ID: 1182300094

View in Genome Browser
Species Human (GRCh38)
Location 22:29332288-29332310
Sequence GGGTGGTCCCAGAGTTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182300094_1182300098 11 Left 1182300094 22:29332288-29332310 CCTTGAAAACTCTGGGACCACCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1182300098 22:29332322-29332344 GCCAATCCTCAACTCCCAGAAGG 0: 1
1: 0
2: 0
3: 152
4: 2220
1182300094_1182300100 12 Left 1182300094 22:29332288-29332310 CCTTGAAAACTCTGGGACCACCC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1182300100 22:29332323-29332345 CCAATCCTCAACTCCCAGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182300094 Original CRISPR GGGTGGTCCCAGAGTTTTCA AGG (reversed) Intronic
900829150 1:4951854-4951876 GTGGGGTCCGAGAGTTTGCATGG - Intergenic
900845610 1:5097979-5098001 GGGTGGTCCCACTATTATCAAGG + Intergenic
901339089 1:8478840-8478862 GGCTGGACCCAGAGTTTTGAGGG + Intronic
906212952 1:44022290-44022312 GGGAGGACTCAGAGGTTTCATGG + Intronic
906837393 1:49098680-49098702 GGGTGGTCAGAGAGTTTAAAGGG + Intronic
907514071 1:54982147-54982169 GGGTGGTCACAGAGCTAACAGGG + Intronic
909721500 1:78776125-78776147 GGGAGGACCCAGAGTGTGCAAGG + Intergenic
912588028 1:110784500-110784522 GGTTGGAGCAAGAGTTTTCAGGG + Intergenic
915951684 1:160193513-160193535 GCGTGGCCCCAGAGCTTTCTAGG - Intronic
916143539 1:161720966-161720988 GGATGGTTCCAGAGGTTTCTAGG + Intergenic
916464259 1:165058063-165058085 AGGTGATTCCAGAGGTTTCAGGG + Intergenic
917487221 1:175466337-175466359 GGGTCTTCCCTGATTTTTCAGGG - Intronic
920741447 1:208584903-208584925 GGGTGGTCCTAGAGGGTGCAGGG - Intergenic
921087145 1:211805493-211805515 AGATGGTCCCTGACTTTTCATGG - Intronic
1063949071 10:11205688-11205710 AGGTGGTCCCTGAGTTCTCATGG - Intronic
1064723057 10:18249465-18249487 GGGTGGACACACATTTTTCAAGG - Intronic
1066647656 10:37625782-37625804 AGGTGGTCCTAGATTTTTGAGGG - Intergenic
1069084121 10:64119840-64119862 GTATGATCCCAGGGTTTTCATGG + Intergenic
1070703052 10:78617377-78617399 TGGTGGTCCCACTGTTTACATGG + Intergenic
1073032488 10:100538188-100538210 GGGTGATTAAAGAGTTTTCAAGG + Intronic
1074506496 10:114075491-114075513 GGGAGCTCCCACAGTTTTCAGGG - Intergenic
1075640804 10:124063015-124063037 TGGTGGGACCAGCGTTTTCATGG - Intronic
1078000249 11:7488716-7488738 GTGTGGTCCCAGATTTTTTCAGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084742313 11:71147586-71147608 CGCTGGTACCAGAGTTTGCAGGG - Intronic
1087910451 11:103747228-103747250 CTGTGGTCCAAGAGTTTGCATGG - Intergenic
1095950358 12:47778366-47778388 GGGTGGCCCTGGAGTCTTCATGG + Intronic
1096674869 12:53221049-53221071 GGGGGTTCCCAGAGAGTTCACGG - Intronic
1096802669 12:54121721-54121743 GGGTGGTCACATTGTTTTCTGGG - Intergenic
1098845727 12:75533549-75533571 GGGTAGTCTCAGTGTTTGCAAGG - Intergenic
1102754320 12:115324729-115324751 GGGCAGTCACAGAGATTTCATGG + Intergenic
1103627092 12:122227518-122227540 GCGTGGTCCCCGAGCTCTCAGGG + Exonic
1105068372 12:133218900-133218922 GGATGCTCCTTGAGTTTTCAGGG - Exonic
1106802135 13:33267136-33267158 GGGTGGGCCCTGGTTTTTCAAGG + Intronic
1111215788 13:85139697-85139719 AGGAGGCCTCAGAGTTTTCATGG - Intergenic
1112171664 13:96978715-96978737 GGGTGGGCCCAGTGTAATCACGG + Intergenic
1117981644 14:61347859-61347881 GAGAAGACCCAGAGTTTTCAGGG + Intronic
1119118329 14:72048149-72048171 GGGTAGTCACAGTGTGTTCAAGG + Intronic
1119776828 14:77254139-77254161 GTGTGGGGCAAGAGTTTTCAAGG + Intronic
1120503588 14:85326566-85326588 GGGTGGACCCAGTGTTCCCAAGG + Intergenic
1121537327 14:94699875-94699897 GACTGGTCCCAGAGTTGGCAAGG + Intergenic
1126081945 15:44971880-44971902 GGGTGGTCCCTGACTTTTCTGGG + Intronic
1128348105 15:66867520-66867542 GGCTTGTCCCAGAGATTCCAGGG - Intergenic
1132247618 15:100309763-100309785 GGGTGGGCCCAGAGTTCTGGAGG - Intronic
1139602012 16:67992875-67992897 GGAGGGTCCCAGAGTATGCAGGG - Intronic
1140475177 16:75236215-75236237 GGCTCGTCCCAGAGCTGTCATGG - Intronic
1141581706 16:85003926-85003948 GGGTGCTCCCGGCGTTTACATGG - Intronic
1146748379 17:35352738-35352760 GAATGGTCCCAGGGTGTTCAGGG - Exonic
1147851963 17:43450644-43450666 GGCTGGTTACAGAATTTTCAGGG - Intergenic
1148219621 17:45852225-45852247 GGGTAGACCCAGAGTTTTCCTGG - Intergenic
1151627783 17:75288291-75288313 GAGTGCTCCCCGAGTTTTCCAGG - Intronic
1151867387 17:76813091-76813113 GGGTGGGCCCAGTGTCATCATGG + Intergenic
1153226896 18:2906661-2906683 GGGTGGCCGCAGAGTCCTCACGG + Intronic
1160050014 18:75424541-75424563 GGATGCTTCCAAAGTTTTCAGGG - Intronic
1162293762 19:9798524-9798546 CCCTGATCCCAGAGTTTTCAGGG + Intergenic
1165473013 19:36014273-36014295 GGGAGCTCCCAGAGGCTTCAAGG + Intergenic
1166417581 19:42607251-42607273 GAGTCCTCCCAGAGATTTCAAGG + Intronic
1167366617 19:49057914-49057936 TGGTGGTCCGAGAGTTGTGAGGG + Exonic
928259773 2:29756113-29756135 GGGTAGGCCCAGAATGTTCAAGG - Intronic
936251888 2:110873830-110873852 GGGTGGCCCCATTGTTTTCTTGG - Intronic
936792075 2:116162854-116162876 GGATGGTCCCAGAAGTGTCATGG + Intergenic
937862659 2:126723067-126723089 GGGTGGTCCCAGAGTTGATGTGG - Intergenic
938073681 2:128320937-128320959 ACGTGGGCCCAGAGTGTTCAAGG + Intergenic
941069899 2:160944253-160944275 GGGTGATGGCAGAGTTCTCAGGG - Intergenic
943200126 2:184812179-184812201 AGGTGGTCTCAGAGTTATTATGG - Intronic
944597678 2:201276308-201276330 GTGTGGTCCCAGGATTTTAAAGG - Intronic
946892797 2:224295659-224295681 ATGTGGTCCTAGAGTTTTTATGG + Intergenic
948069896 2:235112151-235112173 TGGAGGTGGCAGAGTTTTCACGG + Intergenic
1170769014 20:19316217-19316239 AGGTGGTCCCAGATTTTTGATGG - Intronic
1170935254 20:20804354-20804376 GTGTGGTCCCAGACTCTTCCAGG + Intergenic
1171450815 20:25234906-25234928 GGGTACTCTCAGAGTTTTCTGGG - Intergenic
1171854392 20:30331524-30331546 GGGTGGTCACATTGTTTTCTGGG - Intergenic
1172451788 20:35030684-35030706 GGGTGGTACCAAAGTTGTAATGG - Intronic
1175716858 20:61260751-61260773 GGGTGGTCCTTGCCTTTTCAAGG + Intronic
1176457932 21:6929201-6929223 GGGTGGTCCCAGGGACTCCAGGG + Intergenic
1176836104 21:13794285-13794307 GGGTGGTCCCAGGGACTCCAGGG + Intergenic
1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG + Intergenic
1178665546 21:34543285-34543307 GGGTGGGCCCAGTGTAATCAAGG + Intronic
1178918088 21:36720300-36720322 GGGTGGTCCATGACATTTCATGG + Intronic
1182300094 22:29332288-29332310 GGGTGGTCCCAGAGTTTTCAAGG - Intronic
1184314182 22:43670806-43670828 GAGAGGGCCCAGCGTTTTCAAGG + Intronic
955478822 3:59368289-59368311 GTGTGTTGCCAGAGTTTCCATGG + Intergenic
961549308 3:127659774-127659796 GGCTGAGCCCAGAGTTTTCCAGG - Intronic
961660608 3:128466936-128466958 CGCTGGTCCCAGACTGTTCAGGG + Exonic
966456890 3:180127855-180127877 GGGAGGTGCCAGCTTTTTCACGG - Intergenic
968250438 3:197205966-197205988 GGGTGGACCCAAAGTTTCCTTGG - Intronic
968956293 4:3721470-3721492 GGTTGGACCCAGAGGCTTCAGGG - Intergenic
969503568 4:7570004-7570026 GAGGGCTCCCAGCGTTTTCAAGG + Intronic
971255164 4:25007875-25007897 GGGTGGTCCCCAAGTTGACAAGG - Intronic
971623435 4:28886922-28886944 CTCTGATCCCAGAGTTTTCAAGG - Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
973134833 4:46694529-46694551 GGCTGGTCCCACATATTTCAAGG - Intergenic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
977748787 4:100583342-100583364 GGGTGGTCTCAGATTGTTGAAGG + Intronic
979227044 4:118298496-118298518 GGATGATCCCAGAGATTACAAGG + Intronic
979951992 4:126904702-126904724 GGTTGGTCAGAGAGTTTGCAAGG - Intergenic
980106337 4:128592005-128592027 GGGTGGCCCCACATTTTTGAGGG - Intergenic
980848043 4:138347904-138347926 GGTTTGTCCCTGAGTTTTCCTGG + Intergenic
980858985 4:138476369-138476391 GGGTGGCCACAGATTTATCAAGG - Intergenic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
982730984 4:158955253-158955275 GGTTGCTCACAGAATTTTCAAGG - Intronic
984935648 4:184887677-184887699 GGGTGGTCCCAGAGGTGAGAAGG - Intergenic
985730422 5:1544405-1544427 AGGTGGGCCCAGAGGCTTCAGGG + Intergenic
989106432 5:37867396-37867418 AGGTGGTGCCAGAGTTTGAATGG + Intergenic
993040015 5:82803785-82803807 GTGTGCTCCCAAACTTTTCATGG - Intergenic
995544133 5:113213421-113213443 TGGTGGTCTCACAGTGTTCATGG + Intronic
997716930 5:136049388-136049410 GGGGAGTGCCAGAGTCTTCAGGG + Intronic
998995232 5:147864265-147864287 GGGTGGGGCCAGAGTCTTCCCGG + Intergenic
1002160597 5:177312044-177312066 GAGTGGTCTCAGACTTTCCAGGG + Exonic
1003639243 6:7862794-7862816 AGGTGCTCCCAGGGTTTTGATGG - Intronic
1004006435 6:11641516-11641538 GGGTGGGCTCAGAATTGTCAGGG + Intergenic
1007829229 6:44625503-44625525 GGGTGTTCCCAGCCTTTTCTGGG - Intergenic
1008385331 6:50882878-50882900 GAGTTGCCCCAGGGTTTTCAAGG - Intergenic
1016122331 6:140359269-140359291 GGCTGATCTCAGAATTTTCAAGG + Intergenic
1018783411 6:167089796-167089818 TGCTGGGCCCACAGTTTTCATGG - Intergenic
1022805154 7:33814127-33814149 GCGTGTTCCCAGTGTTCTCATGG + Intergenic
1026869365 7:73841261-73841283 GGGTGGTCTCAGAGTCTGCCAGG + Intronic
1027343958 7:77238239-77238261 GTGTGTTCTCAGAGTTCTCAAGG + Intronic
1028238438 7:88389218-88389240 GGGAATTTCCAGAGTTTTCAGGG - Intergenic
1029973761 7:104814429-104814451 GGCTGATCCCAGAGCTTTTAAGG + Intronic
1032796685 7:135283008-135283030 GGGTGGACCCAGAGTTAACAAGG - Intergenic
1035934129 8:3818203-3818225 GGGTGGGCTCTGCGTTTTCATGG - Intronic
1036168758 8:6462993-6463015 GGACTGTCCCAGAGTTTTGAGGG - Intronic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1039893978 8:41703255-41703277 GGGTGGTTCCTGATCTTTCAGGG - Intronic
1041478833 8:58295654-58295676 CTCTGATCCCAGAGTTTTCAGGG + Intergenic
1042055905 8:64764590-64764612 GGGTTGTCTCAGTGTTTTCAGGG - Intronic
1042164586 8:65933328-65933350 GAGTGGTCCCTGAGTTTGCCAGG + Intergenic
1044866135 8:96572986-96573008 GGGAGGTCACACAGTTTTCCTGG - Intronic
1052118780 9:24682404-24682426 GGGAGCTCCCAGAGGTTACAAGG - Intergenic
1053433446 9:38059172-38059194 GGCTGGACCCAGAGTTCCCAGGG - Intronic
1054152953 9:61619963-61619985 GGGTGGTCACATTGTTTTCTGGG + Intergenic
1054180615 9:61906820-61906842 GGGTGGTCACATTGTTTTCTGGG - Intergenic
1054472741 9:65551166-65551188 GGGTGGTCACATTGTTTTCTGGG + Intergenic
1054656976 9:67674322-67674344 GGGTGGTCACATTGTTTTCTGGG + Intergenic
1055931671 9:81565670-81565692 GGGTGTTCCCAGTGATCTCAAGG + Intergenic
1057171304 9:92964865-92964887 GGGTGGTCCCAGACGTGTCCTGG + Intronic
1062729381 9:138100657-138100679 GGGAGGACACAGAGTGTTCAGGG + Intronic
1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG + Intergenic
1195655049 X:107325034-107325056 GGCTGATCCCAGGGCTTTCATGG - Intergenic
1198097278 X:133392378-133392400 AGATGGTCCCAGGGTGTTCAGGG - Intronic
1199426760 X:147711048-147711070 GGATGCTCCCAGAGTTTCTACGG + Intergenic
1200006585 X:153089286-153089308 AGGTGGTCCAAAAGTATTCAAGG - Intergenic