ID: 1182298937

View in Genome Browser
Species Human (GRCh38)
Location 22:29327364-29327386
Sequence GGCCCCTGGAGCCTCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182298920_1182298937 21 Left 1182298920 22:29327320-29327342 CCACCCCCTCTCCCACGGCTGCC No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298923_1182298937 16 Left 1182298923 22:29327325-29327347 CCCTCTCCCACGGCTGCCCCTGA No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298924_1182298937 15 Left 1182298924 22:29327326-29327348 CCTCTCCCACGGCTGCCCCTGAT No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298921_1182298937 18 Left 1182298921 22:29327323-29327345 CCCCCTCTCCCACGGCTGCCCCT No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298928_1182298937 9 Left 1182298928 22:29327332-29327354 CCACGGCTGCCCCTGATCAGGGG No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298931_1182298937 -1 Left 1182298931 22:29327342-29327364 CCCTGATCAGGGGATCTCCCACG No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298930_1182298937 0 Left 1182298930 22:29327341-29327363 CCCCTGATCAGGGGATCTCCCAC No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298919_1182298937 22 Left 1182298919 22:29327319-29327341 CCCACCCCCTCTCCCACGGCTGC No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298922_1182298937 17 Left 1182298922 22:29327324-29327346 CCCCTCTCCCACGGCTGCCCCTG No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298917_1182298937 29 Left 1182298917 22:29327312-29327334 CCACACGCCCACCCCCTCTCCCA No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298926_1182298937 10 Left 1182298926 22:29327331-29327353 CCCACGGCTGCCCCTGATCAGGG No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data
1182298932_1182298937 -2 Left 1182298932 22:29327343-29327365 CCTGATCAGGGGATCTCCCACGG No data
Right 1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182298937 Original CRISPR GGCCCCTGGAGCCTCCCAGA TGG Intergenic
No off target data available for this crispr