ID: 1182301452

View in Genome Browser
Species Human (GRCh38)
Location 22:29339516-29339538
Sequence TGACAAGGCGACGTGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182301439_1182301452 30 Left 1182301439 22:29339463-29339485 CCTCCAGGACATCAGAGAAGGGT 0: 1
1: 2
2: 1
3: 27
4: 443
Right 1182301452 22:29339516-29339538 TGACAAGGCGACGTGTCATGGGG 0: 1
1: 0
2: 1
3: 1
4: 35
1182301440_1182301452 27 Left 1182301440 22:29339466-29339488 CCAGGACATCAGAGAAGGGTTGT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1182301452 22:29339516-29339538 TGACAAGGCGACGTGTCATGGGG 0: 1
1: 0
2: 1
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182301452 Original CRISPR TGACAAGGCGACGTGTCATG GGG Intronic
918325027 1:183401902-183401924 TGACATGGGGGCCTGTCATGGGG + Intronic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1078160207 11:8833449-8833471 TGAGAAGGGGAAGTGTCATCTGG - Intronic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1085652588 11:78281615-78281637 TGAAAAGGGGACAGGTCATGTGG - Intronic
1102561072 12:113762658-113762680 TGCCATGGCAACGTCTCATGTGG - Intergenic
1123774428 15:23565174-23565196 TGACAAGGCGCCGTTTCTTTTGG - Intergenic
1130995028 15:88898879-88898901 AGACAAGGGGAAGTGTCTTGGGG + Exonic
1133228901 16:4357044-4357066 TGTGAAGGGGACGTGACATGTGG + Intronic
1134075812 16:11290548-11290570 TGACAAGGCCACCTATAATGTGG - Intronic
1135714328 16:24748496-24748518 TTACAAGCAGAAGTGTCATGTGG - Intronic
1138054813 16:53821594-53821616 TGACAAAGAGAAGAGTCATGTGG - Intronic
1139099860 16:63752474-63752496 TGACAAGGCCTAGTGACATGTGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1160585761 18:79912528-79912550 TCACCAGGCCACGTGTCATCAGG + Intronic
927075412 2:19572032-19572054 TGAGAAGGAGACCTGTCATTAGG + Intergenic
934689255 2:96345687-96345709 GGACATGGTGAAGTGTCATGAGG + Intronic
938029848 2:127982741-127982763 TGACAAAGCGAAGTGGGATGGGG + Intronic
940620816 2:156110902-156110924 AGACAAGCAGACGTGACATGGGG - Intergenic
942114876 2:172718658-172718680 TGATAAGGCAAGGTCTCATGGGG + Intergenic
943172793 2:184425188-184425210 TGACAAGCCAACATGTCATGTGG + Intergenic
948258844 2:236588274-236588296 TGGCACGGCAACATGTCATGGGG + Intergenic
1176066179 20:63197219-63197241 TAACAAGGTGCTGTGTCATGTGG + Intronic
1182301452 22:29339516-29339538 TGACAAGGCGACGTGTCATGGGG + Intronic
1185302499 22:50089891-50089913 TGACAAGGCGAGGTGCCTGGTGG - Intronic
956345496 3:68273346-68273368 TTACAAGGCCACGTGTGATCTGG - Intronic
957000939 3:74883958-74883980 AGACCAGCTGACGTGTCATGAGG - Intergenic
961602255 3:128071261-128071283 AGACAAGGCCACGTGTGATAGGG - Exonic
964429406 3:156589196-156589218 TGACAAGGGGAAGAGTCAGGGGG - Intergenic
965072590 3:163934763-163934785 TGCAAAGGCCACCTGTCATGAGG + Intergenic
984214495 4:176892503-176892525 TGACAAGGCCACGTGACAGAAGG + Intergenic
990805524 5:59656477-59656499 TGTTAAGTCCACGTGTCATGTGG + Intronic
994176805 5:96719902-96719924 TGATAATGTGACCTGTCATGCGG - Intronic
1006844910 6:37055503-37055525 TGGCAAGGTGAGGTGTCAGGTGG - Intergenic
1014503237 6:122220633-122220655 TGACAAGTCTATGTGTTATGTGG + Intergenic
1026483839 7:70800971-70800993 TGACATGGGGCAGTGTCATGGGG - Intergenic
1187053206 X:15714687-15714709 TGTCAAGGCGATGAGTGATGAGG - Intronic
1189296844 X:39924520-39924542 TCACAAGCTGACATGTCATGAGG + Intergenic