ID: 1182298083

View in Genome Browser
Species Human (GRCh38)
Location 22:29321742-29321764
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182298080_1182298083 24 Left 1182298080 22:29321695-29321717 CCAAACTGATATAAATGACTGAG No data
Right 1182298083 22:29321742-29321764 TTCAGCTTGCTTGCTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182298083 Original CRISPR TTCAGCTTGCTTGCTCCCAG GGG Intergenic
No off target data available for this crispr