ID: 1182298520

View in Genome Browser
Species Human (GRCh38)
Location 22:29325227-29325249
Sequence GCTACTATTTCCACACAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182298517_1182298520 -6 Left 1182298517 22:29325210-29325232 CCCAACATGTATTCCGTGCTACT No data
Right 1182298520 22:29325227-29325249 GCTACTATTTCCACACAAGAAGG No data
1182298518_1182298520 -7 Left 1182298518 22:29325211-29325233 CCAACATGTATTCCGTGCTACTA No data
Right 1182298520 22:29325227-29325249 GCTACTATTTCCACACAAGAAGG No data
1182298516_1182298520 9 Left 1182298516 22:29325195-29325217 CCTCTGCGATATAAGCCCAACAT No data
Right 1182298520 22:29325227-29325249 GCTACTATTTCCACACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182298520 Original CRISPR GCTACTATTTCCACACAAGA AGG Intergenic
No off target data available for this crispr