ID: 1182311560

View in Genome Browser
Species Human (GRCh38)
Location 22:29412387-29412409
Sequence GGCAGCGCTCCCGAGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182311553_1182311560 1 Left 1182311553 22:29412363-29412385 CCCCCAGTTCTTGGCCAGGGCAG No data
Right 1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG No data
1182311554_1182311560 0 Left 1182311554 22:29412364-29412386 CCCCAGTTCTTGGCCAGGGCAGT 0: 2
1: 0
2: 4
3: 21
4: 220
Right 1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG No data
1182311547_1182311560 30 Left 1182311547 22:29412334-29412356 CCCAGAAATATGTTTCAACTAGA 0: 2
1: 0
2: 1
3: 20
4: 297
Right 1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG No data
1182311556_1182311560 -2 Left 1182311556 22:29412366-29412388 CCAGTTCTTGGCCAGGGCAGTGG 0: 2
1: 0
2: 1
3: 22
4: 227
Right 1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG No data
1182311552_1182311560 2 Left 1182311552 22:29412362-29412384 CCCCCCAGTTCTTGGCCAGGGCA 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG No data
1182311555_1182311560 -1 Left 1182311555 22:29412365-29412387 CCCAGTTCTTGGCCAGGGCAGTG 0: 2
1: 0
2: 1
3: 13
4: 224
Right 1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG No data
1182311548_1182311560 29 Left 1182311548 22:29412335-29412357 CCAGAAATATGTTTCAACTAGAC 0: 2
1: 0
2: 0
3: 18
4: 165
Right 1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182311560 Original CRISPR GGCAGCGCTCCCGAGTAGCA GGG Intronic
No off target data available for this crispr