ID: 1182299968

View in Genome Browser
Species Human (GRCh38)
Location 22:29331807-29331829
Sequence GGTGGGCTCGGTCATGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182299968_1182299978 15 Left 1182299968 22:29331807-29331829 CCATCTTCATGACCGAGCCCACC 0: 1
1: 0
2: 3
3: 11
4: 119
Right 1182299978 22:29331845-29331867 GAGATCTCCACTGTCTGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1182299968_1182299976 10 Left 1182299968 22:29331807-29331829 CCATCTTCATGACCGAGCCCACC 0: 1
1: 0
2: 3
3: 11
4: 119
Right 1182299976 22:29331840-29331862 GCAGGGAGATCTCCACTGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
1182299968_1182299972 -7 Left 1182299968 22:29331807-29331829 CCATCTTCATGACCGAGCCCACC 0: 1
1: 0
2: 3
3: 11
4: 119
Right 1182299972 22:29331823-29331845 GCCCACCGTGCTGAGAGGCAGGG 0: 1
1: 0
2: 3
3: 14
4: 142
1182299968_1182299971 -8 Left 1182299968 22:29331807-29331829 CCATCTTCATGACCGAGCCCACC 0: 1
1: 0
2: 3
3: 11
4: 119
Right 1182299971 22:29331822-29331844 AGCCCACCGTGCTGAGAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 173
1182299968_1182299979 16 Left 1182299968 22:29331807-29331829 CCATCTTCATGACCGAGCCCACC 0: 1
1: 0
2: 3
3: 11
4: 119
Right 1182299979 22:29331846-29331868 AGATCTCCACTGTCTGGTTGGGG 0: 1
1: 0
2: 2
3: 6
4: 112
1182299968_1182299977 14 Left 1182299968 22:29331807-29331829 CCATCTTCATGACCGAGCCCACC 0: 1
1: 0
2: 3
3: 11
4: 119
Right 1182299977 22:29331844-29331866 GGAGATCTCCACTGTCTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 106
1182299968_1182299981 24 Left 1182299968 22:29331807-29331829 CCATCTTCATGACCGAGCCCACC 0: 1
1: 0
2: 3
3: 11
4: 119
Right 1182299981 22:29331854-29331876 ACTGTCTGGTTGGGGCTGAGTGG 0: 1
1: 0
2: 3
3: 21
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182299968 Original CRISPR GGTGGGCTCGGTCATGAAGA TGG (reversed) Exonic
900142742 1:1145395-1145417 GGTGGGGTCGGCCATGAAGGTGG - Intergenic
900182730 1:1319437-1319459 GGTGGGGTGAGTCATGTAGATGG + Exonic
900652685 1:3738049-3738071 GGTTGGCTCTCTCAGGAAGAGGG - Intergenic
901197414 1:7447825-7447847 GGTGGGCTCGCTGCTGAACAAGG + Intronic
901216576 1:7558589-7558611 AGTGGGCATGGTCCTGAAGATGG + Intronic
902303524 1:15520037-15520059 GGTGGGGTCAGTCACTAAGAAGG + Intronic
903296953 1:22350104-22350126 GGTGGGCTCCCTAATGTAGATGG - Intergenic
903973889 1:27136914-27136936 TGTGGGCTCTTTCCTGAAGATGG - Intronic
915195009 1:154182865-154182887 GGCGGGCTCGGAGATGAAGTTGG - Intronic
919736876 1:200958150-200958172 GGTGAGCTGGGTCAGGAAGGAGG - Intergenic
1067234686 10:44437645-44437667 GGTGGGCCATGTCATGAAGCTGG - Intergenic
1069439342 10:68413586-68413608 GATGGGCTTGATCATGGAGAGGG - Intergenic
1070056982 10:72944993-72945015 GGTGGGCTAGGAAATGAAGTGGG + Intronic
1071430236 10:85601401-85601423 GGTGGGGTTGGTCTGGAAGAAGG - Exonic
1071528159 10:86370248-86370270 GGTGGGCTCTGTGCTGAGGAGGG - Intergenic
1075644004 10:124085855-124085877 GGGGGGCTCGATGATGAAGTAGG + Intronic
1079327340 11:19505546-19505568 GGTGGGTCGGGTCATGCAGATGG + Intronic
1079350254 11:19686082-19686104 GGTGGGTTAGGACATGAACATGG - Intronic
1083175381 11:60946612-60946634 CGGGGGCTTGGTGATGAAGACGG + Exonic
1084376842 11:68783478-68783500 GGTGGGCTGTGTCTTGCAGAGGG - Intronic
1084408636 11:68993250-68993272 GGTGGGCTCTGGCATCAAGCTGG + Intergenic
1085468807 11:76743633-76743655 GGTGGGGTCGGGCAAGAACAAGG - Intergenic
1086830637 11:91558998-91559020 GGTGGGCTGGATCTTGAAGATGG - Intergenic
1087306818 11:96499098-96499120 GGTGGGCTCTGGCATTAAGCTGG + Intronic
1089910742 11:122097859-122097881 GATGGGCTCGGTGAGGAAGAAGG + Intergenic
1091116187 11:133015877-133015899 GGTGGGCTGGGTCTTGGAGGAGG - Intronic
1091603010 12:1929425-1929447 GGTGGCCACGGGCATGAGGAGGG - Intergenic
1096870142 12:54587968-54587990 GGAGGGGTCGGTAATGGAGAGGG - Intronic
1113037882 13:106071030-106071052 GGTGGGGTAGGCCATGAAAAAGG - Intergenic
1117864857 14:60136628-60136650 GGTGGGCTCTGGCATTAAGCTGG - Exonic
1124743067 15:32315060-32315082 GGTGGTCTCGTCCTTGAAGAAGG + Intergenic
1125717517 15:41827644-41827666 GGTGGCCTCAGACATGCAGAAGG - Exonic
1127315853 15:57792982-57793004 GGTGCCCTGGGTGATGAAGACGG - Intergenic
1128250329 15:66159541-66159563 GGTGGTCTGGGTTATGCAGAGGG - Intronic
1129249738 15:74302356-74302378 GGTGGGCTCGGTCCTCAGAAAGG + Intronic
1132749073 16:1449041-1449063 GGTGGCCTCCATCATGATGACGG + Exonic
1136710559 16:32233708-32233730 GGAGGGGTCTGTCAGGAAGATGG + Intergenic
1136757352 16:32695703-32695725 GGAGGGGTCTGTCAGGAAGATGG - Intergenic
1136810755 16:33174672-33174694 GGAGGGGTCTGTCAGGAAGATGG + Intergenic
1136817231 16:33284752-33284774 GGAGGGGTCTGTCAGGAAGATGG + Intronic
1136823794 16:33341281-33341303 GGAGGGGTCTGTCAGGAAGATGG + Intergenic
1138554734 16:57764782-57764804 GATGGGCAGGGTCATGAAGATGG + Intronic
1139007434 16:62590304-62590326 GGTGGGCTAGGTATGGAAGAAGG + Intergenic
1139957666 16:70700839-70700861 GTTGGCCTCTGTCATGGAGACGG - Intronic
1203059502 16_KI270728v1_random:956054-956076 GGAGGGGTCTGTCAGGAAGATGG - Intergenic
1145817214 17:27804268-27804290 GGTGGGCAGGGCCAAGAAGAAGG - Exonic
1146651963 17:34612662-34612684 GGTGGGCTTGGTCATGAAGGTGG - Intronic
1146782035 17:35682782-35682804 CTTGGGCCCAGTCATGAAGATGG + Exonic
1147169196 17:38608266-38608288 GGTGAGCTCGCTCATCATGAAGG + Intergenic
1147922852 17:43929021-43929043 GGTGGGCTCTGGCATGAGGCTGG - Intergenic
1152115192 17:78382098-78382120 GTTAGGCTCGGTGAAGAAGAGGG + Intronic
1152455518 17:80413949-80413971 GGTGGGCTCTGGCATTAAGCTGG + Intergenic
1152783085 17:82235027-82235049 GGTGGGGTGGGGCATGAAGATGG + Exonic
1152818980 17:82426135-82426157 GGTGGGCTCTGGCATTAAGCTGG - Intronic
1157503941 18:48212797-48212819 ATTGGGCTGGGTCTTGAAGAAGG + Intronic
1159041078 18:63323156-63323178 GGTGGCCTGGGGAATGAAGACGG - Intergenic
1160055076 18:75471480-75471502 AGTGTGGTAGGTCATGAAGAAGG + Intergenic
1160795901 19:945386-945408 GGTGGGCTGGGTCAGGCAGCAGG - Intronic
1163630896 19:18417542-18417564 GGTGGGAGCGGTCATTAGGATGG + Intergenic
926291627 2:11535804-11535826 AGTGGGCACGGTCAGGAAGTGGG - Intronic
929779025 2:44945858-44945880 GGTGGCCTGGGTTAGGAAGAGGG + Exonic
938282596 2:130075045-130075067 GGTGGCCTCGGTCAGCAGGACGG + Exonic
940862432 2:158784562-158784584 AGTGGGGTCGGTCAGGGAGAAGG + Intergenic
1169401411 20:5283507-5283529 GGTAGGCTCTGTCAGAAAGAGGG - Intergenic
1170817556 20:19727668-19727690 GGTGGGCTAGGCAATGAGGAAGG + Intergenic
1170936455 20:20814269-20814291 GGTGGGCTGAGTCAAGCAGACGG + Intergenic
1171067120 20:22028101-22028123 GGAGGGCTCTGTCTGGAAGACGG - Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175930670 20:62492398-62492420 GGTGGGCTGGGTGCTGCAGACGG + Intergenic
1175949418 20:62575292-62575314 GGTGGGCAGGGGCATGAGGAGGG + Intergenic
1179548981 21:42131372-42131394 GGAGGTCTCGGCCATGAAGCTGG + Intronic
1179548991 21:42131408-42131430 GGAGGTCTCGGCCATGAAGCTGG + Intronic
1179549019 21:42131516-42131538 GGAGGTCTCGGCCATGAAGCTGG + Intronic
1179549029 21:42131552-42131574 GGAGGTCTCGGCCATGAAGCTGG + Intronic
1179549039 21:42131588-42131610 GGAGGTCTCGGCCATGAAGCTGG + Intronic
1179839081 21:44058664-44058686 GATGGGCTCCGTCATGGAGAGGG + Intronic
1182299968 22:29331807-29331829 GGTGGGCTCGGTCATGAAGATGG - Exonic
949572596 3:5308082-5308104 GGAGGGCTGGGACATGGAGAAGG - Intergenic
949741514 3:7239605-7239627 GGTGGGCTCAGTAAAGCAGATGG + Intronic
950020052 3:9780607-9780629 GGTAGGCTCGGTCTTGAAGAGGG - Intronic
950444195 3:13026599-13026621 AGTGGGCTGTGCCATGAAGAAGG + Intronic
953843180 3:46406399-46406421 GGAGGGCACGGTCTGGAAGAAGG - Intergenic
956164141 3:66383661-66383683 TGTGGGCTTGGTCAAGAATAAGG - Intronic
957038686 3:75319032-75319054 AATGGGCACCGTCATGAAGAAGG + Intergenic
961086723 3:124074330-124074352 AATGGGCACTGTCATGAAGAAGG + Intergenic
961200716 3:125043315-125043337 GGTGGCCTCGGGCATGAAGGAGG + Intronic
961501696 3:127340782-127340804 GGTGGGCTCGCTCATGCATCCGG - Intergenic
964193251 3:154031108-154031130 GGAGGGCTCATCCATGAAGAGGG - Intergenic
968086677 3:195877011-195877033 GGTGGACACGGTCATGAGGCTGG + Intronic
977708742 4:100100354-100100376 GGTGGGCTAGGACAGAAAGATGG - Intergenic
979707229 4:123734996-123735018 GGTGGGATGGGTCATGGATAAGG + Intergenic
982872151 4:160593945-160593967 GATGGGTGCAGTCATGAAGAAGG + Intergenic
983010355 4:162538500-162538522 GGTGGGCTCTGGCATTAAGCTGG - Intergenic
984356300 4:178663724-178663746 GGTGTGCTAGGTCAAGCAGACGG + Intergenic
984645622 4:182216538-182216560 GGTAGGCTTGGTGATGAAGATGG - Intronic
986364625 5:7018340-7018362 GGAGGGATCAGTCATAAAGATGG - Intergenic
991676139 5:69091559-69091581 GGTGGGCTCTGGCATTAAGCTGG + Intergenic
991971844 5:72148943-72148965 GGAAGGCTGGGTCCTGAAGAGGG - Intronic
992571514 5:78064017-78064039 GGGGGGGTCGGGCAGGAAGAGGG + Intronic
996039408 5:118793314-118793336 TCTGGGCTCTGTCAGGAAGAGGG + Intergenic
996857351 5:128023833-128023855 GGTGGGATGGGTCTTGGAGAAGG - Intergenic
997690325 5:135823712-135823734 GGTGGTGGCAGTCATGAAGAAGG + Intergenic
1000411714 5:160940424-160940446 GGTGGGCATGGACATAAAGATGG - Intergenic
1000757821 5:165183607-165183629 GGTAGGCTCTGTCAGAAAGAAGG + Intergenic
1001492674 5:172166475-172166497 GGTGGGCTTGGGAATGAAGGTGG - Intronic
1006247707 6:32754788-32754810 TGTGGGCTCAGCCCTGAAGATGG - Intergenic
1007737778 6:43992519-43992541 GGTGGTGTTGGTGATGAAGATGG + Intergenic
1012036773 6:94151669-94151691 GGTGGGGCTGGTCATGAGGAAGG + Intergenic
1016803746 6:148191992-148192014 GGTGGACTCGGTTATGAGGCAGG + Intergenic
1018036942 6:159889722-159889744 GGTGAACTCGGTCTTGAAGTTGG - Intergenic
1022829369 7:34049575-34049597 GTGGAGCTCAGTCATGAAGAAGG + Intronic
1029575415 7:101400282-101400304 GGTGGGCTCGGTCATGGAGTGGG + Intronic
1029799233 7:102928833-102928855 CGTGGGCTCCTTCATGAAGAAGG - Intronic
1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG + Intronic
1040079894 8:43275413-43275435 GTTGGGTTCATTCATGAAGAAGG + Intergenic
1056296092 9:85194434-85194456 GGAGGGCTGGGTAATGAGGAAGG - Intergenic
1057488806 9:95506769-95506791 GGGGGGCTCGGTCATAAAGCCGG + Intronic
1059826624 9:118036889-118036911 TGCGGGCTAGGTCATGAAGTAGG + Intergenic
1060092881 9:120760143-120760165 GGAGGGCTGTGTCAAGAAGACGG + Exonic
1186271375 X:7891986-7892008 GGTGGGCTCTGGCATTAAGCTGG - Intergenic
1192534053 X:71912503-71912525 GGTGGGGTCTGCAATGAAGAGGG - Intergenic
1192874340 X:75211884-75211906 GGTGGGCTCTGGCATTAAGCTGG - Intergenic
1194383338 X:93222637-93222659 CTTGGGCCCAGTCATGAAGATGG - Intergenic
1197999936 X:132423125-132423147 GCCGGTCTAGGTCATGAAGAAGG + Intronic
1198801704 X:140454231-140454253 GGTGGGTGTGGTCAAGAAGATGG - Intergenic
1198854588 X:141002895-141002917 GGTGGGCTCTGGCATTAAGCGGG - Intronic
1198877430 X:141242252-141242274 GGTGGGCTCTGGCATTAAGCGGG + Intronic
1198908113 X:141584473-141584495 GGTGGGCTCTGGCATTAAGCGGG + Intronic
1198908678 X:141589951-141589973 GGTGGGCTCTGGCATTAAGCGGG - Intronic
1198918392 X:141698200-141698222 GGTGGGCTCTGGCATTAAGCGGG + Intronic
1199003620 X:142670816-142670838 GGTTGGCTCGGTTAAGAAAATGG - Intergenic
1199033316 X:143026204-143026226 GGTGGGCTCTGGCATGAAGCTGG - Intronic
1199075150 X:143517180-143517202 GGTGGGCTCTGGCATTAAGCGGG + Intronic
1199214199 X:145247773-145247795 GGTGGGCTCTGGCATTAAGCGGG - Intronic