ID: 1182298820

View in Genome Browser
Species Human (GRCh38)
Location 22:29326918-29326940
Sequence ACAGCTCGAGCCCTTGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182298812_1182298820 21 Left 1182298812 22:29326874-29326896 CCTTGGTTGGTTCTGGACTCTTT No data
Right 1182298820 22:29326918-29326940 ACAGCTCGAGCCCTTGACCCTGG No data
1182298819_1182298820 -9 Left 1182298819 22:29326904-29326926 CCACAGCTGGGCACACAGCTCGA No data
Right 1182298820 22:29326918-29326940 ACAGCTCGAGCCCTTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182298820 Original CRISPR ACAGCTCGAGCCCTTGACCC TGG Intergenic
No off target data available for this crispr