ID: 1182298080

View in Genome Browser
Species Human (GRCh38)
Location 22:29321695-29321717
Sequence CTCAGTCATTTATATCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182298080_1182298083 24 Left 1182298080 22:29321695-29321717 CCAAACTGATATAAATGACTGAG No data
Right 1182298083 22:29321742-29321764 TTCAGCTTGCTTGCTCCCAGGGG No data
1182298080_1182298081 22 Left 1182298080 22:29321695-29321717 CCAAACTGATATAAATGACTGAG No data
Right 1182298081 22:29321740-29321762 CATTCAGCTTGCTTGCTCCCAGG No data
1182298080_1182298082 23 Left 1182298080 22:29321695-29321717 CCAAACTGATATAAATGACTGAG No data
Right 1182298082 22:29321741-29321763 ATTCAGCTTGCTTGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182298080 Original CRISPR CTCAGTCATTTATATCAGTT TGG (reversed) Intergenic
No off target data available for this crispr