989960-17989982 TTTATGTCAGTATGGACACATGG - Intronic
926938288 2:18108348-18108370 TTTATATCAGAATGGACTAATGG + Intronic
926949143 2:18222437-18222459 TTTATTTCAATATAGACTCATGG - Intronic
927445150 2:23153856-23153878 TGTATTTCAGTATGGACTCATGG - Intergenic
927611456 2:24545421-24545443 TTTTAATCAGTGTGGACTTAGGG - Intronic
927730214 2:25464488-25464510 TTTATATCAGTGTGGACTCATGG - Intronic
928031399 2:27782975-27782997 TTTATATCAGTATGAACTCATGG + Intronic
928032446 2:27793119-27793141 TTTATATCAGTATAGACTTGTGG - Intronic
928477402 2:31643811-31643833 TTCATATCAGCATGGACACATGG - Intergenic
928839902 2:35593210-35593232 TTTATATTAGTATGAACTCATGG - Intergenic
928996558 2:37298068-37298090 TATATATCAATATAGACTCATGG + Intronic
929035331 2:37685712-37685734 TTTGTATCATTATGGTCTCATGG - Intronic
929236747 2:39613226-39613248 CTTATATCAGTATGGACTCATGG + Intergenic
929472617 2:42210655-42210677 TTTATTTCAGTATGGACTCATGG + Intronic
929577530 2:43061732-43061754 TTTATATAAGTTCAAACTCATGG + Intergenic
930290624 2:49488978-49489000 TTTATAGCAGGTTGGCCTCCTGG - Intergenic
930340135 2:50102318-50102340 ATTTTATCAGTTTTGAGTCATGG - Intronic
930428500 2:51242886-51242908 TTTATTTCAGTATGGACTCCTGG + Intergenic
930588906 2:53303509-53303531 TTTATATCAGTATAAACTTATGG + Intergenic
930732497 2:54741792-54741814 TTTATATCACTATGGATGCAAGG - Intronic
931865447 2:66405371-66405393 TTTATATAAGTATGAACTCAAGG - Intergenic
931903090 2:66812201-66812223 TTGATACCAGTATTGACTCATGG + Intergenic
932160611 2:69456133-69456155 TTTATATCAGTATGGGCTCATGG + Intergenic
932315822 2:70781498-70781520 TTTATATTAGTATGAGCTCATGG - Intronic
932361691 2:71113711-71113733 GTTATATCAGTATGGACTTGTGG - Intronic
932444266 2:71764849-71764871 TCTATATCCGCATGGACTCAGGG - Intergenic
932642103 2:73459553-73459575 TTTATATCATTATGGACTCTTGG + Intronic
932843156 2:75103533-75103555 TTTATGTTAGTATGGACTCATGG - Intronic
933112494 2:78421299-78421321 TTTATATCAGTATAAACTCTTGG - Intergenic
933164217 2:79057257-79057279 TTTATATTAGCTTGGACTCAAGG - Intergenic
933626087 2:84601288-84601310 TTTATATCAGTATGAATTCATGG - Intronic
933671379 2:85010789-85010811 TTTATATCAGTATGGAGTCGTGG + Intronic
933878303 2:86642531-86642553 TTTATATTAGTATGTACTCAAGG + Intronic
933947979 2:87304137-87304159 CTTATATCACTATGGACTCATGG - Intergenic
934905482 2:98197619-98197641 TTTATTTCAATGTGGACTCATGG + Intronic
934965140 2:98714984-98715006 TTTACATAAGTATGAACTCATGG - Intronic
935538966 2:104326843-104326865 TTTAAATCATCCTGGACTCATGG - Intergenic
935747354 2:106200157-106200179 TTTATATCAGTATAGACTCATGG + Intergenic
935794299 2:106626382-106626404 TTTATATCAGTAGGGACTCATGG + Intergenic
935826225 2:106953051-106953073 GTTATATCATCATGGACTCATGG - Intergenic
935826592 2:106957755-106957777 TTCATATCAGTATAGACTCATGG + Intergenic
936245396 2:110821787-110821809 TTTATGTAAGTATGTACTCATGG + Intronic
936275494 2:111093047-111093069 CTTCTATCAGTTTCCACTCATGG + Intronic
936332219 2:111557457-111557479 CTTATATCACTATGGACTCGTGG + Intergenic
936388440 2:112052046-112052068 TTTATGTTAGTATAGACTCATGG + Intergenic
936490498 2:112967540-112967562 TTTATATCAGTATGGACTCGTGG + Intergenic
936768521 2:115883806-115883828 CTTATATCAGTATGAACTAATGG + Intergenic
937147245 2:119658219-119658241 TTTATATCAGCATGGAATCATGG + Intronic
937343796 2:121110074-121110096 TTTGTATCAGTGTGGACTCATGG - Intergenic
937365950 2:121261545-121261567 ACTATATCAGTATAGACTCATGG - Intronic
937504837 2:122525554-122525576 TTCAATGCAGTTTGGACTCAAGG - Intergenic
937812549 2:126215207-126215229 TTTATAGCAATATGGACTCGTGG - Intergenic
937866548 2:126755887-126755909 TTACTATCAGTAGGGACTCAAGG + Intergenic
937902272 2:127029727-127029749 TTTATATCAGAATGGACCCAGGG - Intergenic
937953199 2:127404061-127404083 TTTATATCTGTATGAACTCTTGG - Intergenic
938154881 2:128926740-128926762 TTTATGTCAGTATGAACTCATGG + Intergenic
938203386 2:129396247-129396269 TTTATATGAGCATGGACTCATGG - Intergenic
938227634 2:129629544-129629566 TTTATATCAGTGTGGACTCAAGG + Intergenic
938231346 2:129662808-129662830 TTTATATCAGTATGGATGCATGG - Intergenic
938268245 2:129945279-129945301 ATTATTTCAGTATAGACTCATGG + Intergenic
938814759 2:134889886-134889908 TTTATATCATTTTGGACTCATGG - Intronic
938840640 2:135159101-135159123 TTTATACCAGTATGAACTCAAGG - Intronic
938861848 2:135377661-135377683 TTTGTATCAGTGTGGACTCATGG - Intronic
939166604 2:138647347-138647369 TTTACATCAGCGTGTACTCACGG + Intergenic
939302885 2:140369210-140369232 ATTATGTCAGTTTTTACTCAAGG - Intronic
939316697 2:140559732-140559754 TTTATGTCAGTGTGGAATCATGG - Intronic
939463460 2:142527417-142527439 TTTACATCAGTATGGACTAATGG + Intergenic
939475072 2:142676395-142676417 TTGATAGCAGTATAGACTCATGG + Intergenic
940062604 2:149588859-149588881 TTTATGTCAGTATGGACTCATGG + Intergenic
940256892 2:151740437-151740459 TTTATATCAGTAAGGACTAATGG + Intergenic
940267242 2:151851772-151851794 GTTATATCAGTTTGGTCTTCTGG - Intronic
940294293 2:152106217-152106239 TTTTTATCACTATGAACTCATGG - Intergenic
940323743 2:152403419-152403441 TTTGTATCAGTGTGGACTCATGG + Intronic
940333098 2:152496705-152496727 TTTATATCTGTATGGATTCATGG + Intronic
940424752 2:153517608-153517630 TTTATAGTAGTAAGGACTCATGG - Intergenic
940442619 2:153736214-153736236 TTTAAATCAGCCTGCACTCATGG + Intergenic
940793969 2:158057408-158057430 TTTATATCAGCATGACCTCATGG + Intronic
941064041 2:160880651-160880673 TTTATATCAGTATGAATGCATGG + Intergenic
941342094 2:164319330-164319352 TTTATATCAGCATAAACTCATGG + Intergenic
941544221 2:166827334-166827356 TTTATGTAAGCATGGACTCATGG - Intergenic
941796964 2:169609652-169609674 TTTATATCAGTGTAGACTGCTGG - Intronic
941830664 2:169955310-169955332 TTTTTATCAGTGTGGACTCATGG + Intronic
941832773 2:169980550-169980572 TTTATATTAGTATGTACTCATGG + Intronic
941975726 2:171402992-171403014 TTTATATCAGTATGGATACATGG - Intronic
942107487 2:172647558-172647580 TTTATGTAAGTTTGGACTCATGG - Intergenic
942137180 2:172937807-172937829 TTTATATCACTATGCACTCATGG + Intronic
942228742 2:173839882-173839904 TTTATATTAGTATGGACTCTTGG + Intergenic
942282971 2:174385775-174385797 TTTCTATCAATATGGACTCATGG - Intronic
942978622 2:182050439-182050461 TTTATTTCAGTTTGGTCTTTTGG + Intronic
943221378 2:185111219-185111241 CTTATATCAGTATGGACTCATGG - Intergenic
943408896 2:187520769-187520791 TTTATATAAGTATGGACTCATGG + Intronic
943431723 2:187810904-187810926 TTTATATTAGTATGGTCTCGTGG - Intergenic
943914345 2:193609639-193609661 TTTATATTAATTTTGATTCATGG - Intergenic
943994359 2:194740235-194740257 TTTCTATCAATATAGACTCATGG - Intergenic
944008211 2:194938041-194938063 TTTATACCAGTATGAACTCCAGG - Intergenic
944068054 2:195639964-195639986 TTTTTATCAGTGTAGAGTCATGG + Intronic
944176965 2:196841220-196841242 TTTATGTAAGATTGGACTTAAGG - Exonic
944282842 2:197917967-197917989 TTTATATCAGTATGGACTCACGG - Intronic
944293535 2:198035650-198035672 TTCTTATCAGTATGGACTCATGG - Intronic
944304229 2:198160363-198160385 TTGATCTCAGTTTAAACTCAAGG + Intronic
944757922 2:202783051-202783073 TTGATATCAGTGTGGACTCCTGG - Intronic
944822691 2:203446601-203446623 TTTACATCAGTATAAACTCATGG + Exonic
944876528 2:203968034-203968056 TTTATATCTGTATGGCATCATGG + Intergenic
945104892 2:206300819-206300841 TTTATATCATTATAGACTCATGG + Intronic
945184741 2:207128288-207128310 TTTATATCAGTATGGATTCAGGG - Intronic
945400587 2:209377648-209377670 TTTTTATCAGATTCTACTCAAGG + Intergenic
945510601 2:210697686-210697708 TTTACATCAGTATGGGCTCCTGG + Intergenic
945513984 2:210739673-210739695 TTTATATCAGCATAGATTCATGG + Intergenic
945525077 2:210878237-210878259 TTTATGTCAGTATGGGCTCATGG + Intergenic
945794689 2:214347759-214347781 ATTATATCAGCTTGGACTAGAGG + Intronic
945898588 2:215513409-215513431 TTTATATGAGTATGGATTCATGG + Intergenic
946069684 2:217023024-217023046 TTTATATCAGTCTGGACTCATGG - Intergenic
946123765 2:217540723-217540745 TTTATATCAGTAGGAACTCATGG - Intronic
946942095 2:224780160-224780182 TTTGTAGCAGTTTGGGGTCAAGG - Intronic
947116416 2:226776277-226776299 TTTATATTAGTATGGACTCATGG - Intronic
947325646 2:228973308-228973330 TTTATATTAGTAAGAACTCATGG - Intronic
947332183 2:229041404-229041426 TTTATATCAATATTGATTCATGG - Intronic
947361337 2:229348519-229348541 TTTATACTAGTATGGACTCCTGG - Intergenic
947361841 2:229353427-229353449 TTTATACTAGTATGGACTAACGG - Intergenic
947921420 2:233878123-233878145 TTTATATCAGTATGGACTCATGG + Intergenic
948339336 2:237236923-237236945 TTTATATCAGCATAGACCCATGG - Intergenic
948842797 2:240663864-240663886 TTTATATCAGCATGGATTCATGG + Intergenic
1169097329 20:2914020-2914042 CTTATATCAATATGGACTTACGG + Intronic
1169238356 20:3951627-3951649 TTTCTATCAGTCTAGACTAATGG + Intronic
1169238360 20:3951709-3951731 TTTCTATCAGTCTAGACTCATGG + Intronic
1169983371 20:11412453-11412475 TTTATATCAGTGTGGACTCATGG + Intergenic
1170186907 20:13601491-13601513 TTTATATCAGTATGGACTCATGG - Intronic
1170612627 20:17927133-17927155 CTTATATCAGTGTGGACTTGTGG - Intergenic
1170638785 20:18133409-18133431 TTTCTATCAGTGTGGACTGGTGG - Intergenic
1170649400 20:18226276-18226298 CTGGTATCAGTATGGACTCATGG - Intergenic
1171024633 20:21618335-21618357 TTAGTATCAGATTGTACTCAAGG + Intergenic
1171080888 20:22182650-22182672 TTTATATGACTTTGGTATCAGGG + Intergenic
1171368336 20:24642571-24642593 TTTATGTCAGTATGGACCCTTGG + Intronic
1172496555 20:35389622-35389644 TTTATACCAGTATGAGCTCATGG - Intronic
1172582570 20:36059971-36059993 TTTATAACAGTATGGACTCATGG - Intergenic
1172756954 20:37292283-37292305 TTTGTATCGGTGTGAACTCATGG + Intronic
1173084543 20:39903381-39903403 TTTAGATAAGTTGGGACTCCAGG - Intergenic
1173264312 20:41464986-41465008 TTTATATCAGTATTGACTTGTGG - Intronic
1173492931 20:43498048-43498070 TTTATATCAATATGGACTCCTGG + Intergenic
1174397320 20:50255342-50255364 TTTATATCAGTACAGACTCACGG + Intergenic
1174480847 20:50830323-50830345 TTTCTGTCAGTTTGGCCTTAAGG - Exonic
1175047072 20:56117092-56117114 TTTATATCAGTATGGACTCATGG - Intergenic
1175047327 20:56119354-56119376 TTTATATCAGTATGGATTTATGG - Intergenic
1175418036 20:58814615-58814637 TTTATATCAGTCTGGACCTGTGG + Intergenic
1175710383 20:61215992-61216014 TTTATCTGAGTGCGGACTCATGG + Intergenic
1175733129 20:61367627-61367649 TTTACTTCAGTGTGGACTCGGGG - Intronic
1176657454 21:9600196-9600218 TTAGTACCAGTATGGACTCATGG + Intergenic
1176900330 21:14433913-14433935 ATTATATCAATATGGACTCATGG - Intergenic
1177064572 21:16413549-16413571 CTTACATCAGTATGGATTCATGG + Intergenic
1177533424 21:22394167-22394189 CTTATTTTAGTATGGACTCATGG - Intergenic
1177701286 21:24642825-24642847 TTTATGTCAGTATGGACTTAAGG + Intergenic
1177851504 21:26354413-26354435 TTTATATCAGTATAGACTCATGG - Intergenic
1178162218 21:29931573-29931595 TCTATATCAGTATGCACTCATGG + Intronic
1178234570 21:30825870-30825892 CTTATATCAGTATGGGTTCATGG - Intergenic
1178433871 21:32540223-32540245 TTTATATCAGTATGTGCTGATGG - Intergenic
1178572283 21:33749845-33749867 TAAATATCATTTTGAACTCATGG + Intronic
1179028016 21:37696027-37696049 TCTATATCAGTATGGATTCATGG - Intronic
1179078151 21:38143485-38143507 TTTATTTCTGTTTGGAATCTGGG + Intronic
1179521160 21:41946001-41946023 TTTAGCTCAATATGGACTCATGG - Intronic
1180018373 21:45102710-45102732 TTTATGTCAGTCTGGACTCATGG - Intronic
1180974497 22:19840230-19840252 TTTACCTCAGTGTGGACTCATGG - Intronic
1181661606 22:24354418-24354440 TTTATATTAGTATAGACTCATGG + Intronic
1181722724 22:24788198-24788220 TTTACATCAGCCTGCACTCATGG - Intergenic
1181744083 22:24943680-24943702 TTAATATCACTTTGGGCTTAGGG - Intronic
1182075679 22:27493893-27493915 TGTCTATCATTTGGGACTCATGG + Intergenic
1182298079 22:29321687-29321709 TTTATATCAGTTTGGACTCATGG - Intergenic
1182408071 22:30155342-30155364 TTTATATCAGTATGGACTCATGG + Intronic
1182817733 22:33181101-33181123 TTTACATCAGAATAGACTCATGG - Intronic
1182995840 22:34811434-34811456 TTCATATTACTATGGACTCATGG - Intergenic
1183325396 22:37188582-37188604 TTTAGCTCAGGGTGGACTCAGGG - Intronic
1184538622 22:45104834-45104856 TTTATATCTGTATGGATTCCTGG - Intergenic
1184896969 22:47414819-47414841 TTTATATCAGTATGGGCTCAGGG - Intergenic
949581128 3:5389497-5389519 TTTATATTGCTATGGACTCATGG + Intergenic
949603021 3:5621719-5621741 TTTACATCGGTAAGGACTCATGG + Intergenic
949759628 3:7455153-7455175 CTGATATCAGTATGGACTCATGG - Intronic
950402842 3:12783586-12783608 TTTGTATAAGTATGGACTTATGG - Intergenic
950621365 3:14208112-14208134 TTTATATAACTATGAACTCATGG - Intergenic
950883358 3:16341646-16341668 TTCATGTCAGTTTTGATTCAAGG - Intronic
951614715 3:24529591-24529613 ATTTTATCAATATGGACTCATGG + Intergenic
952163098 3:30715773-30715795 CTTATATCAGTGTGGACTCGAGG - Intergenic
952229107 3:31410923-31410945 TTTATATCAGTAGGGACTCATGG - Intergenic
952326939 3:32328993-32329015 TTTATCTCATTTTGGTATCAAGG - Intronic
952367017 3:32684074-32684096 TTTATATCAGTATGGACTCATGG - Intergenic
952681426 3:36097990-36098012 TTTATATCAGTATGGGCTCATGG - Intergenic
952686672 3:36157866-36157888 TTTACATCAGTATGGACTCATGG - Intergenic
953238063 3:41123469-41123491 TTTATATCAGTGTGGACACTTGG - Intergenic
953343613 3:42156546-42156568 TTTTTATCAGTATAGACTCACGG - Intronic
953432081 3:42848152-42848174 TTTATATTAGTATGAACTCATGG - Intronic
953462321 3:43091406-43091428 TTCATATCAATATTGACTCATGG - Intronic
953594908 3:44301881-44301903 TTTTTCTCAGTTTTGAGTCAAGG + Intronic
953600443 3:44358311-44358333 TTCATATCAGTTTGTATTCCTGG - Intronic
953720840 3:45353694-45353716 TTTCTATCAATATGGACTCATGG + Intergenic
953794232 3:45971198-45971220 TTCATAGCAGTATTGACTCATGG - Intronic
954612157 3:51950672-51950694 TTATTATCAGTGTAGACTCATGG + Intergenic
954768672 3:52945385-52945407 TTTATATCAGTGTGGACTCATGG - Intronic
955375612 3:58393892-58393914 TTTATATTAGTATGTACTCAAGG + Intronic
955913672 3:63884497-63884519 TTTATACCAGTATGGCCTCATGG - Intronic
956256489 3:67288726-67288748 TGTATACTAGTATGGACTCATGG + Intergenic
956290806 3:67657699-67657721 CTTGTATCACTGTGGACTCATGG + Intergenic
956300404 3:67765499-67765521 TTTATATCAGTAGAGACTTATGG - Intergenic
956465381 3:69515487-69515509 TTTGTATCAGTATGGACTCATGG + Intronic
956756608 3:72394294-72394316 TTTATATCAATATGAATTCATGG + Intronic
956914609 3:73858108-73858130 TGTACATCAGTTTGAACTCTAGG - Intergenic
956984815 3:74686534-74686556 TTTAAATCAATATGGACTTATGG + Intergenic
957125730 3:76157693-76157715 TTTATAACACTGTGGACTCCTGG - Intronic
957208032 3:77223274-77223296 TTTATATCAGTTAGAGCTCAAGG + Intronic
957684269 3:83480282-83480304 TTTATATCAGTGTAAATTCATGG + Intergenic
957758501 3:84523503-84523525 ATTATACCAGCTTGGACTGATGG - Intergenic
958100976 3:89009976-89009998 TTTGTCTCATTTTGGAATCATGG - Intergenic
958443897 3:94191566-94191588 TTTATATCACTATGGACTATGGG + Intergenic
958997514 3:100922134-100922156 TGTATAGCACTTTGTACTCAAGG + Intronic
959078364 3:101775305-101775327 TTTACATCAGGGTGCACTCATGG - Intergenic
959599199 3:108160088-108160110 TTTATATCTGTGTGGACTTGTGG + Intergenic
960095624 3:113687086-113687108 CTTATATCAGTATGGACTCATGG + Intronic
960126827 3:114008012-114008034 TTTATATATATTTAGACTCAAGG - Intronic
960605745 3:119503032-119503054 TTTCTATCAGTAGGGACTCATGG + Intronic
960821325 3:121736103-121736125 TTTATATCAGTATTGACTGATGG - Intronic
961495920 3:127291207-127291229 TTTATATCAGTATGGACTCATGG + Intergenic
961981722 3:131086445-131086467 TTTATATTAGTATGAACTCATGG + Intronic
962213101 3:133495801-133495823 TTTATATCAGCATGAACACATGG + Intergenic
962604441 3:137021553-137021575 TATGTATCATCTTGGACTCATGG - Intergenic
962647346 3:137453577-137453599 TTTATATCAATATGGACTCGTGG + Intergenic
962657412 3:137562113-137562135 TTTGTATCAGTATGGATTCATGG - Intergenic
962863869 3:139430399-139430421 TTTATATCAGTAAGGAATCGTGG + Intergenic
963153594 3:142072775-142072797 TTTAGATTAGTATGGACTCATGG - Intronic
963314167 3:143741416-143741438 TTTATATCAGTGTGGACTTGTGG - Intronic
963413595 3:144964001-144964023 TTTTAATGAGTTTGGCCTCAAGG + Intergenic
963451471 3:145486816-145486838 TTTATATCGGTATGAACTCATGG + Intergenic
964238449 3:154562551-154562573 TATTTATCGGTATGGACTCATGG + Intergenic
964366600 3:155957196-155957218 TTTAGACCAGTATGTACTCATGG + Intergenic
965029675 3:163349534-163349556 TTTATTTTAGTATGGACTCATGG - Intergenic
965073634 3:163948444-163948466 TTTATATAACTGTGGACTCATGG - Intergenic
965459505 3:168944601-168944623 CTTATATCAGTATAGACTCATGG - Intergenic
965666372 3:171097947-171097969 TTTATATCAGTATAGATTCATGG - Intronic
965947249 3:174258285-174258307 TTTATACCATTATGGACTCGTGG - Intronic
966511087 3:180764266-180764288 TTTATATCAGGATAGACTCATGG - Intronic
966677603 3:182606112-182606134 TTTATATCAGTATTGACTCACGG - Intergenic
967401928 3:189072812-189072834 TTTTTATTAGTAGGGACTCATGG + Intronic
967432029 3:189396998-189397020 TTTATATCTGTTTGTATTCTTGG - Intergenic
967456704 3:189695187-189695209 TTTATATCATTATAAACTCATGG + Intronic
967526072 3:190494340-190494362 TTTTTATCAGTATAAACTCATGG + Intergenic
967657538 3:192069700-192069722 TTTGTATCAATGTGGAATCATGG - Intergenic
967690568 3:192468952-192468974 TTTATACCAGTATAGATTCACGG + Intronic
967694951 3:192519785-192519807 TTTATATCAGTATGGCCTCAAGG + Intronic
968146376 3:196302552-196302574 TTTATTTCAACATGGACTCATGG - Intronic
969195439 4:5559764-5559786 TTTCTATCGGTATAGACTCATGG - Intronic
970137919 4:12946086-12946108 TTTATATCGGTATGGCCTCATGG - Intergenic
970512656 4:16796470-16796492 TGTATATCAGCATGGATTCATGG - Intronic
970636584 4:18017182-18017204 TTTTTATCTGTATGAACTCATGG - Intronic
970641536 4:18071646-18071668 TGTATATCAGTGTGGACTCGTGG - Intergenic
971095917 4:23403103-23403125 TTTATTTTAGTTTAGATTCAGGG + Intergenic
971164462 4:24168787-24168809 TTTATATCAGTATGGACTCATGG - Intergenic
971436115 4:26626107-26626129 TTTACATCAGTATGGACTCATGG + Intronic
971450715 4:26799015-26799037 TTTATTTCATTTTAGATTCAGGG - Intergenic
971542775 4:27841898-27841920 TTTATAACAGTTTCGACATAGGG + Intergenic
971613073 4:28751325-28751347 TTGATGTCCGTTTGGACTGAGGG - Intergenic
971682957 4:29725062-29725084 TTTAAATGATTTTGTACTCAGGG - Intergenic
971790910 4:31168685-31168707 TTCATATCAGTATGGGTTCATGG + Intergenic
972084231 4:35193646-35193668 TTCATATCCATTTGGACTCATGG + Intergenic
972475376 4:39445071-39445093 TTTGTTTTAGTTTGGACTCAAGG + Intronic
972540600 4:40035863-40035885 TTTATGTCAGCATGGACTCCTGG - Intergenic
972851442 4:43056082-43056104 TTTATATTAGTATGGATTCATGG + Intergenic
973130513 4:46642442-46642464 TTTATATCAATGTAGACTCATGG + Intergenic
973565367 4:52181015-52181037 TTTATATGATTATGGACTCATGG - Intergenic
973622360 4:52740311-52740333 TTTTTATCAGTGTGGACTCATGG - Intronic
974351972 4:60760112-60760134 TTTATATCAGTATGTACTCATGG - Intergenic
974774735 4:66464853-66464875 TATATTTCAGTTTTGACTGATGG + Intergenic
974890244 4:67872999-67873021 TTTAAACCTGGTTGGACTCATGG + Intronic
975233155 4:71958376-71958398 TTTATGTCAGTATGGACTCATGG + Intergenic
975283201 4:72586952-72586974 TTTATATCGGTTTGTACTCATGG + Intergenic
975420138 4:74154483-74154505 TTTATATGATTATGGGCTCATGG + Intronic
975464166 4:74690603-74690625 TTTCTATCTGTATGGACTCACGG + Intergenic
975687472 4:76931861-76931883 CTTATATCAGTATAGACTCATGG - Intergenic
975896057 4:79092360-79092382 TTTATATCAATATGAACTCAAGG + Intergenic
975974992 4:80084816-80084838 TTTACATCTGTATGGATTCATGG - Intronic
976358044 4:84143791-84143813 TTTCTATCAGTATGGACCCATGG - Intergenic
976476783 4:85493463-85493485 TGTATATCAGTATGGACTCGTGG + Intronic
976664587 4:87577106-87577128 TTTATATCAGTATAGACTCATGG + Intergenic
976719562 4:88156537-88156559 TTTGTATCAGTATGGGCTCATGG - Intronic
976847359 4:89505064-89505086 TTTACATCAGTATGGACTCATGG + Intergenic
977018326 4:91724065-91724087 TTTACATCAACTTGTACTCATGG - Intergenic
977700774 4:100020413-100020435 TTTATATTAGTGTGGATTCATGG + Intergenic
977763352 4:100767042-100767064 TTTATATTAGTGTTCACTCATGG - Intronic
977859627 4:101941053-101941075 TTTATATCTGTATGAACTCATGG + Intronic
977878332 4:102175570-102175592 TTTATCTCATTTTGAACTCTAGG - Intergenic
978058656 4:104308176-104308198 TTTGTATAAGTATGAACTCAAGG - Intergenic
978270029 4:106877766-106877788 TTTACATTAGTATTGACTCATGG + Intergenic
978288891 4:107113464-107113486 TTTATATCAGTTTGGACTCATGG - Intronic
978614840 4:110584254-110584276 TTTATATCACTATGGACTCATGG - Intergenic
978716574 4:111850625-111850647 TAAAAATCAGTATGGACTCATGG - Intergenic
979304578 4:119127602-119127624 TATATATTCTTTTGGACTCAAGG + Intergenic
979423688 4:120538171-120538193 TTTATATCAGTATGGACTCATGG + Intergenic
979503806 4:121470314-121470336 TTAATATCAGTATGGATTCATGG + Intergenic
979911060 4:126366143-126366165 TTTAAAAAAGTTTTGACTCAGGG - Intergenic
980038870 4:127916021-127916043 TTAATATCATTTTGAATTCATGG + Intergenic
980441908 4:132859373-132859395 TTTATATCAGTATGAATGCATGG + Intergenic
980453430 4:133007116-133007138 TTTATATCAGTATGCACTCATGG + Intergenic
980650366 4:135706202-135706224 TTTATATCAGTATAGACTCATGG - Intergenic
980709264 4:136542709-136542731 TTTGTATTAGTATGGACTCATGG - Intergenic
980759681 4:137214317-137214339 TTGATATCAGGATGGAGTCATGG - Intergenic
980849746 4:138366383-138366405 TTTAGATCAGTATGGGCTCATGG + Intergenic
980851711 4:138390207-138390229 TTTTTGTCAGTTTGGTCTCAAGG + Intergenic
981016796 4:139982172-139982194 TTTATACCAGTATAGATTCATGG + Intronic
981268367 4:142814736-142814758 TTTATATCACTATGGACTCATGG - Intronic
981492868 4:145359179-145359201 TTTGGATCACTATGGACTCATGG - Intergenic
981567865 4:146119622-146119644 TTTGTATCAGTATGGAATCTTGG - Intergenic
981678994 4:147372628-147372650 TTTATGTCAGCATGAACTCATGG + Intergenic
982154822 4:152508260-152508282 TGTATATCAGAATGGACTCGCGG - Intronic
982177200 4:152717082-152717104 TTTATATCACTATTGACTCATGG + Intronic
982284168 4:153717112-153717134 TTGATATCAATGTGGACTCATGG + Intronic
982458461 4:155637807-155637829 TTTATATTAGTATAGACTCATGG + Intergenic
982599455 4:157428054-157428076 TTTATATCAGTATTAATTCATGG + Intergenic
982746829 4:159112573-159112595 CTTATATCAGTATGGGCTCATGG - Intronic
982816328 4:159889875-159889897 TTTAGATCAGTCTAAACTCATGG + Intergenic
982879521 4:160693867-160693889 TTGTTATTAGTATGGACTCATGG + Intergenic
983454725 4:167948851-167948873 TCTATATCAGTGTAGACCCAAGG - Intergenic
983727943 4:170953449-170953471 TATGTATCAGTATGTACTCATGG + Intergenic
984241154 4:177220732-177220754 TTTATATCAATATGGACTCATGG - Intergenic
984992156 4:185391529-185391551 TTTATATCAGTATAGACTCATGG + Intronic
985084738 4:186300683-186300705 TTTGTATCAGTATGAACTCATGG - Intergenic
985211435 4:187599626-187599648 TTTATATCAGTGTAGACTCGTGG - Intergenic
985417954 4:189755881-189755903 TTAGTAACAGTATGGACTCATGG - Intergenic
986276266 5:6277649-6277671 TTTATATCAGTGTTCACTCGTGG - Intergenic
986277883 5:6296297-6296319 TTTATATCAGTGTGGACTCATGG - Intergenic
986377322 5:7145479-7145501 TTTTTATCATTATGGACTTATGG - Intergenic
986515292 5:8555815-8555837 TTTATATCAATATGGAATCATGG - Intergenic
986745616 5:10742191-10742213 TTTATGTCAGTATGGACTCATGG + Intronic
986850416 5:11805669-11805691 TTTATATTAGTATAGACACATGG - Intronic
986930247 5:12809937-12809959 TATACAACAGTTTGGACTCCAGG - Intergenic
986938857 5:12925066-12925088 TTTAAATCAGCTTGAACTAAAGG - Intergenic
986988071 5:13521586-13521608 TTTATGTCAGTATGGACTTACGG + Intergenic
987050057 5:14141843-14141865 TTTTCATCACTATGGACTCATGG + Intergenic
987394480 5:17409370-17409392 TTTATATCAGTATGGACTCATGG + Intergenic
987848038 5:23313653-23313675 TTTATATCAGTATGCACCGAAGG - Intergenic
987971567 5:24952902-24952924 TTTACATCAGTATGAACTCTTGG - Intergenic
988386545 5:30573416-30573438 TTTATATCAGTATGGACTTATGG - Intergenic
988474802 5:31574629-31574651 TTTGTATCAGTGTGGACTCATGG - Intergenic
988875563 5:35442128-35442150 TTTAAGTAAGTGTGGACTCATGG - Intergenic
989381279 5:40811739-40811761 TTTATAGCAGTGTGGACTCATGG + Intergenic
989516719 5:42352714-42352736 TTTATGTCAGCATGGATTCATGG - Intergenic
989553476 5:42763291-42763313 TTTATATCAGTAAGGATTTATGG - Intronic
989783471 5:45298615-45298637 TTTGTATCAGTATGGACACTTGG - Intronic
989798921 5:45511222-45511244 TTTATATTATAATGGACTCATGG - Intronic
989810920 5:45673472-45673494 TTTATATCAGTATGATCTCATGG + Intronic
990114602 5:52372715-52372737 TTTATATCAATATGTACTCATGG - Intergenic
990547482 5:56837342-56837364 TATATATGAGTCTAGACTCATGG + Intronic
990662967 5:58039128-58039150 TTTATATGAGTATGAACTCATGG - Intergenic
990705564 5:58525346-58525368 TTTATGTTAGTATGGACTCATGG - Intergenic
990731043 5:58809808-58809830 TTTCTCTCAGTTTGGAGTCTGGG - Intronic
990798204 5:59568315-59568337 TGTATATCAGTATGGACTCATGG - Intronic
990938367 5:61174512-61174534 TTTATAACAGAATGGACTCATGG + Intergenic
991010728 5:61880486-61880508 CTTATATCAGTATGAACTCATGG + Intergenic
991111738 5:62907896-62907918 TGTATAGCAATATGGACTCATGG + Intergenic
991435171 5:66590702-66590724 TTTATATGAGTGTGGACTCATGG + Intergenic
992166984 5:74063089-74063111 TTAATATCAGCATGGCCTCATGG + Intergenic
992167803 5:74072181-74072203 TTTATATCAGTATGGACTCGTGG - Intergenic
992235274 5:74702887-74702909 TTTTTATCAGTGTGGACTCATGG + Intronic
992559898 5:77941069-77941091 TTTACATCAGTGTGAACTCATGG - Intergenic
992893012 5:81221371-81221393 TTTATATCAGTATGGACTAATGG + Intronic
993259016 5:85634515-85634537 TTGATACAAGTATGGACTCATGG + Intergenic
993382683 5:87225626-87225648 TTTTTATCAGTGTGAACTCAGGG - Intergenic
993460421 5:88175107-88175129 TTTCCATCAGTATGGACTCATGG + Intergenic
993542979 5:89175423-89175445 TTTATATCAGTATGGATTCACGG - Intergenic
993591069 5:89795604-89795626 TTTACATCAGTATGGGCTCATGG - Intergenic
993940706 5:94054806-94054828 TTTATATCAGTATGGACTTGTGG + Intronic
994040801 5:95257959-95257981 TTTATATCAGTGTGGACTAATGG - Intronic
994296404 5:98094074-98094096 TATATAACAGAGTGGACTCAAGG - Intergenic
994531613 5:100980012-100980034 TTTTTTTCTTTTTGGACTCAGGG + Intergenic
994784534 5:104140131-104140153 TTTATATCATTTGGGAATGAGGG - Intergenic
994942099 5:106337370-106337392 TTCATTTCACTTTGAACTCAGGG - Intergenic
995068212 5:107886713-107886735 TTTGTATCAGTATGGACTTGTGG - Intronic
995231192 5:109765722-109765744 TTTATATCAGTATGGGCTCATGG + Intronic
995380564 5:111528085-111528107 TTTATTTCTTTTTTGACTCATGG - Intergenic
995455742 5:112349914-112349936 TTTATAGCAGTTTGTTCACATGG - Intronic
995795542 5:115937346-115937368 TTTGTGTCAGTATGGACACAAGG - Intergenic
995807687 5:116071873-116071895 TTTAGATCAGTATGGACTTGTGG + Intergenic
996211091 5:120811645-120811667 TTTATTTCATTTTAGATTCAGGG + Intergenic
996295470 5:121909775-121909797 TTTATGTCAGTATGGACTCAAGG - Intergenic
996598271 5:125230149-125230171 TTTATATCAATATAAACTCATGG + Intergenic
996758269 5:126958944-126958966 TTTAAAGCAGTGTGGACTAATGG - Intronic
997458492 5:134035601-134035623 TTTCCATCAGTATGGACTTATGG - Intergenic
997637365 5:135423547-135423569 TTTGTATCAGTATGGCTTCATGG + Intergenic
997946076 5:138202692-138202714 TTAGTATCAGTATGAACTCATGG - Intronic
998054032 5:139058566-139058588 TTTGTATGAGTATGAACTCATGG + Intronic
998249306 5:140540302-140540324 TTTATATGAGTTGGGACATAAGG + Intronic
998446341 5:142201408-142201430 TTTATATTAGTGTGGAGTCATGG - Intergenic
998823486 5:146077986-146078008 TTTATGTCAGTATAGGCTCAGGG - Intronic
999167993 5:149567589-149567611 TTTATATCAGTATGAACTTATGG + Intronic
999344910 5:150809137-150809159 TTTATTTCAGTGTGGACTCATGG + Intergenic
999633430 5:153595597-153595619 TTTATATCAATATGGATTCAAGG + Intronic
999945054 5:156586587-156586609 TTTATATTTGTATAGACTCATGG + Intronic
1000689947 5:164305348-164305370 TTTATATCAGTATGGAATCACGG - Intergenic
1000939492 5:167343022-167343044 TTTATGTCAGTATGGACTCCTGG + Intronic
1000995386 5:167953238-167953260 CTTCTGTCAGTTTGGAATCAGGG - Intronic
1001151813 5:169236128-169236150 TTTCTGTGAGTATGGACTCATGG + Intronic
1001188081 5:169596991-169597013 TTTATATCAGTATAGCCTCATGG + Intronic
1001360010 5:171073909-171073931 TTTATATCAGTATGGATTGAAGG - Intronic
1002275035 5:178098725-178098747 CTTATATCAGTGTGGACTCATGG - Intergenic
1002348832 5:178567810-178567832 TTTATATCACTGTAGACTCAAGG - Intronic
1002554378 5:180023690-180023712 TTTATATCATTATGGACCCATGG - Intronic
1002782097 6:374818-374840 TTTACATCAATCTGGACTTAGGG - Intergenic
1003289620 6:4768560-4768582 TTTATATCAATTGAGACTCATGG - Intronic
1003313001 6:4985734-4985756 TTTCTATCAGTATGGACTCAAGG - Intergenic
1003519397 6:6845020-6845042 ATTATATCAGTATAGACTCATGG + Intergenic
1003913168 6:10760968-10760990 TTCATCTTAGTATGGACTCATGG + Intronic
1004439720 6:15638042-15638064 TTTACATCACCATGGACTCAGGG - Intronic
1004451177 6:15748156-15748178 TGTATATCAGTGCGAACTCATGG - Intergenic
1004539410 6:16535551-16535573 TTTATATCAATATGAACTCATGG - Intronic
1004940378 6:20550289-20550311 TTTCTATCAGTACAGACTCATGG + Intronic
1004950796 6:20669376-20669398 TTTATATCAGTGTAGCCTCATGG + Intronic
1004960091 6:20778481-20778503 TTTATATTAGTTGGGACCAATGG + Intronic
1005002052 6:21251536-21251558 TTTATATCTGTATGGACTTATGG + Intergenic
1005097597 6:22134670-22134692 TTTATATCAGTATGGACTCATGG - Intergenic
1005175854 6:23043829-23043851 TTTATATTACTATGGATTCATGG - Intergenic
1005176871 6:23056897-23056919 TTTGTATCAGTATGGACTCATGG - Intergenic
1005211095 6:23464642-23464664 CTTATATCAGTATTGACTCATGG - Intergenic
1005654590 6:27921726-27921748 TTTAAAGCAGTATGGACTAATGG + Intergenic
1005900324 6:30211808-30211830 TTAATTTCAGTGTAGACTCAGGG - Intronic
1006726387 6:36201961-36201983 TTTATTTCACTTTGAACTAAAGG - Intronic
1006739942 6:36300919-36300941 TTTATATCAGTATGGATTCATGG + Intronic
1006864110 6:37194604-37194626 TTTATATCAGTATGGACTCATGG + Intergenic
1006967142 6:37999263-37999285 TATATATCAGTATGGACTCATGG - Intronic
1006976292 6:38105418-38105440 TTTTAATGAGTTTGGACACATGG + Intronic
1007101909 6:39254514-39254536 TTTATATCAGGATGGACTCATGG + Intergenic
1007132802 6:39492351-39492373 ATTGTATCAGTTTGGGCTAAAGG + Intronic
1007372489 6:41435430-41435452 TTTATATCAGCAGGGACTCGGGG + Intergenic
1007642188 6:43350419-43350441 TTTATATGAGTATGAATTCATGG - Intronic
1007832486 6:44649142-44649164 TTTATATCAGTACGGACTCGTGG - Intergenic
1008160744 6:48072274-48072296 TTTATATTGGCATGGACTCATGG + Intergenic
1008396298 6:51011646-51011668 TTTATATCTGTATAAACTCATGG + Intergenic
1009350294 6:62667293-62667315 TTTATATTAGTATGGCTTCATGG - Intergenic
1009738449 6:67710376-67710398 TTTGTGTCATTTTGGAATCAAGG + Intergenic
1010925769 6:81744050-81744072 TTTATATCAGTGTGAATGCATGG + Intronic
1011023497 6:82840448-82840470 TTTATATCAGTATGGACTCATGG - Intergenic
1011068280 6:83353595-83353617 TTTTGATCAATTTGAACTCATGG + Intronic
1011364477 6:86566582-86566604 CTTATATCAGTACGGACTCATGG - Intergenic
1011403505 6:86990604-86990626 TTTATATAAGTATGAACTCATGG - Intronic
1011422644 6:87189951-87189973 TTTATGTCAGTATAGACTCATGG + Intronic
1011835403 6:91424763-91424785 TTTATATCAGTATGGAATGATGG + Intergenic
1011963326 6:93119995-93120017 CTTATATCAGTATGGACTCATGG + Intergenic
1012161124 6:95887293-95887315 TTTATATCAGTCTGTAATCATGG + Intergenic
1012179682 6:96137332-96137354 TTTATATAACTATGCACTCATGG - Intronic
1012469440 6:99554502-99554524 TTTATATCAGTATGGACTCATGG + Intronic
1012528319 6:100203935-100203957 TAAGTATCAGTGTGGACTCATGG - Intergenic
1012854054 6:104480276-104480298 CTTACATCAGTTTGGACTCGTGG + Intergenic
1013144908 6:107379174-107379196 TTTATATCAGCATGGACTCATGG + Intronic
1013751549 6:113412915-113412937 TTTAAATCAGTCTAAACTCATGG + Intergenic
1013760873 6:113515904-113515926 TTTATGTCAGTATGGACATACGG + Intergenic
1014102860 6:117530754-117530776 TTATCATCAGTTTGGACTCCTGG - Intronic
1014689862 6:124550199-124550221 TTTATATCAGTAAGAACTCCAGG + Intronic
1014919623 6:127198227-127198249 TTTATATAAGTTTAGCATCAAGG - Intergenic
1014930019 6:127324826-127324848 TTTATATCAATATGCACTCATGG - Intronic
1014950672 6:127551200-127551222 TTTATATCTGTGTGGAATCATGG - Intronic
1015606282 6:134957843-134957865 TTCATATTGGTATGGACTCATGG + Intergenic
1015752668 6:136576119-136576141 TTTATATTAATATGGACTCACGG + Intronic
1015798847 6:137040677-137040699 AGTATATCAGTATGGACTCATGG - Intronic
1015849863 6:137560491-137560513 TTTGTAACAGTTTGAACCCATGG - Intergenic
1016065317 6:139676630-139676652 TTTATATCAGTATGGATTCATGG - Intergenic
1016207959 6:141492646-141492668 GTAATGTCAGTTTGGACTCATGG + Intergenic
1016390649 6:143571353-143571375 TTTGTATTAGTGTGGTCTCATGG + Intronic
1016447519 6:144149302-144149324 TTTATATCAGTGTAGACTCATGG + Intergenic
1016455598 6:144227297-144227319 TTTATATCAATATTGGCTCATGG + Intergenic
1016697320 6:147012555-147012577 TTTATATCAGTATGGACGCAGGG - Intergenic
1016919337 6:149275444-149275466 TATACATCAGTATGGTCTCAAGG - Intronic
1016966203 6:149720589-149720611 GTTATGTCAGTATGGCCTCATGG + Intergenic
1017203854 6:151784295-151784317 TTTATATCAGTATAGCTTCATGG + Intronic
1017615872 6:156245749-156245771 TTTATATCAGTATGTGCTCATGG - Intergenic
1017909246 6:158778845-158778867 GTTATATTAATATGGACTCATGG - Intronic
1018549908 6:164983818-164983840 TTTTTATCAGTATGAAATCATGG + Intergenic
1018648418 6:165969834-165969856 TTTACATGAGTATGGACTTATGG - Intronic
1020756016 7:12203750-12203772 TTCATATCAGTAAGAACTCATGG + Intergenic
1020770198 7:12381299-12381321 TTTATATCATTTTGAACTCTGGG + Intronic
1021113686 7:16724652-16724674 TTTATATCAATTTGGTCTGATGG + Intergenic
1021166402 7:17347936-17347958 TTTATATTAGTATGGATTCATGG - Intergenic
1021261865 7:18468325-18468347 CTTAGATCAGTGTGGACACATGG + Intronic
1021563994 7:21998886-21998908 GTTACATCACTGTGGACTCATGG - Intergenic
1021596611 7:22323795-22323817 CTTGTATCAGTATGGACTCATGG - Intronic
1021772036 7:24013926-24013948 TTTTTATGACTTTGGTCTCAAGG - Intergenic
1021887819 7:25157208-25157230 TTTCTCTCAGTATAGACTCATGG - Intronic
1022452075 7:30524869-30524891 TTTATATCAATGTGTCCTCATGG + Intronic
1022490970 7:30817421-30817443 TTTATATCAACTTGCCCTCAGGG + Intronic
1022512305 7:30946784-30946806 TTCATATAAGTTTGGATTCATGG + Intronic
1022600614 7:31755728-31755750 TTTATATCAGTGTGGACTCATGG - Intronic
1023056572 7:36295413-36295435 CTTAGATCAGTACGGACTCATGG - Intronic
1023663764 7:42497780-42497802 ATCATATCAGTATAGACTCATGG + Intergenic
1023896704 7:44439731-44439753 CTTATATCAGTATGGACTCATGG - Intronic
1024025447 7:45406364-45406386 TTCACATCAGTGTGGACTCAAGG - Intergenic
1024175386 7:46835212-46835234 TTTATATTAGTATGAACTCATGG - Intergenic
1024175780 7:46839598-46839620 TTTGTATCATTATGGATTCATGG - Intergenic
1024781072 7:52848647-52848669 TTTATATCAATATGGACTTGTGG + Intergenic
1025140357 7:56458161-56458183 TTTCTATCAATATGGACTCATGG + Intergenic
1025770828 7:64504510-64504532 TTTATAGTAATTTGGATTCATGG - Intergenic
1026080513 7:67214976-67214998 TTTATCTCATTTTGGTATCAGGG + Intronic
1026453540 7:70551143-70551165 TTTCTATCAGTATGGAGTCATGG - Intronic
1026598159 7:71751834-71751856 TTTATTTTATTTTAGACTCAGGG + Intergenic
1026696574 7:72599053-72599075 TTTATCTCATTTTGGTATCAGGG - Intronic
1028006380 7:85574567-85574589 TTTCTCTCAGTTTGGGCTCCTGG + Intergenic
1028254021 7:88569800-88569822 GTTATATCAGTATGGACTAATGG + Intergenic
1028348821 7:89818198-89818220 TTTATATCAGTATAGATTCATGG + Intergenic
1028400189 7:90417179-90417201 TTTATATCAGCATGGACATATGG - Intronic
1028604524 7:92641344-92641366 TTTATATCAGCATGGACTCATGG + Intronic
1028783596 7:94766467-94766489 CTTATATCTGTCTGGTCTCATGG + Intergenic
1028804948 7:95014835-95014857 TTTATATTAGCATGAACTCATGG + Intronic
1029802613 7:102965096-102965118 TTTATGAGAGTTGGGACTCAGGG + Intronic
1029920770 7:104260475-104260497 TTTATATCACTATGGATTCATGG + Intergenic
1030154024 7:106434557-106434579 TTTATATCAGTATGGATTCAGGG - Intergenic
1030310163 7:108060735-108060757 TTTATATCAGCATGGACTCATGG - Intronic
1030339699 7:108363153-108363175 TTTATATCAGTTTGTACTCATGG - Intronic
1031053888 7:116973017-116973039 TTTATAGCAGTATGGATTCATGG + Intronic
1031128319 7:117801073-117801095 ATTACATCAGTGTGGAGTCATGG - Intronic
1031221116 7:118966673-118966695 TTTATGTTAGTATGGACTCATGG + Intergenic
1031279494 7:119779360-119779382 TTTATATCAGTATAAACTGATGG - Intergenic
1031307744 7:120154105-120154127 TCTAAATCAGTATAGACTCATGG - Intergenic
1031308045 7:120158751-120158773 TTTACATCGGTATGGACTCATGG + Intergenic
1031378274 7:121053800-121053822 TTTATGTCAGTATGGACTAATGG + Intronic
1031453120 7:121946573-121946595 TTTATATTAATTTGAACTCAAGG - Intronic
1031479795 7:122265011-122265033 TTTATATCACTATAGACTCATGG - Intergenic
1031938268 7:127759308-127759330 TTTTTATCAATATGGACTCTTGG + Intronic
1032172255 7:129594753-129594775 TTTATATCACTATGAACTCATGG + Intergenic
1032372629 7:131374019-131374041 TTTGTATCAATATAGACTCATGG + Intronic
1032730297 7:134635137-134635159 TTTATATCAGTATGAATTCATGG - Intergenic
1033103311 7:138496171-138496193 TTTAGATCAGTTTGGAGACATGG + Intronic
1033162172 7:139007242-139007264 TAAATATCAGTGTGGACTCATGG - Intergenic
1033835137 7:145301228-145301250 TTTATATCAGTGTGAACTCATGG + Intergenic
1034212859 7:149380520-149380542 TTTTTTTCATTTTGGACTTAAGG + Intergenic
1034518926 7:151603912-151603934 TTCATATCAGTGTAGACTCATGG + Intronic
1034583499 7:152067430-152067452 TTTCTCTCAGTTTGGATTTAGGG + Intronic
1034736813 7:153436804-153436826 TTTCTATCAGTATGGACTCATGG + Intergenic
1034868906 7:154665337-154665359 TTTATATCAGTAAAGACTCATGG + Intronic
1035061182 7:156070744-156070766 TTTTTCTCAGGTTGAACTCAAGG - Intergenic
1035769379 8:2134657-2134679 GCTGTATCCGTTTGGACTCAGGG + Intronic
1036067444 8:5398036-5398058 ATTATATCCATATGGACTCATGG - Intergenic
1036093606 8:5697552-5697574 TTTATACCTGTATGGACTCTTGG + Intergenic
1036457096 8:8919257-8919279 TTTATATCAACGTGGACCCAAGG + Intergenic
1036464643 8:8985182-8985204 TATATGTCAGTATGGACTCATGG - Intergenic
1036488507 8:9201752-9201774 TTTATGTCAATATGGGCTCATGG + Intergenic
1037076245 8:14722831-14722853 TTTATATAAGTATGTACACAGGG + Intronic
1037098762 8:15017478-15017500 CTAATATCAGTTTGGACCTATGG - Intronic
1037307972 8:17525676-17525698 TGTGTATGAGTTTGCACTCAGGG + Intronic
1038109277 8:24477423-24477445 TTTATATCAGTATGGACTCATGG + Intronic
1038682327 8:29680275-29680297 TTCATATCTTTCTGGACTCATGG - Intergenic
1038699713 8:29838341-29838363 TTTTTATCAGTATGAACTTATGG - Intergenic
1039006347 8:33041956-33041978 TTTATATCCGTATGGACTCATGG + Intergenic
1039116191 8:34093814-34093836 TTTATATTACTATGGACTCATGG + Intergenic
1039331288 8:36539893-36539915 TTCATATTATTATGGACTCATGG - Intergenic
1039371589 8:36989384-36989406 TTTATATCAGTACGAACTCATGG + Intergenic
1039714576 8:40093630-40093652 TTTATGTAAGTGTGGATTCAAGG + Intergenic
1039853246 8:41390330-41390352 TTTATATCAGTATGGGCTCATGG - Intergenic
1039899910 8:41744193-41744215 TGTAGAGCTGTTTGGACTCATGG - Intronic
1040086871 8:43352295-43352317 TTTATATTAGTGTGCACTCTTGG + Intergenic
1040573587 8:48630764-48630786 GTTATATGAGTATGGACTAATGG + Intergenic
1040644221 8:49379480-49379502 TTTAAATCAGTTTGGATTCCTGG - Intergenic
1040691398 8:49943042-49943064 ATTGTATCAGTATGAACTCATGG + Intronic
1040765673 8:50907665-50907687 TTTATATCAGATAGGACTAATGG - Intergenic
1040924532 8:52664658-52664680 TTTACTTCAGTTTGGATTCAGGG + Intronic
1040998689 8:53427702-53427724 TTTATATTAGTATGGACTCATGG - Intergenic
1041398032 8:57411829-57411851 TTTTTATCACTATGGGCTCATGG + Intergenic
1041440734 8:57893687-57893709 TATTTATCAATATGGACTCATGG + Intergenic
1041974452 8:63781177-63781199 TTTACATCAGTGTGAACTCATGG - Intergenic
1042414086 8:68499456-68499478 TGTATATCAGTATGGACATACGG - Intronic
1042441796 8:68836678-68836700 CTTGTATTAGTATGGACTCATGG - Intergenic
1042633022 8:70842145-70842167 TTTAGATCAGTGTAGACTCATGG + Intergenic
1042728079 8:71900879-71900901 ATTATGTCAGTATGAACTCATGG - Intronic
1042949999 8:74191390-74191412 TTTATATTAGTATGGGCTCTTGG + Intergenic
1043001841 8:74769110-74769132 TTTATATCAGTATGAATTCATGG + Intronic
1043015130 8:74929978-74930000 TTTATATGAGAATGAACTCAGGG + Intergenic
1043017748 8:74961759-74961781 TTTATATGAGTATGGACTTGGGG + Intergenic
1043102878 8:76068607-76068629 AATATATCAGTTTGGCCTCATGG + Intergenic
1043122095 8:76339070-76339092 TTTATATCAGCATGGACTCATGG - Intergenic
1043283875 8:78504569-78504591 TTTATATCAGTGTATACTTATGG - Intergenic
1043556962 8:81441616-81441638 ATTATATCAGTATGGATTCATGG + Exonic
1043710724 8:83414747-83414769 TTTATATCTGTATGGACTCATGG + Intergenic
1043724175 8:83588771-83588793 TTTATATCAGTATAGATTCATGG - Intergenic
1043801107 8:84610716-84610738 TTTATATCAGTATGGAATGATGG + Intronic
1044106701 8:88216950-88216972 TTTATATATATGTGGACTCATGG + Intronic
1044362837 8:91308721-91308743 TTTATATTAGTATGGACTCTAGG + Intronic
1044389010 8:91626765-91626787 TTTATTTCAGTTCAGACACATGG - Intergenic
1044693238 8:94898793-94898815 TTCCTATCAGTATGCACTCATGG + Intronic
1044740866 8:95324908-95324930 TTTATATGAGTGTGCACTCCTGG + Intergenic
1044792876 8:95865711-95865733 TTTATATCAGTTTTGACTCTTGG - Intergenic
1044793103 8:95867926-95867948 TTTATATCAGTATGGACTCATGG + Intergenic
1044957321 8:97494527-97494549 TTTATATCAGTGTAGACTCATGG - Intergenic
1045020532 8:98039800-98039822 TTTATATCACTTTGGCCACACGG + Intronic
1045594663 8:103638483-103638505 TCTATATCAGTATGGATTAATGG + Intronic
1045747350 8:105439261-105439283 TTTTTAACAGTGTGGCCTCATGG + Intronic
1045777435 8:105822240-105822262 TTTTTATCAGTATGGACTCATGG + Intergenic
1045825760 8:106396053-106396075 TTTATATAAGTAGGAACTCATGG - Intronic
1045885205 8:107087691-107087713 TTGATATCAGTATGGATTAATGG + Intergenic
1045966020 8:108025473-108025495 TTTATAGCAGTATAGATTCATGG - Intronic
1046372877 8:113334202-113334224 TTTATATTATTTTAGATTCAGGG + Intronic
1046373443 8:113343353-113343375 TTTATATCAGATTGGAGACTAGG + Intronic
1046756003 8:117973594-117973616 TTTAAATTATTTTGGAGTCAGGG - Intronic
1046837088 8:118814026-118814048 TTTATATCATTATGGACTTACGG - Intergenic
1047103049 8:121701620-121701642 TTTATATTAGTATGGACTCATGG + Intergenic
1047243477 8:123116847-123116869 TTTATGTCAGGATGAACTCATGG - Intronic
1047329283 8:123871592-123871614 TATATATCAGGATGGACTCTTGG - Intronic
1047363021 8:124186121-124186143 CATGTATCAGTATGGACTCATGG - Intergenic
1047783586 8:128131899-128131921 TTTCTATCACTTGGGACCCAAGG + Intergenic
1048086992 8:131192927-131192949 GTTATATCACTATGGACTCATGG + Intergenic
1048235970 8:132691184-132691206 TTTATATCAGTATAGACTCATGG + Intronic
1048564128 8:135576416-135576438 TTTCTGTCAGTGTGGACTCATGG + Intronic
1049131218 8:140844451-140844473 TCTATATTACTATGGACTCATGG + Intronic
1049270809 8:141695140-141695162 TTTATATTTGTCTGGACTCCTGG - Intergenic
1049722239 8:144124256-144124278 TTTTTATCAGTGAGGACTCGTGG - Intergenic
1050070204 9:1802772-1802794 TTTATGTCTGTATGGACTCATGG - Intergenic
1050520796 9:6497809-6497831 TTTATAGCAGTCTGTCCTCATGG + Intronic
1050985858 9:12081077-12081099 TTTAAATTAGTTTGAACTCATGG - Intergenic
1051109020 9:13614267-13614289 TTTACATCTGCCTGGACTCAGGG + Intergenic
1051244365 9:15094408-15094430 TTTATATCAGTTTGGACTCATGG + Intergenic
1051839187 9:21375197-21375219 CTTATATCAGTATGAACTCATGG + Intergenic
1051892129 9:21953345-21953367 CTTATATTAGTGTAGACTCATGG - Intronic
1051961403 9:22768458-22768480 TTCATATCAATATGGATTCATGG + Intergenic
1052168211 9:25359118-25359140 ATTATATCAGTATAGACTCATGG + Intergenic
1052493872 9:29201267-29201289 TTTATATCAGCATGAACGCATGG + Intergenic
1052758224 9:32563765-32563787 TTTATATCAGTTTGCACTCATGG + Intronic
1054742752 9:68825306-68825328 TTTGTATCTGGTTGGACTGATGG + Intronic
1054744266 9:68838929-68838951 TTTATATCAGTTTAGATGAATGG + Intronic
1055184112 9:73429623-73429645 TTTATATCAGTATGGATGAATGG + Intergenic
1055245650 9:74239439-74239461 TTTCTATCAGCAGGGACTCATGG - Intergenic
1055431630 9:76249905-76249927 TTTATATTTGTATGAACTCATGG - Intronic
1056089842 9:83194718-83194740 TTTGTATCAGCATGGCCTCAGGG + Intergenic
1056110147 9:83387292-83387314 TTTAGATTAGGATGGACTCATGG + Intronic
1056174030 9:84016864-84016886 TTTATATGAATATAGACTCATGG + Intergenic
1056281641 9:85047050-85047072 TTTATATCAGTAGGAACTCATGG + Intergenic
1056688981 9:88789806-88789828 TTTATATCAGGGTGGACTCATGG - Intergenic
1056851660 9:90089746-90089768 TTTATATCAACATGAACTCATGG + Intergenic
1057012320 9:91615778-91615800 TTTATATCTGTATGAACTGATGG - Intronic
1057079034 9:92158586-92158608 TTTATATTGCTATGGACTCATGG + Intergenic
1057144911 9:92751714-92751736 CTTACATCAGTATGAACTCATGG + Intronic
1057301571 9:93888723-93888745 TTTATATCAGCATGGCCCCATGG - Intergenic
1057746308 9:97754541-97754563 TTTATATCAATATGGACTCATGG + Intergenic
1058031305 9:100201074-100201096 TCTAAATCAATTTGGACTTATGG - Intronic
1058114208 9:101066549-101066571 TTTATGTCAGTATGGACTCATGG + Intronic
1059110984 9:111558205-111558227 TTTGTCTCAGTACGGACTCATGG + Intronic
1059185277 9:112263259-112263281 TTTATATCGGTATGGACTAAAGG - Intronic
1059603703 9:115810071-115810093 TTTATTTTACTATGGACTCATGG - Intergenic
1059668045 9:116467705-116467727 TTTACATGAGTTTAGACTCTTGG - Intronic
1060165377 9:121409575-121409597 TTCATATCTGTGTGGACTCATGG + Intergenic
1060369325 9:123055160-123055182 TTTATGTAAGTATGGACTCCTGG + Intronic
1061508091 9:131043609-131043631 TTTACATCAGTATGGATTCGTGG - Intronic
1061637487 9:131922310-131922332 CTTAAATCAGTGTGGACTCAAGG + Intronic
1061735809 9:132657527-132657549 TTTGTATCAGTTTGAACTCACGG + Intronic
1062298901 9:135852861-135852883 TTTATATCCGGATGGCCTCATGG - Intronic
1203635181 Un_KI270750v1:103770-103792 TTAGTACCAGTATGGACTCATGG + Intergenic
1186096936 X:6112426-6112448 CATATATCAGTATGGACTCATGG - Intronic
1186106476 X:6212898-6212920 TTTATATCAGTATGGACACATGG - Intronic
1186604299 X:11073717-11073739 TTCATAACAGTTTGGACTCATGG - Intergenic
1186604305 X:11073800-11073822 TTTATATCAATATGGACTCATGG - Intergenic
1186644089 X:11487762-11487784 TTTATATCACCATGGACTCATGG - Intronic
1186951926 X:14636096-14636118 TTTATATCAGTATGACCTTATGG - Intronic
1187696020 X:21921622-21921644 TTCATTTAAGTGTGGACTCATGG + Intergenic
1187743252 X:22379503-22379525 CTTATATCAGTTTGGATTCATGG + Intergenic
1187804758 X:23107195-23107217 TTTATATCCGTTTGAGCTCATGG + Intergenic
1188246604 X:27842059-27842081 TTTATATCAGTATGAACTTGTGG + Intergenic
1188504456 X:30866664-30866686 TTTATCTCAGTATGGGCTCATGG - Intronic
1188523630 X:31065717-31065739 TTTATCTCACTATGGATTCATGG - Intergenic
1188769611 X:34136133-34136155 TTTATATCAGTATGGACTCATGG - Intergenic
1188775273 X:34209356-34209378 TTTATGTCAATATGGAGTCATGG + Intergenic
1188995871 X:36884623-36884645 TTTATATTAGTATGGACCCTGGG + Intergenic
1189006871 X:37005195-37005217 TTTATATCAGTATGGACTCATGG + Intergenic
1189041705 X:37548464-37548486 TTTGTATCAGTATGGACTCATGG - Intronic
1189513179 X:41683975-41683997 TTTACATCAGCATAGACTCATGG - Intronic
1189585191 X:42453355-42453377 ATTATGTCAGTATGAACTCATGG - Intergenic
1189673024 X:43432146-43432168 TTTATATCATAATGGACCCAGGG + Intergenic
1189782758 X:44531940-44531962 TTTATATCAATATGGACTCATGG - Intronic
1190070422 X:47274702-47274724 TTTATGGCAGTATGGACTCACGG + Intergenic
1190103091 X:47538020-47538042 TTTATATCAGTATGGACTCATGG - Intergenic
1190370979 X:49740392-49740414 TGTGTATCAGTTTGAACTCTGGG - Intergenic
1190379131 X:49821491-49821513 TTTATATCAGTATGGACTCATGG - Intergenic
1190450302 X:50572706-50572728 TTTATATCACTATAGACTTATGG + Intergenic
1190521697 X:51285454-51285476 TTTATATCAGTATAGACTCCTGG + Intergenic
1190731453 X:53228977-53228999 CTTATATCAATGTGGAGTCATGG - Intergenic
1190853433 X:54268774-54268796 TTTATGTTAGTATGAACTCATGG - Intronic
1191060357 X:56289111-56289133 TTTATATCAGCATGGACTCATGG + Intergenic
1191086594 X:56574394-56574416 TTTATATCAGTATAAACTCATGG + Intergenic
1191136907 X:57074643-57074665 TTAATATCAGTATGTACTCATGG + Intergenic
1191193852 X:57699445-57699467 TTTATATCAGTATTGACTCATGG - Intergenic
1191632698 X:63339297-63339319 TTTATATCAGTATAGACTTATGG - Intergenic
1192226974 X:69236016-69236038 TTTATATCACTATAGACTCATGG + Intergenic
1192257922 X:69480857-69480879 TTTATATCACTATGGACTCATGG - Intergenic
1192416511 X:70985804-70985826 TTTACAACAGTATGAACTCATGG - Intergenic
1192421122 X:71031932-71031954 TGATTATCAGTATGGACTCATGG - Intergenic
1192619111 X:72659138-72659160 TTTATATCAGTATGGACTTATGG + Intronic
1192734556 X:73836957-73836979 TTTATATCAGTATGATCTCAGGG - Intergenic
1193797713 X:85896798-85896820 ATTATATAAGTTTGTACTCTTGG - Intronic
1193928618 X:87523636-87523658 TTTATATCAGTATGGACTCATGG - Intronic
1193955267 X:87852151-87852173 TTAATTGCAGTATGGACTCATGG - Intergenic
1194659774 X:96617729-96617751 TTTATATTATTTTAAACTCATGG - Intergenic
1195648579 X:107260931-107260953 TTTATATGAGTATGAACACATGG - Intergenic
1195865463 X:109428003-109428025 TTTATATCAGTGTGCACATATGG - Intronic
1195891766 X:109702850-109702872 TTTATATTAGTATGGACTCGTGG - Intronic
1195896000 X:109746856-109746878 TTTACATCAGTATGGACTCCTGG - Intergenic
1196035535 X:111139804-111139826 CTTATATCAATTTGAATTCATGG - Intronic
1196203265 X:112910144-112910166 TTTATATCAGTATAGACTCATGG + Intergenic
1196262097 X:113595049-113595071 TTTATATCAGTATGGACTCATGG + Intergenic
1196511048 X:116512963-116512985 TTTTTATGATTTTGGAATCAGGG + Intergenic
1196636947 X:118012940-118012962 TTTCTATTAGTATTGACTCATGG + Intronic
1196769498 X:119279896-119279918 TTTATACCAGTATAGACTTACGG + Intergenic
1196782757 X:119398448-119398470 TTTATGTCAGTTTCCACTAACGG - Intergenic
1197125356 X:122939611-122939633 TTTATGTCAGTATAGACTCATGG - Intergenic
1197250800 X:124214673-124214695 TGTATGTCAATATGGACTCATGG + Intronic
1197276387 X:124484517-124484539 TTTATATCAGTATGGACTCATGG + Intronic
1197596354 X:128468736-128468758 TTTATATAATTTTAGTCTCATGG + Intergenic
1197650891 X:129062320-129062342 TTTATATCAGTATAGATTCATGG - Intergenic
1197689630 X:129484666-129484688 TTTATATCAGTATGGACTCATGG - Intronic
1198008425 X:132523643-132523665 ATTACATCAGTGTGGACTCATGG - Intergenic
1198025364 X:132700582-132700604 TTTCCATTAGTTTGGTCTCACGG - Intronic
1198031221 X:132755169-132755191 ATTATATCAGTATGGACTCTTGG + Intronic
1198239264 X:134767031-134767053 TTTGCATCAGTGTGGACTCATGG - Intergenic
1198279616 X:135128773-135128795 TTTATATCAGTATGGACTCATGG - Intergenic
1198291341 X:135243741-135243763 TTTATATCAGTATGGACTCATGG + Intergenic
1198757678 X:139997930-139997952 TTAATATCAGTATGGATTCATGG + Intergenic
1198778296 X:140205347-140205369 GTTATACCAGTATGGACTCATGG + Intergenic
1198826873 X:140707621-140707643 TTACTATCACTGTGGACTCACGG + Intergenic
1198941432 X:141961037-141961059 TTTATATCATTATGAACTCATGG + Intergenic
1199331603 X:146566942-146566964 TTTATATAAATTTTGACTTAAGG + Intergenic
1199346333 X:146745711-146745733 TTTATATCAGTGAGGACTCATGG + Intergenic
1199498725 X:148485292-148485314 TTTATATCAATATGGATTCATGG - Intergenic
1199504397 X:148545036-148545058 TTTTTATAAGTTGGGAATCATGG + Intronic
1199509518 X:148605792-148605814 TTCATAGCAGTATGAACTCATGG - Intronic
1200087540 X:153615661-153615683 TTTTTATCACTGTGGACTCGGGG - Intergenic
1200946535 Y:8846414-8846436 TGTATATCAGTGTGTAGTCATGG + Intergenic
1201338926 Y:12910484-12910506 TTTTTATCAGTTTGTAGACATGG + Intronic
1201361123 Y:13150217-13150239 TTTATATCAGTGTTCACTCTTGG - Intergenic
1201490798 Y:14539297-14539319 TTTATATCACTATGGGCACATGG + Intronic
1201865932 Y:18654473-18654495 TTGATATCAGTACGTACTCATGG + Intergenic
1201986180 Y:19969820-19969842 TTTATATCCATATGGACTCATGG - Intergenic