ID: 1182298081

View in Genome Browser
Species Human (GRCh38)
Location 22:29321740-29321762
Sequence CATTCAGCTTGCTTGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182298079_1182298081 30 Left 1182298079 22:29321687-29321709 CCATGAGTCCAAACTGATATAAA 0: 3
1: 55
2: 186
3: 378
4: 662
Right 1182298081 22:29321740-29321762 CATTCAGCTTGCTTGCTCCCAGG No data
1182298080_1182298081 22 Left 1182298080 22:29321695-29321717 CCAAACTGATATAAATGACTGAG No data
Right 1182298081 22:29321740-29321762 CATTCAGCTTGCTTGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182298081 Original CRISPR CATTCAGCTTGCTTGCTCCC AGG Intergenic
No off target data available for this crispr